KASP molecular marker related to pod number and grain number characters of soybean single plant and application of KASP molecular marker

By developing KASP molecular markers associated with the number of pods and seeds per soybean plant, efficient screening and marker-assisted breeding of soybeans were achieved, solving the problem of low breeding efficiency in existing technologies and improving the accuracy of soybean yield trait screening and breeding efficiency.

CN122012797APending Publication Date: 2026-05-12黑龙江省农业科学院大豆研究所(黑龙江农业科技杂志社)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610436961.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-03
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently screen and utilize superior alleles related to the number of pods and seeds per plant in soybean breeding, resulting in low breeding efficiency, long cycles, and difficulty in meeting the demand for increased soybean yield.

Method used

We developed KASP molecular markers associated with the number of pods and seeds per soybean plant, and used molecular marker-assisted selection through genotype detection to screen for materials with high pod and seed counts per plant. We then used KASP molecular marker primer combinations for PCR amplification and fluorescence signal analysis to rapidly identify genotypes.

Benefits of technology

It improves the accuracy and efficiency of screening for traits such as the number of pods and seeds per soybean plant, reduces field workload, shortens the breeding cycle, and increases soybean yield per unit area.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012797A_ABST
    Figure CN122012797A_ABST
Patent Text Reader

Abstract

The invention discloses a KASP molecular marker related to the pod number character and the grain number character of a soybean single plant and application of the KASP molecular marker, and belongs to the technical field of soybean agronomic character molecular marker development and molecular marker assisted breeding. The KASP molecular marker related to the pod number character and the grain number character of the soybean single plant is located at the 45649932 bp site of the No.19 chromosome of the Wm82. A4. V1 version of the soybean genome, and the genotype of the KASP molecular marker is A or T. The invention provides a novel and simple molecular marker and an auxiliary selection method, which are suitable for rapid screening of relative height of pod number and grain number of single soybean plant and molecular marker auxiliary breeding. The molecular marker can be used for detecting genotypes of materials with different single plant pod numbers and grain numbers in natural populations, can also be used for molecular-assisted selective breeding of soybean materials with different single plant pod numbers and grain numbers, replaces large-scale phenotypic screening, reduces the field workload, and remarkably improves the screening accuracy and efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker development for soybean agronomic traits and molecular marker-assisted breeding technology, and more specifically to KASP molecular markers related to the number of pods and seeds per soybean plant and their applications. Background Technology

[0002] Soybeans, as an important economic grain and oil crop in my country, are highly sought after globally due to their rich nutritional and medicinal value. They not only contain basic nutrients such as isoflavones, high-quality protein, various essential amino acids, and unsaturated fatty acids, but are also rich in various bioactive substances, including soy isoflavones, soy peptides, soy phospholipids, soy oligosaccharides, and soy saponins. Modern medical research has confirmed that these active ingredients have significant anti-tumor, lipid-lowering, and cardiovascular disease prevention effects, demonstrating enormous development potential in the fields of functional foods and medicine.

[0003] Soybean yield traits are genetically characterized as a complex trait controlled by multiple quantitative trait loci (QTLs). Traditional breeding methods suffer from inherent drawbacks such as long cycles, low efficiency, and limited yield increases. However, with breakthroughs in molecular biology techniques, particularly the increasing maturity of high-throughput sequencing and gene editing technologies, fine gene regulation technology offers a novel approach to the precise aggregation and efficient utilization of superior alleles. This technological breakthrough is considered a core technology for breeding breakthrough soybean varieties and an essential path to improving future soybean breeding capabilities.

[0004] To achieve this goal, the first step is to systematically conduct the discovery and accumulation of superior alleles, while simultaneously developing high-precision molecular markers—these fundamental efforts constitute the prerequisites for fine gene regulation and multi-gene aggregation. Specifically, this requires utilizing genome-wide association studies (GWAS), transcriptomics, and other technologies to establish a comprehensive genotype-phenotype association database; developing a high-density SNP marker system covering the entire genome; and constructing a novel breeding system combining marker-assisted selection (MAS) and genome selection (GS). Through these systematic efforts, the ultimate goal is to shift from an "empirical breeding" model to a "precision design breeding" model, providing strong scientific and technological support for the high-quality development of my country's soybean industry.

