Chili CMS fertility recovery character related Indel marker and amplification primer and application thereof

Abstract

The invention relates to a capsicum CMS fertility recovery character related Indel marker as well as an amplification primer and application of the capsicum CMS fertility recovery character related Indel marker. Specifically, the Indel marker provided by the invention is closely linked with the capsicum CMS restoring gene, has a stable positioning effect, is suitable for fertility detection of capsicum in any growth period under laboratory conditions, lays a foundation for cloning of the capsicum CMS restoring gene and research of a capsicum pollen development molecular mechanism, and has a wide application prospect. And the method has high application value in the utilization of pepper heterosis and the cultivation of new varieties.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and plant molecular marker breeding technology, and more specifically, to an Indel marker associated with the CMS fertility restoration trait in peppers, its amplification primers, and its applications. Background Technology

[0002] Chili pepper (Capsicum annuum L.) is an important vegetable and seasoning crop in the Solanaceae family. With the increasing demand for high-quality, high-yield, and stress-resistant hybrids, utilizing heterosis has become an important approach for breeding superior chili pepper varieties. Cytoplasmic male sterility (CMS) is a widely used and highly efficient breeding technology system in chili pepper hybrid seed production. CMS causes pollen abortion through the interaction of mitochondrial and nuclear genes, effectively avoiding artificial emasculation, reducing seed production costs, and improving seed production efficiency. However, the application of the CMS system is limited by factors such as the difficulty of restorer line breeding, the complex genetic mechanism of restorer genes, and the lack of molecular markers.

[0003] Chili pepper is a typical "three-line" seed crop (CMS sterile line, maintainer line, and restorer line). The restorer line is the only male parent that can provide functional pollen to the hybrid (F1). Traditional breeding relies on phenotypic testing, which is time-consuming and highly susceptible to environmental interference. After cloning the restorer gene, codominant, high-throughput functional markers can be developed to achieve precise screening at the seedling stage, shortening the breeding cycle by more than 50% and significantly improving the efficiency of creating superior restorer lines. With the help of Rf gene molecular markers, traits such as high yield, disease resistance, and low light tolerance can be rapidly aggregated to cultivate new restorer lines with "high crossbreeding rate and high seed weight," reducing F1 seed production costs by 30-40%. At least five different CMS sources of chili pepper have been reported, and their fertility restoration is controlled by different Rf loci; cloning and verifying the interaction networks of each Rf can provide greater genetic diversity for hybrids.

[0004] Restoring male sterility (CMS) in chili peppers is crucial for hybrid production. Rf genes typically influence the protein expression of CMS-related genes, promoting fertility restoration. Over the past decade, with the continuous publication of plant reference genomes, research on CMS restoration genes has become a hot topic. However, due to the complexity of the molecular mechanisms of male sterility in chili peppers, marking, locating, and cloning genes related to pollen fertility has become a core step in marker-assisted breeding of superior varieties. Marker-assisted breeding directly utilizes molecular markers closely linked to or co-segregating with target trait genes to screen individuals for target regions or even the entire genome, aiming to improve the selection efficiency of target traits and shorten the breeding cycle.

[0005] More than 10 Rf genes have been identified and reported in crops such as rice, maize, rapeseed, wheat, and soybean. Rf genes typically affect the transcription of sterility genes in mitochondria, thereby restoring fertility in sterile lines. In related studies on pepper CMS, most reports suggest that fertility restoration is a dominant trait controlled by a single gene (Gulyas et al. 2006), while some researchers have found that fertility restoration is a quantitative trait controlled by one major QTL and four minor QTLs (Wang et al. 2004), and the sterility phenotype may also be affected by temperature (Kim et al. 2013). With the development of bioinformatics and the completion of pepper whole-genome sequencing, several pepper fertility restoration genes have been cloned and reported, and corresponding molecular markers have been developed. However, these publicly available molecular markers have certain limitations in practical applications, especially in matching phenotypes and genotypes among multiple germplasms, which to some extent restricts the application scope of molecular marker-assisted breeding. Therefore, developing new molecular markers closely linked to pepper fertility restoration is of great significance for promoting molecular marker-assisted selection breeding of pepper. Summary of the Invention

[0006] In view of this, the present invention proposes an Indel marker associated with the CMS fertility restoration trait of pepper, its amplification primers and applications, aiming to solve the current technical problems.

