Method for identifying low-temperature weak-light phenotype of muskmelon and special primer thereof

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a method for identifying low-temperature weak-light phenotypes of muskmelons and special primers thereof. The leaf DNA of the muskmelon breeding material is amplified through a specific molecular marker combination, and whether the material is a low-temperature-resistant and weak-light-resistant material or not is judged according to amplified specific fragments. According to the technology, the low-temperature weak-light tolerance of the muskmelon material can be preliminarily judged without planting the muskmelon material to the fruiting period and measuring phenotype and physiological indexes of the plant, so that the screening efficiency of the breeding material is greatly improved.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a method for identifying the low-temperature, low-light phenotype of melons and its dedicated primers. Background Technology

[0002] my country ranks first in the world in both melon cultivation area and yield. Early spring planting can significantly improve the economic benefits of melons and is an important planting season. However, in early spring, the outside temperature is low and there is frequent rainy weather. Melon seedlings in greenhouses are exposed to low temperature (<15℃) and low light (3000-4000 lux) for extended periods, resulting in slowed growth and physiological damage. Therefore, breeding melon varieties tolerant to low temperature and low light is an important goal in melon breeding both domestically and internationally. Screening molecular markers related to the low temperature and low light tolerance of melons for breeding material selection has important theoretical and practical significance for breeding low temperature and low light tolerant varieties suitable for greenhouse cultivation.

[0003] Existing technologies identify breeding materials using phenotypic or physiological indicators related to low-temperature and low-light characteristics. Phenotypic indicators include leaf SPAD value, root length, and root fresh weight, while physiological indicators include root activity, malondialdehyde (MDA) content, and chlorophyll content. Using morphological and physiological indicators to identify plant low-temperature and low-light characteristics often suffers from cumbersome measurement procedures and unstable results. For example, root activity and MDA content require cleaning the plant roots, which is tedious, but data reliability is high when root cleanliness is high. Therefore, existing traditional breeding phenotypic and physiological data collection techniques suffer from drawbacks such as high cost and low efficiency.

[0004] Therefore, there is an urgent need to develop a new method to improve the screening efficiency of melon breeding materials resistant to low temperature and low light. Summary of the Invention

[0005] The purpose of this invention is to provide a method for identifying the low-temperature and low-light phenotype of melons and its dedicated primers. The dedicated primers provided by this invention can specifically detect melon materials with a low-temperature and low-light phenotype, thereby improving the screening efficiency of melon breeding materials.

[0006] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a specific primer composition for identifying the low-temperature, low-light phenotype of melons. The specific primer composition includes Mel-Hs-1-F and Mel-Hs-2-R, as well as two specific primer pairs, Mel-Hs-3-F and Mel-Hs-4-R.

[0007] Preferably, the nucleotide sequences corresponding to Mel-Hs-1-F, Mel-Hs-2-R, Mel-Hs-3-F and Mel-Hs-4-R in the primer pairs are shown in SEQ ID NO.1-4, respectively.

[0008] The present invention also provides a kit for identifying the low-temperature, low-light phenotype of melons, the kit comprising the above-mentioned specific primer composition.

[0009] This invention also provides a method for identifying the low-temperature, low-light phenotype of melons, comprising the following steps: S1. DNA extraction: Collect young melon leaves and extract total genomic DNA from the leaves using the CTAB method; S2. PCR amplification: The total genomic DNA was subjected to a PCR reaction using the above-mentioned specific primer combination to obtain PCR amplification products; S3. Data collection and analysis: The PCR amplification products were stained with fluorescence and then electrophoresed. The results were observed using a gel imaging system. Among them, a PCR amplification product fragment of 506 bp indicates a phenotype resistant to low temperature and low light; a PCR amplification product fragment of 938 bp indicates a phenotype intolerant to low temperature and low light.

[0010] Preferably, the PCR reaction system is 10 µL, comprising 5 µL 2×Taq MasterMix (Dye), 2 µL primers (5 mM), 2 µL DNA (10 ng / µL), and 1 µL ultrapure water.