[0005] The number of pods and seeds per soybean plant are direct components of yield, and their genetic analysis is of great significance for high-yield breeding. Studies have shown a significant positive correlation between the number of pods and seeds per soybean plant, and both exhibit high heritability. According to the Soybase database, more than 150 QTLs related to pod number and more than 120 QTLs related to seed number have been located. These loci are widely distributed on all soybean chromosomes except chromosome 12, with several densely distributed regions of pod number QTLs on chromosomes 6, 8, 13, 17, and 19. Zhang Lei et al. (2018) identified seven SNP loci significantly associated with the number of pods per plant in cultivated soybean populations through genome-wide association analysis. These SNPs were located on chromosomes 5, 9, and 16, and two of these loci were found to be adjacent to known flowering genes, revealing the regulatory role of the photoperiod pathway in pod number formation. Zhang Qingqi et al. (2020) further utilized a chromosome segment substitution line population to finely locate a major QTL that simultaneously controls the number of pods and seeds per plant in the qPod17.1 region of chromosome 17. Its enhancing allele can increase the number of pods per plant by 12.3% and the number of seeds by 9.7%, providing a precise target for molecular marker-assisted selection.

[0006] In 2021, China's total soybean production reached 16.4 million tons. However, facing the demands of a large population and the needs of economic development, continuously increasing soybean yield per unit area remains the core objective of breeding work. Precisely locating QTLs for pod number and grain number per plant using marker-assisted selection (MAS) and genome selection (GS) technologies can significantly improve breeding efficiency and accelerate the development of high-yielding soybean varieties. Simultaneously, in-depth exploration of the regulatory genes for pod number and grain number per plant provides new insights into constructing a genetic regulatory network for yield traits. The pod number and grain number per soybean plant are not only important breeding targets but also ideal entry points for studying soybean domestication, genetic evolution, and molecular regulatory mechanisms. Future research combining multi-omics analysis and gene editing technologies to further elucidate their genetic basis will provide crucial scientific support for molecular design breeding and the development of breakthrough varieties.

[0007] Therefore, providing KASP molecular markers related to the traits of pod number and seed number per soybean plant and their applications is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0008] In view of this, the present invention provides KASP molecular markers related to the number of pods and seeds per soybean plant and their uses.

[0009] The molecular markers obtained in this invention are closely linked to the traits of pod number and grain number per soybean plant, and can be used for assisted selection breeding to screen soybean materials with different pod numbers and grain numbers per plant and their offspring.

[0010] To achieve the above objectives, the present invention adopts the following technical solution:

[0011] To achieve the screening function, this invention provides a KASP molecular marker for identifying different pod numbers and seed numbers per soybean plant. The molecular marker is an SNP mutation marker located at 45649932 bp on chromosome 19 of soybean genome Wm82.a4.v1, with the sequence of the first and last 50 bp as shown in SEQ ID NO.1 or SEQ ID NO.2.

[0012] The KASP molecular marker genotype is A or T; the sequence of the A genotype within 50 bp before and after it is shown in SEQ ID NO.1, and the corresponding phenotype is low pod number and seed number per plant; the sequence of the T genotype within 50 bp before and after it is shown in SEQ ID NO.2, and the corresponding phenotype is high pod number and seed number per plant.

[0013] AGAAGAAAAAATTGCTTGTGTGATTGGTGACCGATCAACTAGTGATGTTG A TGTGAGGCTACGCACACAGGAAGGTCGAGATGATTGGCTATACTGCCACT; SEQ ID NO.1.

[0014] AGAAGAAAAAATTGCTTGTGTGATTGGTGACCGATCAACTAGTGATGTTG T TGTGAGGCTACGCACACAGGAAGGTCGAGATGATTGGCTATACTGCCACT; SEQ ID NO. 2.

[0015] In addition, this invention also provides a KASP molecular marker primer combination for identifying the number of pods and seeds per soybean plant, the primer sequences of which are as follows: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCT CCTGTGTGCGTAGCCTCACAT -3';SEQ ID NO.3.

[0016] Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATT CCTGTGTGCGTAGCCTCACAA -3';SEQ ID NO.4.

[0017] Reverse primer R: 5'-GTCTCTCTTCTGTGTCTGTTATTAGTGG-3'; SEQ ID NO. 5.

[0018] This invention also provides KASP molecular markers related to the number of pods and seeds per soybean plant and their uses for molecular-assisted selection breeding of soybean materials or their offspring with different numbers of pods and seeds per plant.

[0019] Specifically, the application of the KASP molecular marker or the KASP molecular marker primer combination in identifying or assisting in the identification of the number of pods and seeds per soybean plant.