[0007] On the one hand, this invention proposes an Indel marker associated with the CMS fertility restoration trait in chili peppers.

[0008] In some implementations, the Indel marker is co-segregated with the CMS fertility restorer trait in peppers.

[0009] In some embodiments, the Indel marker is inserted at position 213979230 bp on chromosome 6 of the chili pepper cv.Zunla-1v2.0 genome; in some specific embodiments, the Indel marker is a specific insertion fragment of 88 bp in length with a nucleotide sequence as shown in SEQ ID No. 323.

[0010] In some specific implementations, the Indel marker is used to identify sterile and restorer lines of pepper, with the restorer line pepper having an 88 bp insertion compared to the sterile line pepper.

[0011] In some specific implementations, the Indel marker is used for molecular identification of the CMS fertility restoration trait in chili peppers.

[0012] On the other hand, the present invention also proposes a primer for amplifying Indel markers associated with the CMS fertility restoration trait in peppers.

[0013] In some implementations, the amplification primers are used to amplify the Indel marker as described in any of the above embodiments.

[0014] In some embodiments, the primers used for amplification are used to amplify gene fragments including the Indel markers described in any of the above embodiments; in some specific embodiments, the gene fragments correspond to the 213978911-213979612 bp segment on chromosome 6 of the pepper cv.Zunla-1v2.0 genome.

[0015] In some implementations, the primers for amplification include: Indel 160-F: 5'-CCTGAGACGCTAGAAGGTAAAA-3'; (SEQ ID NO: 160) Indel 160-R: 5'-TTGAATACTCAGGCAGCACC-3'. (SEQ ID NO:321) On the other hand, the present invention also proposes a method for molecular identification using the Indel marker described in any of the preceding claims.

[0016] In some embodiments, the molecular identification method includes the following identification steps: S1) Design specific primers using the Indel markers described above; S2) Using sterile and restorer lines of pepper as materials, PCR reactions were performed separately; S3) Result identification and analysis: amplified fragments with a length of 790bp are homozygous fertile materials, amplified fragments with a length of 702bp are homozygous sterile materials, and amplified fragments with two bands of lengths of 702bp and 790bp are heterozygous fertile materials.

[0017] In some embodiments, the nucleotide sequence of the 790 bp amplified fragment is shown in SEQ ID NO:324; In some embodiments, the nucleotide sequence of the 702 bp amplified fragment is shown in SEQ ID NO:325; In some implementations, the specific primers are as described in any of the above descriptions.

[0018] On the other hand, the present invention also proposes the application of the Indel marker as described in any of the above claims, the amplification primers as described in any of the above claims, or the molecular identification method as described in any of the above claims.

[0019] In some implementations, the application includes at least one of the following: 1) Identifying the fertility of pepper pollen; 2) Chili pepper hybridization breeding or molecular genetic breeding; 3) Analysis of genetic diversity in chili peppers; 4) Construct a genetic linkage map of pepper fertility; 5) Identification of male sterility restoration genes in pepper cytoplasm; 6) Identification of male sterility trait in pepper cytoplasm, and / or, 7) Breeding of male sterile restorer lines for pepper cytoplasm.

[0020] On the other hand, the present invention also proposes a product for identifying the CMS fertility restoration trait of peppers, characterized in that the product comprises Indel-labeled amplification primers as described in any of the above.

[0021] In some implementations, the product is used to identify the CMS fertility restorer trait in chili peppers.

[0022] In some implementations, the product includes: detection reagents, kits, genomic chips, or liquid probes.

[0023] In some implementations, the product is a kit, and the detection reagent is an amplification primer as described in any of the above embodiments.

[0024] In some implementations, the product also includes PCR reaction reagents.