[0011] Preferably, the amplification program for the PCR reaction is as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s; annealing at 50°C for 30 s; extension at 72°C for 10 s; 35 cycles; final extension at 72°C.

[0012] Preferably, the fluorescent staining in step S3 is performed using 2.5% high-resolution standard gel agarose with the addition of 20 μL ethidium bromide.

[0013] The present invention also provides the application of the above-mentioned specific primer composition or the above-mentioned method in identifying melons with a low-temperature and low-light phenotype.

[0014] The beneficial effects of this invention are: This invention utilizes two pairs of specific primers, Mel-Hs-1-F and Mel-Hs-2-R, and Mel-Hs-3-F and Mel-Hs-4-R, for multiplex PCR amplification, which significantly improves the detection efficiency of single plants resistant to low temperatures and low light conditions as well as those intolerant to low temperatures and low light conditions. Compared with conventional morphological identification, this method is unaffected by environmental conditions, saves manpower, material resources, and land data, and improves identification efficiency. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 Phenotypes of heat-resistant parent P143 and heat-insensitive parent P149 and their F1 before and after heat treatment; Figure 2 Normal distribution of total leaf area growth trait in F2 population; Figure 3 The QTL mapping results are for leaf area (LA). Figure 4 The electrophoresis results of the amplified fragments are shown in the figure. M represents the marker (50-500 bp), and 1-20 represent 20 F2 single plants. Detailed Implementation

[0017] This invention provides a rapid identification method for molecular markers related to low temperature and low light in melon. The identification method includes PCR amplification of DNA from young melon leaves using specific primers Mel-Hs-1-F, Mel-Hs-2-R, Mel-Hs-3-F, and Mel-Hs-4-R.

[0018] The sequence information of the specific primers Mel-Hs-1-F, Mel-Hs-2-R, and Mel-Hs-3-F and Mel-Hs-4-R is as follows: Mel-Hs-1-F: CTAAGACGCTCTGATTAGGGAC (SEQ ID NO. 1); Mel-Hs-2-R: ACGCTTACTATGGCCGGTAAAG (SEQ ID NO. 2); Mel-Hs-3-F: AGTCTTCAAATCGTGGATGG (SEQ ID NO.3); Mel-Hs-4-R:CTTGGGGTGAGTTTTCTTACAAG (SEQ ID NO. 4).

[0019] The PCR amplification of the low-temperature, low-light resistant fragments by Mel-Hs-1-F and Mel-Hs-2-R yielded a size of 506 bp, with the specific sequences as follows: CACTGCAAATGGACAAAAACCAGAACTCGAGAAAATCAAAAGCGATATATAATCAAGAACTATATCAAAAACCTCGGCACAAAACTCCAAAAGAAATCGTAAATAAACCCTACAGTTAAACTCATAAAAAAAGCAACAACCTAAGACGCTCTGATTAGGGACATACCTTCTCCAAACTCGAACAACCTAAATTCATTTCTTAAGCAACAAGAAGAACTCCATAGAACCAGAACTCAAAGCGCCAAAAAAAAAAAAAAAAAAAGAAGAAAAAGAAAAACTTACCGAAAACAGTGTTAATCGGGTTCATGGCGACCTGATTCTTAGCTGCATCACCGATCAAGCGCTCAGAGTCGGTGAAAGCAACATACGACGGCGTCGTCCTGTTGCCCTGATCGTTGGCAATGATCTCAACTCGATCATGCTGCCACACACCAACGCAAGAGTACGTGGTTCCAAGATCAATTCCGATCGCCGTACCTTCTCCTTTACCGGCCATAGTAAGCGTG(SEQ ID NO.5)。