[0020] The above molecular markers can be used to carry out molecular-assisted selection breeding for soybeans with high pod number and seed number per plant: The KASP molecular markers designed and developed are closely linked to traits of high pod number and seed number per plant. These markers can be used for preliminary screening of soybean varieties with high pod and seed number per plant, thus achieving marker-assisted breeding and accelerating the breeding process. In production, these molecular markers can also be used to detect high pod and seed number per plant during the seedling stage, screening for plants with high pod and seed number traits, improving soybean photosynthetic efficiency, promoting dry matter accumulation, and ultimately increasing soybean yield per unit area.

[0021] A method for identifying the number of pods and seeds per soybean plant includes the following steps: (1) Extract genomic DNA from soybean samples to be tested; use the KASP molecular marker primer combination to perform PCR amplification of soybean sample genomic DNA on ABI Stepone PCR instrument; use ABI Stepone PCR instrument to detect fluorescence signal and analyze genotyping.

[0022] (2) Judgment based on genotype results: When the genotype result of the sample is consistent with the genotype AA of soybean material with high number of pods and grains per plant, the soybean sample being identified exhibits the trait of low number of pods and grains per plant; when the genotype result of the sample is consistent with the genotype TT of material with low number of pods and grains per plant, the soybean sample being identified exhibits the trait of high number of pods and grains per plant.

[0023] As can be seen from the above technical solution, compared with the prior art, this invention discloses KASP molecular markers related to the traits of pod number and grain number per soybean plant and their applications. Based on the obtained KASP markers of soybean genes regulating pod number and grain number per plant, a novel and simple molecular marker and marker-assisted selection method is provided, suitable for rapid screening and marker-assisted breeding of soybean plants with relatively high or low pod number and grain number. This molecular marker can detect the genotypes of materials with different pod and grain numbers per plant in natural populations, and can also be used for molecular-assisted selection breeding of soybean materials with different pod and grain numbers per plant, replacing large-scale phenotypic screening, reducing field workload, and greatly improving the accuracy and efficiency of screening. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0025] Figure 1 The molecular marker gene typing map and phenotypic association verification results of natural soybean populations with different pod numbers and grain numbers per plant in this invention; Allele1 / Allele1 represents FAM, indicating genotype AA; Allele2 / Allele2 represents HEX, indicating genotype TT; yellow indicates negative control with no signal. Detailed Implementation

[0026] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] Example 1: Development and validation of KASP molecular markers for pod number and grain number traits in soybean plants By screening molecular markers, the KASP molecular marker closely linked to the traits of pod number and seed number per soybean plant was finally obtained. The primer combination sequence for this molecular marker is as follows: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCT CCTGTGTGCGTAGCCTCACAT -3';SEQ ID NO.3.

[0028] Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATT CCTGTGTGCGTAGCCTCACAA -3';SEQ ID NO.4.

[0029] Reverse primer R: 5'-GTCTCTCTTCTGTGTCTGTTATTAGTGG-3'; SEQ ID NO. 5.

[0030] The SNP marker is located at 45649932 bp on soybean chromosome 19. The molecular marker is an SNP mutation marker, divided into A genotype and T genotype. The 50 bp sequences before and after the molecular marker site are as follows: AGAAGAAAAAATTGCTTGTGTGATTGGTGACCGATCAACTAGTGATGTTG A TGTGAGGCTACGCACACAGGAAGGTCGAGATGATTGGCTATACTGCCACT; SEQ ID NO.1.

[0031] or AGAAGAAAAAATTGCTTGTGTGATTGGTGACCGATCAACTAGTGATGTTG T TGTGAGGCTACGCACACAGGAAGGTCGAGATGATTGGCTATACTGCCACT; SEQ ID NO. 2.

[0032] The number of pods and seeds per plant in natural soybean populations was measured, as follows: (1) DNA extraction Genomic DNA was extracted from natural soybean populations using the CTAB method.

[0033] (2) PCR amplification The PCR reaction system consisted of: 5.0 μl of 30-50 ng / μl soybean genomic DNA, 5.0 μl of KASP Master Mix, and 0.14 μl of KASP Assay Mix (primer concentrations were all 10 ng / μl and met the molar ratio of F-HEX:F-FAM:R=2:2:5), for a total volume of 10.14 μl.

[0034] The PCR reaction program was as follows: 30℃, 1 minute (read fluorescence signal); 94℃, 15 minutes (pre-denaturation); 94℃, 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing for 60 seconds, 10 cycles; 94℃, 20 seconds (denaturation); 55℃, annealing for 60 seconds, 31-35 cycles. 30℃, 1 minute (read fluorescence signal).

[0035] PCR amplification was performed on the ABI Step One PCR instrument, and the genotyping information could be obtained directly after the instrument detected the fluorescence signal.