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) The Indel molecular marker co-segregated with the CMS fertility restoration trait of pepper and its application in this invention are developed by discovering markers closely linked to the pepper CMS restoration gene. The genetic effect of the pepper CMS restoration gene located by the Indel molecular marker of this invention is obvious and stable, which can meet the needs of molecular breeding.

[0026] (2) This invention allows for the detection of genotypes in pepper pollen development in the laboratory, unaffected by environmental conditions. It enables the detection of fertility in individual pepper plants at any growth stage during the segregating generations of pepper hybrids, without affecting normal plant growth. This invention utilizes agarose gel electrophoresis to detect pepper fertility, overcoming the limitations of complex operations associated with traditional polyacrylamide gel electrophoresis. Using this invention for pepper fertility detection is rapid and inexpensive.

[0027] (3) Since molecular markers have the advantages of being simple, fast and high-throughput in assisted breeding systems, the molecular markers of this invention can lay the foundation for the cloning of the chili CMS restoration gene and the study of the molecular mechanism of chili pollen development. They have good application value in the utilization of chili heterosis and the breeding of new varieties. Attached Figure Description

[0028] Figure 1 The results of morphological observation of floral organs of the male sterile pepper line H12 (S / rfrf) and the male sterile pepper restorer line H3 (N / RfRf) of this invention.

[0029] Figure 2 The results show the pollen viability of the two parents in this invention.

[0030] Figure 3 This invention uses the BSA-Seq method combined with molecular markers to identify the linkage map of the chili pepper CMS revival gene. In the SNP-index graph, the horizontal axis represents the name and length of each chromosome, and the vertical axis represents the SNP-index value. The point is the SNP-index value corresponding to each SNP. The red curve represents the average SNP index within the sliding window. The orange and green reference lines mark the 99% and 95% confidence interval thresholds, respectively.

[0031] Figure 4 This is a gel electrophoresis image of Indel 160, the marker co-segregating with the CMS restorer trait of pepper in this invention, in the parents and the F2 and BC1F1 populations. In the image, M is the DL2000 Marker, showing bands of 790bp and 702bp; P1 represents pepper restorer line H3, P2 represents pepper sterile line H12; 1-22 represent fertile and sterile individual plants in the F2 and BC1 generations.

[0032] Figure 5 This is the sequence alignment result of cloning and sequencing of the marker Indel 160, which co-segregates with the CMS restorer trait of pepper in this invention, in parental pepper restorer line H3 and sterile line H12. F represents pepper restorer line H3; S represents sterile line H12. Detailed Implementation

[0033] Exemplary embodiments of the present disclosure will now be described in more detail with reference to the accompanying drawings. While exemplary embodiments of the present disclosure are shown in the accompanying drawings, it should be understood that the present disclosure may be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present disclosure and to fully convey its scope to those skilled in the art. It should be noted that, unless otherwise specified, embodiments and features described herein can be combined with each other. The present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0034] Example 1: Phenotypic identification of pepper male-sterile line H12 (S / rfrf) and pepper male-sterile restorer line H3 (N / RfRf). Morphological observations were performed on the floral organs of H12 and H3 respectively. The anthers of H3 were plump and large in size, and were covered with pollen grains after dehiscence. The anthers of H12 were significantly smaller in size than those of H3, appearing dry, flat, and wrinkled, and no obvious pollen was released after dehiscence (see...). Figure 1 Pollen viability staining of the anthers revealed that mature anthers of H3 contained a large number of pollen grains, most of which were large, round, and deeply stained. Mature anthers of H12 contained no stained pollen grains, only anther remnants (see...). Figure 2 This indicates that no pollen grains were produced in the anthers of H12, classifying it as a complete sterile type.

[0035] Example 2: Genetic characteristics of the H3 restorer gene Rf Genetic characteristics of the Rf gene controlling stamen fertility in H3 were analyzed (see Table 1). When H12 and H3 were crossed, all F1 plants were fertile. In the F2 generation, phenotypic segregation occurred, with 2381 fertile and 755 sterile plants out of a population of 3136. Chi-square analysis showed a theoretical phenotypic segregation ratio of 3:1 in the F2 generation and a 1:1 segregation ratio of fertile to sterile plants in the BC1 generation, consistent with Mendel's laws of inheritance. These results indicate that the fertility restoration trait in H3 is controlled by a pair of dominant genes.