[0020] Among them, the size of the low-temperature and low-light-intolerant fragments of Mel-Hs-3-F and Mel-Hs-4-R amplified by PCR was 938 bp.The specific sequence is as follows: TAAGTCTTCAAATCGTGGATGGAAAAAAGAATCTAGGATGATAAGAAATGAAAGTAAAAAAATTTGATTGGTGGCTGCAGAATTTAGGGTTAGAAGATTTCAAAGTTATAAGGAGGAAGAAGAGAGGAGGAGAATTTATAAAAAACCTTTAAGGAAAAAGAAAAGGTTCTAGAGAGTTCTAATGGAAAAGATACGAAGGCTGAAAAGTTATTTGTGTTTGGCGTATGAACATACAAAATATAATGTCGACCGTTACTTTTTCTACTCTCTAGGTTTTTCTAGAACTTTCTTTTCCCCTTTCTTTATTAATAATCTACATTCTATAACATATTTGTAGAATAATCTTTTATAACCTTTTCGCCCTTCTCTTTTTAGTTAATTCCTACCTTTTCCTTTGTTTAAGATGGGATAAAAACTCTCGTGGATGAGTCTTTTTTTTTTTTTTTTTATTAGTGTAATCTAACGGATACTATTCAATCTTAAAAAAAATGTACGATTTGTATATACTATATGACTCATATCAAGTATTAATATTGAAAGTTTTTTTTCTTCAACTATTCAATACAATTTTAAAACTTTAATATCATTCAAGATATGTTGAACTAAACACTTTTGATATTAACTTGAAACATCAAAGTGAACTTGACATAACACTATACTTGGGTGAGTTTTCTTACAAGTTAGCTCGAAAATACTGAAAGAAAACAAAAAATTACCAAACAAAATATGTACATCAATAAACGGGACAAAATAACATTTTAGCCACTTTAAAGTTTGTTTAACTTTTGTTCTTATATTTTTAAAAATTTAATTTTATGTATTTGCATCTTTTTATAAAACCTAAATTTAATCATCAAGATAATTTATTGTCTTTTATTTTATTTATGTTCCTTTTAGCATTTTTAATGGCATATTTATCTGAGAATATTCTAGCATCA (SEQ ID NO.6).

[0021] The identification method provided by this invention includes the following steps: (1) Sampling: Take young melon leaves and store them at -80℃; (2) DNA extraction: Total genomic DNA was extracted from fresh leaves using the CTAB method; (3) PCR amplification: Four specific primers, Mel-Hs-1-F and Mel-Hs-2-R, as well as Mel-Hs-3-F and Mel-Hs-4-R, were simultaneously in one reaction system. The mixed system was 10 µL, including 5 µL of 2×Taq MasterMix (Dye), 2 μL of primers (5 mM) (0.5 μL of each primer), 2 μL of DNA (10 ng / μL), and 1 μL of ultrapure water.

[0022] The PCR amplification program was as follows: pre-denaturation at 94℃ for 2 min; denaturation at 94℃ for 30 s, annealing at 50℃ for 30 s, extension at 72℃ for 10 s, for 35 cycles; final extension at 72℃. The amplified products were subjected to electrophoresis on a 2.5% high-resolution standard agarose gel with 20 µL of ethidium bromide added for 2 h at 200 V. After electrophoresis, the results were observed using a gel imaging system.

[0023] (5) Data collection and analysis: A single plant amplification fragment of 506 bp indicates tolerance to low temperature and low light, while a single plant amplification fragment of 938 bp indicates intolerance to low temperature and low light.

[0024] The bin-map method used in this invention is a genetic map construction method based on high-throughput sequencing data. This method involves constructing a genetic population, sequencing each individual organism within the population, and examining its phenotype. Then, using SNP information from the sequencing data, chromosomes are divided into multiple bins (i.e., genetic regions) using a sliding window approach, with each bin representing a relatively stable genetic region.

[0025] In the construction of the bin-map, a single plant is first selected as a reference. The SNPs on its chromosome are observed using a plot to identify approximate homozygous and heterozygous regions. Then, the SNP sum value within each window is calculated using a sliding window approach to obtain the genotypes on the chromosome that convert to that window. Next, incorrect genotypes are corrected based on the genotype information surrounding the window, and recombination breakpoints on the chromosome are identified based on the window genotype information, thus constructing bins on the chromosome of the selected single plant. Finally, bin estimation is performed on the chromosome of each material in the population, and these breakpoints are arranged along the chromosome from beginning to end to integrate them into the complete chromosome. binmap .