[0036] The forward primers F-HEX and F-FAM each have their own fluorescent adapters (displayed as different colors on the genotyping map, e.g., red for AA genotype, blue for TT genotype, and green for AT genotype). If the material being tested is homozygous, only one corresponding primer will be selected for amplification. The fluorescence difference indicates whether the tested material is homozygous AA or TT genotype. If the material being tested is heterozygous, both primers will amplify, producing a third fluorescent signal, thus distinguishing heterozygous genotypes.

[0037] The results for the natural population are shown in Table 1.

[0038] Table 1 Genotyping data of natural populations and data on pod and seed count per plant

[0039] Note: - indicates no data.

[0040] like Figure 1 (Where red represents the AA genotype with low pod and grain number per plant; blue represents the TT genotype with high pod and grain number per plant; and yellow represents the negative control with no fluorescence signal.) As shown in Table 1, the results of pod and grain number per plant and molecular marker identification of 169 soybean germplasm natural materials are as follows: Theoretically, soybeans with the AA genotype should have low pod and grain numbers per plant, while soybeans with the TT genotype should have high pod and grain numbers per plant. The theoretical results are largely consistent with the measured pod and grain numbers per plant. Molecular markers can detect different genotypes with varying pod and grain numbers per plant in natural populations, further clarifying that these molecular markers can be used for molecular-assisted selection breeding of soybean materials with different pod and grain numbers per plant.

[0041] like Figure 1 Analysis of the data in Table 1 shows that the number of pods per plant (93.8 pods / plant (Harbin), 46.8 pods / plant (Sanya)) and the number of seeds per plant (206.7 seeds / plant (Harbin), 88.5 seeds / plant (Sanya)) of homozygous TT genotype soybeans were significantly higher than those of AA genotype soybeans (78.0 pods / plant (Harbin), 38.2 pods / plant (Sanya)) and (181.2 seeds / plant (Harbin), 73.6 seeds / plant (Sanya)). Therefore, the molecular markers of this invention are mainly used for the initial screening of soybean varieties with high pod and seed counts per plant, in order to achieve the purpose of molecular marker-assisted breeding.

[0042] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A KASP molecular marker associated with the traits of pod number and seed number per soybean plant, characterized in that, The KASP molecular marker genotype is A or T, located at 45649932 bp on chromosome 19 of the soybean genome Wm82.a4.v1.

2. The KASP molecular marker related to the number of pods and seeds per soybean plant as described in claim 1, characterized in that, When the KASP molecular marker genotype is A, the sequence of the first and last 50 bp is shown in SEQ ID NO.1, and the corresponding phenotype is low pod number and seed number per plant; when the KASP molecular marker genotype is T, the sequence of the first and last 50 bp is shown in SEQ ID NO.2, and the corresponding phenotype is high pod number and seed number per plant.

3. A KASP molecular marker primer combination for identifying the number of pods and seeds per soybean plant, characterized in that, The primer sequences are as follows: Forward primer F-FAM: 5'-GAAGGTGACCAAGTTCATGCTCCTGTGTGCCGTAGCCTCACAT-3'; SEQ ID NO.3; Forward primer F-HEX: 5'-GAAGGTCGGAGTCAACGGATTCCTGTGTGCGTAGCCTCACAA-3'; SEQ ID NO.4; Reverse primer R: 5'-GTCTCTCTTCTGTGTCTGTTATTAGTGG-3'; SEQ ID NO.

5.

4. A kit for identifying the number of pods and seeds per soybean plant, characterized in that, Contains the KASP molecular marker primer combination as described in claim 3.

5. The use of the KASP molecular marker according to any one of claims 1-2, the KASP molecular marker primer combination according to claim 3, or the kit according to claim 4 in identifying or assisting in the identification of the number of pods and seeds per soybean plant.

6. A method for identifying the number of pods and seeds per soybean plant, characterized in that, Includes the following steps: (1) Extract genomic DNA from soybean samples to be tested; perform PCR amplification of soybean sample genomic DNA using the KASP molecular marker primer combination described in claim 3 on an ABI Stepone PCR instrument; detect fluorescence signals using an ABI Stepone PCR instrument and analyze genotyping; (2) Judgment based on genotype results: When the genotype result of the sample is consistent with the genotype AA of soybean material with low number of pods and grains per plant, the soybean sample being identified exhibits the trait of low number of pods and grains per plant; when the genotype result of the sample is consistent with the genotype TT of soybean material with high number of pods and grains per plant, the soybean sample being identified exhibits the trait of high number of pods and grains per plant.