[0036] Table 1. Fertility statistics of offspring from male-sterile chili pepper populations

[0037] Example 3: Fine mapping of H3 restorer gene Rf Using the male-sterile pepper line H12 (S / rfrf) and the male-sterile pepper restorer line H3 (N / RfRf) as parents, an F2 population was constructed to preliminarily locate the CMS restorer gene in pepper. After the plants fully flowered, anthers were observed to investigate fertility. Fifty fertile and 50 sterile plants were collected from each pool to construct extreme mixed pools. DNA was extracted from each plant in both pools using the CTAB method, and DNA concentration was determined using Nanodrop 2000 to ensure equal mixing. Subsequently, DNA samples from the restorer line H3, the sterile line H12, and the fertile and sterile pools were subjected to BSA-Seq sequencing.

[0038] Following the standard library preparation protocol using the TruSeq DNA PCR-free prep kit provided by Illumina, sequencing libraries were prepared with precise 400 bp inserts. Paired-end (PE) sequencing of the libraries was performed on the Illumina NovaSeq sequencing platform using Next-Generation Sequencing (NGS). Next, the raw data generated from high-throughput sequencing underwent preliminary quality assessment and screening to ensure high-quality data. Subsequently, these high-quality data were precisely aligned to a reference genome, and the alignment results were analyzed in detail.

[0039] To visually represent the distribution of SNP-index on chromosomes in offspring, a graph was plotted showing the distribution of SNP-index on chromosomes (see...). Figure 3 ). Figure 3 The red line shows the SNP-index distribution in window form, analyzed using sliding window analysis. The SNP-index difference between the two progeny pools was calculated as Δ(SNP-index) = SNP-index(extreme trait A) - SNP-index(extreme trait B). After 10,000 permutation tests, 95% and 99% confidence levels were selected as screening thresholds, with windows having a confidence level higher than 99% considered candidate intervals. SNP-index association analysis determined that the candidate region for the CMS restorer gene in pepper is located within the 209.6 Mb-215.2 Mb interval on chromosome 6 of pepper.

[0040] Example 4: Development and Application of Molecular Markers Based on the whole-genome resequencing information of the restorer line and sterile line parents, and data provided by the reference genome (https: / / solgenomics.net / organism / Capsicum_annuum / genome), primer sequences were designed using Primer5 software. Subsequently, DNA was extracted from the two parents and F2 and BC1 generation single plants using the CTAB method. Specific DNA fragments were amplified using PCR 2×Accurate Taq Master Mix. After amplification, the PCR products were detected by non-denaturing polyacrylamide gel electrophoresis and agarose gel electrophoresis to ensure the accuracy of the results.

[0041] Using the F2 segregating population as the experimental subject, we fully utilized the whole-genome resequencing information of the restorer line and sterile parental lines. Within the mapping region, Indel primers were designed, and chromosome walking was successfully performed using recombinant individuals as the mapping population by detecting the genotypes of the parents and individual plants in the F2 population. After rigorous screening, Indel markers closely linked to the pepper CMS restorer gene Rf were obtained. These markers are of significant value for subsequent genetic linkage map construction.

[0042] Specifically, within the initial mapping region, 161 pairs of Indel markers were successfully developed (see Table 2). Among them, 28 pairs showed polymorphism between the restorer line and the sterile line parents. Using the F2 mapping population, recombinant single plants were screened, and the candidate gene of the pepper CMS restorer gene Rf was finely mapped to a 162kb region, which contains 4 genes. To verify this result, single plants were randomly selected from the F2 and BC1F1 generations for further analysis. The results showed that the Indel 160 molecular marker co-segregated with pepper fertility. This discovery provides new molecular markers and mapping information for the cloning of the pepper CMS restorer gene.

[0043] Precise analysis revealed that Indel 160 is located on chromosome 6 of pepper within the range of 213,978,911-213,979,612 bp, with the specific insertion site at 213,979,230 bp. Compared to the sterile line, the restorer line showed an 88 bp insertion in this region (TGTAATTCGGTCAAGTCGTCTTTACCTCTTGACATATTATGGTGGATATCTCTTTGAACTAATAAAAGTAGTTTGTCTGAAGCTCTGA; SEQ ID NO:323).