[0026] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0027] Unless otherwise specified, the production processes, experimental methods, or testing methods involved in the embodiments of this invention are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, which are very clear and distinct in the relevant application areas. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0028] The various instruments, equipment, raw materials or reagents used in the embodiments of this invention are not subject to any special restrictions on their source. They are all conventional products that can be purchased through regular commercial channels and can be prepared according to conventional methods known to those skilled in the art.

[0029] Example 1: Using bin-map to locate genes related to low temperature and low light tolerance in melons 1. Materials and Methods 1.1 Materials F1 generation was obtained by crossing the low-temperature and low-light tolerant melon parent P143 with the low-temperature and low-light sensitive melon parent P149. After self-pollination, an F2 generation population containing 166 individual plants was constructed. The parents, F1, and F2 populations were sown in 32-cell trays under normal conditions of 28 / 18℃ (day / night) and 5000 μmol / (m²). 2 •s) Cultivate to the two-leaf-one-heart stage.

[0030] 1.2 Phenotypic Data Collection The low-temperature, low-light treatment conditions were 15 / 8℃ (day / night) and 100 μmol / (m 2 •s). Leaf area (LA) was calculated for the P143, P149, F1, and F2 populations before and after low temperature and low light treatment. Differences in parental phenotypic data were compared, and normal distribution was tested for 166 individual plant phenotypic data from the F2 population.

[0031] 1.3 Genotype Data Collection After the low-temperature and low-light treatment, the culture conditions were adjusted to normal conditions, and plant growth recovered. Young leaves were collected from individual plants of the parental lines, F1, and F2 populations. The parental lines and F1 plants underwent resequencing, while 166 F2 individual plants were subjected to RAD sequencing. Using GCF_025177605.1_USDA_Cmelo_AY_1.0_genomic.fa as the reference genome, the following sequencing was performed: Binmap Construction and QTL analysis.

[0032] 1.4 Binmap Construction and QTL Analysis Binmap construction employs a sliding window approach, selecting 15-20 markers per window and sliding one marker at a time to determine the genotypes within that window and the exchange sites for each progeny material, resulting in a parental genotype map for each progeny material. The genetic distances of all Bin markers are calculated using the Kosambi algorithm in MSTmap software to create the Binmap. QTL_Cartographer software is then used with CIM (Compound Interval Mapping) to locate QTL markers in the Bin genotype and phenotypic data. A model of 6 is selected, and the LOD threshold is determined after 1000 iterations, choosing an appropriate LOD value corresponding to the alpha.

[0033] 2 Results 2.1 Plant characteristics of P143 and P149-1 and their tolerance to low temperature and low light stress After treatment with low temperature and low light, P149 exhibited excessive hypocotyl and internode elongation, and its total leaf area growth was significantly lower than that of P143, indicating that P149 was sensitive to low temperature and low light. In contrast, P143 showed shorter, more robust hypocotyls and more robust growth, demonstrating tolerance to low temperature and low light. Figure 1 In the F2 population, the total leaf area growth trait follows a normal distribution. Figure 2 ), which can be used for QTL positioning.

[0034] The results of multiple comparisons of leaf area phenotype data of the parents P143 and P149 and their F1 are shown in Table 1.

[0035] Table 1. Results of multiple comparisons of leaf area phenotypic data of parental lines P143 and P149 and their F1 generations.

[0036] 2.2 Construction of High-Density Binmap for Melon Using 166 F2 individual plants, a total of 1098 Bin markers were obtained. The constructed high-density Binmap for melon had a total map distance of 3954.56 cM, encompassing 12 chromosomes, with an average genetic distance of 3.51 cM per marker. Detailed map information is shown in Table 2.