[0044] To further investigate the impact of this genetic variation on pepper pollen fertility, we designed specific primers for the upstream and downstream of Indel 160 and performed PCR amplification on the DNA of the restorer line and sterile parents, F2 to F5 generations, and BC1 to BC4 generations of segregating populations. Subsequently, we performed agarose gel electrophoresis on the amplified products to more accurately analyze the genetic segregation of Indel 160 across different generations. The results were determined based on the electrophoretic bands, as shown below. Figure 4 As shown.

[0045] Table 2 InDel Primer Information

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053] The PCR reaction system contained the following components: 5 μL of 2×Accurate Taq Master Mix, 0.2 μL of forward primer Indel160-F, 0.2 μL of reverse primer Indel 160-R, 0.25 μL of template DNA, and 4.35 μL of ultrapure water, for a total volume of 10 μL. The PCR reaction program was set as follows: first, pre-denaturation at 94℃ for 30 s; then 33 cycles, each cycle consisting of denaturation at 98℃ for 10 s, annealing at 56℃ for 10 s, extension at 72℃ for 40 s, and storage at 4℃.

[0054] For the detection of PCR products, agarose gel electrophoresis is used. During electrophoresis, 1g of agarose powder is added to 100ml of TAE, heated until completely dissolved, cooled to 50-60℃, and then nucleic acid dye is added and gently mixed. The mixed agarose solution is poured into the gel casting mold, a comb of appropriate size is inserted to avoid air bubbles, and the gel is allowed to stand at room temperature for 30 minutes until it is completely solidified. After solidification, the comb is removed, the gel is placed in the electrophoresis tank, and electrophoresis buffer is added, ensuring that the buffer covers the gel surface by 1-2mm, and the sample wells are facing the negative electrode. The sample mixture is slowly added to the sample wells using a micropipette, taking care not to let the pipette tip touch the gel to avoid sample overflow or damage to the wells. The power is turned on, the voltage is set (usually 5-10V / cm gel length), the current direction is confirmed (nucleic acids migrate towards the positive electrode), and electrophoresis begins. The migration of the bromophenol blue indicator is observed. When the bromophenol blue indicator migrates to 2 / 3-3 / 4 of the gel length, the power is turned off, and electrophoresis is stopped. Remove the gel, place it in a gel imaging system, select an appropriate excitation wavelength, observe and photograph the nucleic acid bands, and record the experimental results.

[0055] Indel 160 primers were used to test pepper samples (including restorer lines and sterile parents, as well as F2 and BC1F1 generation single plants). The pollen fertility and genotype of the plant could be determined based on the banding of the PCR amplification products. If the PCR amplification product was a 790 bp DNA band, the pepper plant was homozygous fertile; if it was a 702 bp DNA band, it was homozygous sterile; and if it produced two DNA bands, 702 bp and 790 bp in length, the plant was heterozygous fertile.

[0056] like Figure 4 As shown in the figure, the bands are 790bp and 702bp; P1 represents pepper restorer line H3, P2 represents pepper sterile line H12; 1-22 represent fertile and sterile plants of the F2 and BC1 generations. Plants with the same band as restorer line H3 have genotype AA and exhibit a fertile phenotype; plants with the same band as sterile line H12 have genotype aa and exhibit a sterile phenotype; plants with two bands have genotype Aa and exhibit a fertile phenotype. The above gene amplification electrophoresis results are consistent with the actual plant behavior, which proves that the molecular marker Indel 160 of this invention can effectively distinguish pollen fertility in pepper plants. The discovery of this molecular marker lays an important foundation for the final cloning of the pepper CMS restorer gene and the establishment of a molecular marker-assisted breeding system.

[0057] In summary, it can be understood that the male-sterile pepper line H12 (S / rfrf) is the sterile parent, and the male-sterile restorer line H3 (N / RfRf) is the fertile parent. This invention, through genetic analysis, discovered that the fertility restoration trait in H3 is controlled by a pair of dominant genes. Previously, the chili pepper CMS restorer gene was preliminarily located in the 209.6 Mb-215.2 Mb region of chromosome 6, a region different from previously reported chili pepper restorer gene locations. This Indel marker was developed based on the whole-genome resequencing results of the chili pepper male-sterile line H12 and the chili pepper male-sterile restorer line H3, combined with BSA-seq mapping results. Through repeated validation in parents, self-crossed populations, and backcrossed populations, the Indel 160 marker of this invention can accurately identify pollen fertility and genotype in chili pepper plants.

[0058] Through meticulous design and optimization, the Indel 160-labeled primers developed in this invention exhibit superior performance. The primers are designed based on sequence information flanking the insertion / deletion site, ensuring precise binding to the target DNA fragment and avoiding non-specific binding, thereby improving detection accuracy and specificity. The PCR bands of the Indel 160-labeled primers are single and bright, ensuring high stability. Notably, there is an 88 bp difference between the sterile and restorer line fragments; this significant distinction simplifies the identification process, requiring only agarose gel electrophoresis for PCR product detection, eliminating the complex procedures of traditional polypropylene gel electrophoresis. In summary, the primers of this invention are highly efficient, stable, and easily distinguishable, providing strong support for research and applications in related fields.

[0059] Through in-depth research, this invention has discovered that the Indel 160 marker exhibits excellent genetic stability during breeding. The variation in the Indel 160 marker is minimal in offspring, a characteristic that is significant for maintaining the stable inheritance of breeding objectives. Furthermore, the Indel 160 marker-assisted breeding technology disclosed in this invention largely overcomes the limitations of traditional molecular marker technologies, providing a new and powerful tool for breeding work.

[0060] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the specific implementation of the present invention. Any modifications or equivalent substitutions that do not depart from the spirit and scope of the present invention should be covered within the scope of protection of the claims of the present invention.

[0061] The partial sequence of this invention is as follows: DNA band sequence >790bp CCTGAGATGCTAGAAGGTAAAAATGTAAACCTATGTGATTGATACCCTCTTTATTTCAATCACCTCGTCAACTTTTAACCCATATTCTCATTGACCTTATTTCTATTTCTCTGCTATCTTTAAACAATCTAGTTAACAACTATTGTTACTAGTACGTATGCATTTTTGTAACTTGACATGTATTATGCATCTTGTAACAACTATTTTGGCATATACTTATTGGATAACAATGAATACCATATTCAAACTTCCATCCTGGTCTCCTCATGAAAGTCATCCAAGTGAAACTACTTGGGATGGGAGGTATGTTTATCTAGTGATGTAATTCGGTCAAGTCGTCTTTACCTCTTGACATATTATGGTGGATATCTCTTTGAACTAATAAAAGTAGTTTGTCTGAAGCTCTGAATCATGTTCATCATTTTCTTGGTGAGATCCCTCGAATTTTATTGAAGTTGGTTACTGGTCAAAACCAGGTTGATTCTTCTAAACTTTTCTGAAAGGTGGAAATCATACATGATTGATGTCTGTAGACCCAATGTCGCGGACACAATATGGGAACAATTCAGGAGCGTTTTTTGTGATTTTATCCTTTTTCTGGCCTGAGATGAAGTTTAATTCAAGAAACATATTCATATTAGCAAACCCCTACTTTTTTGGGTTTATTAGTTTGTAATTGTAGAAATAGGTTTGCTCACATCTTTGATGCTGCGTTGATATGCTTATTTTCGTGTCATTCTGTACTATAACTGCTAGTGTGATTTTTGGCTGGTGCTGCCTGAGTCTTCAA SEQ ID NO:324 >702bp DNA band sequence CCTGAGACGCTAGAAGGTAAAAATGTAAACCTATGTGATTGATACCCTCTTTATTTCAATCACCTCGTCAACTTTTAACCCATATTCTCATTGACCTTATTTCTATTTCTCTGCTATCTTTAAACAATCTAGTTAACAACTATTGTTGCTAGTACGTATGCATTTTTGTAACTTGACACGTATTATGCATCTTGTAACAACTATTTTGGCATATACTTATTGGATAACAATGAATACCATATTCAAACTTCCATCCTGGTCTCCTCATGAAAGTCATCCAAGTGAAACTACTTGGGATGGGAGGTATGTTTATCTAGTGAATCATGTTCATCATTTTCTTGGTGAGATCCC TCGAATTTTATTGAAGTTGGTTTCTGGTCAAAACCGGGTTGATTCTTCTAAACTTTTCTGAAAGGTGGAAATCATACATGATTGATGTCTGTAGACCCAATGTCGCGGACACAATATGGGAACAATTCAGGAGCGTTTTTTGTGATTTTATCCTTTTTCTGGCCTGAGATGAAGTTTAATTCAAGAAACATATTCATATTAGCAAACCCCTACTTTTTTGGGTTTATTAGTTTGTAATTGTAGAAATAGGTTTGCTCACATCTTTGATGCTGCGTTGATATGCTTATTTTCGTGTCATTCTGTACTATAACTGCTAGTGTGATTTTTGGCTGGTGCTGCCTGAGTATTCAA SEQ ID NO:325