[0037] Table 2. Binmap information for melons

[0038] 2.3 QTL positioning of melon's resistance to low temperature and low light The QTL for the total leaf area growth trait in chr09, with an α=0.05 threshold and a LOD value of 4.05, is located in the Tg09_bin27 interval (5302208-5417189 bp), with a total length of 1.15 Mbp, containing 8 genes. Six of these genes... transcription factor , geranylgeranyl transferaseRING-H2 finger protein , serine / threonine-protei n、 Heat shock cognate 70 kDa transfer RNA proline All of these are associated with plant stress expression and are candidate target regions for the low-temperature and low-light tolerance characteristics of melons. Figure 3 ).

[0039] 2.4 Tag Development and Validation The heat shock cognate gene, 70 kDa, is overexpressed under low temperature and low light conditions and exerts a protective function on cells. Based on the sequence differences of the heat shock cognate gene LOC103498170 in parental strains P143 and P149-1, two pairs of multiplex PCR markers were developed.

[0040] Mel-Hs-1-F:CTAAGACGCTCTGATTAGGGAC (SEQ ID NO. 1); Mel-Hs-2-R:ACGCTTACTATGGCCGGTAAAG (SEQ ID NO. 2); Mel-Hs-3-F: AGTCTTCAAATCGTGGATGG (SEQ ID NO.3); Mel-Hs-4-R:CTTGGGGTGAGTTTTCTTACAAG (SEQ ID NO. 4).

[0041] The results are shown in Table 3 and Figure 4 The results show that the marker amplified a fragment of 506 bp in a single plant to indicate tolerance to low temperature and low light, and a fragment of 938 bp in a single plant to indicate intolerance to low temperature and low light. The marker was specifically amplified in 20 F2 single plants, and the marker-determined low temperature and low light tolerance characteristics of the single plant corresponded well with the low temperature and low light tolerance phenotype.

[0042] Table 3

[0043] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A specific primer composition for identifying the low-temperature, low-light phenotype of melon, characterized in that, The specific primer composition includes Mel-Hs-1-F and Mel-Hs-2-R, as well as two specific primer pairs, Mel-Hs-3-F and Mel-Hs-4-R.

2. The specific primer composition according to claim 1, characterized in that, The nucleotide sequences corresponding to Mel-Hs-1-F, Mel-Hs-2-R, Mel-Hs-3-F and Mel-Hs-4-R in the primer pairs are shown in SEQ ID NO.1-4, respectively.

3. A reagent kit for identifying the low-temperature, low-light phenotype of melons, characterized in that, The kit contains the specific primer composition of claim 1.

4. A method for identifying the low-temperature, low-light phenotype of melons, characterized in that, Includes the following steps: S1. DNA extraction: Collect young melon leaves and extract total genomic DNA from the leaves using the CTAB method; S2. PCR amplification: The total genomic DNA is subjected to PCR reaction using the specific primer composition described in claim 1 to obtain PCR amplification products; S3. Data collection and analysis: The PCR amplification products were stained with fluorescence and then electrophoresed. The results were observed using a gel imaging system. Among them, a PCR amplification product fragment of 506 bp indicates a phenotype resistant to low temperature and low light; a PCR amplification product fragment of 938 bp indicates a phenotype intolerant to low temperature and low light.

5. The method according to claim 4, characterized in that, The PCR reaction system consisted of 10 µL, including 5 µL of 2×Taq MasterMix (Dye), 2 µL of primers (5 mM), 2 µL of DNA (10 ng / µL), and 1 µL of ultrapure water.

6. The method according to claim 4, characterized in that, The amplification program for the PCR reaction was as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s; annealing at 50°C for 30 s; extension at 72°C for 10 s; 35 cycles; final extension at 72°C.

7. The method according to claim 4, characterized in that, The fluorescent staining in step S3 is performed using 2.5% high-resolution standard gel agarose with 20 μL ethidium bromide added.

8. The application of the specific primer composition of claim 1 or the method of claim 4 in identifying melons with a low-temperature and low-light phenotype.

Images