Claims

1. A CMS-associated Indel marker for the fertility-restoring trait in chili peppers, characterized in that, The insertion site of the Indel marker is at position 213979230 bp on chromosome 6 of the chili pepper cv.Zunla-1v2.0 genome; the Indel marker is a specific insertion fragment with a length of 88 bp and a nucleotide sequence as shown in SEQ ID No.

323.

2. The Indel marker associated with the CMS fertility restoration trait in chili peppers as described in claim 1, characterized in that, The Indel marker is used for molecular identification of the CMS fertility restoration trait in chili peppers.

3. A primer for amplifying Indel markers associated with the CMS fertility restoration trait in chili peppers as described in claim 1 or 2, characterized in that, The primers used for amplification include: Indel 160-F: 5'-CCTGAGACGCTAGAAGGTAAAA-3' (SEQ ID NO: 160); Indel 160-R: 5'-TTGAATACTCAGGCAGCACC-3' (SEQ ID NO: 321).

4. A method for molecular identification using the Indel marker as described in claim 1 or 2, characterized in that, The identification process includes: S1) Design specific primers for the Indel marker as described in claim 1 or 2; S2) Using sterile and restorer lines of pepper as materials, PCR reactions were performed separately; S3) Result identification and analysis: amplified fragments with a length of 790bp are homozygous fertile materials, amplified fragments with a length of 702bp are homozygous sterile materials, and amplified fragments with two bands of lengths of 702bp and 790bp are heterozygous fertile materials.

5. The molecular identification method as described in claim 4, characterized in that, The specific primer is as described in claim 3.

6. The application of the Indel marker as described in claim 1 or 2, the primer for amplification as described in claim 3, or the molecular identification method as described in claim 4 or 5, characterized in that, The application includes at least one of the following: 1) Identifying the fertility of pepper pollen; 2) Chili pepper hybridization breeding or molecular genetic breeding; 3) Analysis of genetic diversity in chili peppers; 4) Construct a genetic linkage map of pepper fertility; 5) Identification of male sterility restoration genes in pepper cytoplasm; 6) Identification of male sterility trait in pepper cytoplasm, and / or, 7) Breeding of male sterile restorer lines for pepper cytoplasm.

7. A product for identifying the CMS fertility restorer trait in chili peppers, characterized in that, The product includes the Indel-labeled amplification primers as described in claim 1 or 2.

8. The product for identifying the CMS fertility restoration trait in chili peppers according to claim 7, characterized in that, The product in question is a reagent kit.

9. The product for identifying the CMS fertility restoration trait in chili peppers according to claim 8, characterized in that, The product includes: detection reagents, kits, genomic chips or liquid probes, wherein the detection reagents are the amplification primers as described in claim 3.

10. The product for identifying the CMS fertility restoration trait in chili peppers according to any one of claims 7-9, characterized in that, The product also includes PCR reaction reagents.

Images