Long-chain non-coding RNA (Ribonucleic Acid) gene OslncBR3 and application thereof in improving rice blast resistance
By cloning the long non-coding RNA gene OslncBR3 in rice and performing genetic engineering regulation in rice, the problem of the easy failure of traditional disease-resistant rice varieties was solved, and the effect of significantly improving rice blast resistance was achieved, providing important genetic resource support.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HUBEI UNIV OF EDUCATION
- Filing Date
- 2026-03-20
- Publication Date
- 2026-05-15
AI Technical Summary
Existing technologies are insufficient to effectively utilize long non-coding RNAs to enhance resistance to rice blast in rice. Traditional differential expression analysis is also insufficient to accurately screen for key long non-coding RNAs, leading to the ineffectiveness of traditional disease-resistant varieties after their promotion.
The rice long non-coding RNA gene OslncBR3 was cloned and applied to regulate its resistance to rice blast by overexpression or knockout. Recombinant vectors and recombinant engineered bacteria were constructed and introduced into rice genetic engineering breeding to improve or reduce resistance.
It significantly enhances rice's resistance to rice blast, provides important genetic resources to support disease-resistant molecular design and breeding, and strengthens rice's green prevention and control capabilities.
Smart Images
Figure CN122038404A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the long non-coding RNA gene OslncBR3 and its application in improving rice blast resistance. Background Technology
[0002] Rice (Oryza sativa L.) is the staple food and main source of nutrition for more than half of the world's population and the economic backbone of over 200 million smallholder farmers. Achieving high and stable rice yields is of great strategic significance for ensuring national food security and social stability. However, rice blast disease, caused by Magnaphalthe oryzae, is known as the "cancer" of rice, as it can occur at any stage of rice growth and can cause 70%–80% yield reduction or even crop failure in severe cases. With the intensification of climate change and the rapid mutation of the rice blast fungus population, traditional resistant varieties often become ineffective after a few years of promotion, posing a long-term threat to rice production safety. Therefore, elucidating the molecular mechanisms of rice resistance to rice blast and discovering new resistance regulatory factors are core scientific issues for achieving sustainable disease-resistant rice breeding.
[0003] Traditional research on plant disease resistance mechanisms has primarily focused on coding RNAs and their mediated signaling pathways, such as the immune response induced by NLR-type resistance proteins through recognition of pathogen effector factors. Recent studies have shown that long non-coding RNAs (LNAs), as an important component of epigenetic regulation, are increasingly being recognized as playing a crucial role in the immune response of rice, providing a new perspective for disease resistance gene discovery. However, compared to traditional coding genes, LNAs generally exhibit low expression levels, weak sequence conservation, and ambiguous functions, making it difficult for traditional differential expression analysis to accurately screen for functionally critical LNAs. To date, functional studies and applications of LNAs in rice resistance to rice blast fungus infection are relatively limited.
[0004] Therefore, discovering novel long non-coding RNAs for rice blast resistance will not only help deepen our understanding of the rice immune regulatory network, but will also provide important genetic resource support for molecular design breeding for disease resistance and green control of rice blast. Summary of the Invention
[0005] The purpose of this invention is to provide a long non-coding RNA gene, OslncBR3, and its application in improving rice blast resistance, thereby compensating for the deficiencies in existing rice blast resistance genes. Applying it to rice breeding enhances rice's resistance to blast, providing an important genetic resource for the green control of blast through resistance breeding.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] In a first aspect, the present invention provides a rice long non-coding RNA gene OslncBR3, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0008] Secondly, the present invention provides a recombinant vector containing the rice long non-coding RNA gene OslncBR3 described above.
[0009] Thirdly, the present invention provides a recombinant engineered bacterium containing the above-mentioned rice long non-coding RNA gene OslncBR3.
[0010] Fourthly, the present invention provides the application of the above-mentioned rice long non-coding RNA gene OslncBR3, the above-mentioned recombinant vector, and the above-mentioned recombinant engineered bacteria in regulating plant resistance to rice blast.
[0011] Furthermore, the plant in question is rice.
[0012] Furthermore, overexpression of OslncBR3 in rice was used to enhance rice resistance to rice blast, while knockout of OslncBR3 in rice was used to reduce rice resistance to rice blast.
[0013] Fifthly, the present invention provides the application of the above-mentioned rice long non-coding RNA gene OslncBR3, the above-mentioned recombinant vector, and the above-mentioned recombinant engineered bacteria in the cultivation of rice varieties resistant to rice blast.
[0014] Furthermore, the long non-coding RNA gene OslncBR3 was introduced into the recipient rice, and the OslncBR3 gene was overexpressed in the recipient rice to obtain transgenic rice. Compared with the recipient rice, the transgenic rice showed improved resistance to rice blast.
[0015] In a sixth aspect, the present invention provides a method for improving resistance to rice blast disease, specifically by overexpressing the above-mentioned OslncBR3 in rice to improve the resistance of rice to rice blast disease.
[0016] The beneficial effects of the invention are:
[0017] This invention marks the first cloning of the long non-coding RNA OslncBR3 from rice, its sequence shown in SEQ ID NO.1. By comparing the resistance to rice blast fungus in OslncBR3 knockout mutants, OslncBR3-overexpressing plants, and wild-type rice, it was found that overexpression of OslncBR3 significantly enhances rice resistance to rice blast, while knockout of OslncBR3 reduces rice resistance to rice blast. Therefore, applying the OslncBR3 gene to rice genetic engineering breeding has significant economic value and promising prospects for industrial application. Attached Figure Description
[0018] Figure 1 This is an agarose gel electrophoresis image of the PCR amplification product of rice long non-coding RNA OslncBR3 in Example 1 of the present invention.
[0019] Figure 2 This is an agarose gel electrophoresis image showing the process of constructing the rice long non-coding RNA OslncBR3 knockout vector in Example 2 of the present invention.
[0020] Figure 3 This is a schematic diagram of the Agrobacterium-mediated genetic transformation process in rice.
[0021] Figure 4 Mutation detection diagram of the knockout target site in OslncBR3 knockout plants.
[0022] Figure 5 This is a graph showing the gene expression levels in OslncBR3 overexpressing plants.
[0023] Figure 6 Comparison of leaf and leaf lesion area of rice long non-coding RNA OslncBR3 mutant, overexpression, and wild-type plants after 7 days of inoculation with rice blast fungus. Detailed Implementation
[0024] The present invention will be further described below with reference to the embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally carried out in accordance with known means in the art.
[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0026] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0027] This invention provides a rice long non-coding RNA, OslncBR3, whose nucleotide sequence is shown in SEQ ID NO.1. The full-length nucleotide sequence is 200 nt, as detailed below:
[0028] GCATGTGCATTAACACAAGAGTCTTCAGGTGGGGGAACGCCTCTGCATCAAGAACCAAAGTTTTCGAACTGTGCATGTTGTTCAGTCTTAGATAAGTGAGGTTTGACAAGTGTGATGCGAGCATCCCCAGTGGATCTTCCCCAAGATTACACCAACTTAGAGCTAAGTACTTGAGATGTGTAGTGTGGCTAAGAAATATC.
[0029] In the following embodiments, the rice long non-coding RNA OslncBR3 is referred to simply as OslncBR3.
[0030] Example 1: Cloning of rice long non-coding RNA OslncBR3
[0031] This embodiment provides a method for cloning the rice long non-coding RNA OslncBR3, including the following steps:
[0032] (1) Material preparation
[0033] Rice varietal materials and Escherichia coli DH5α (Takara 9057). The rice varietal materials were used for RNA extraction and are preserved in our laboratory.
[0034] (2) Cloning and transformation of rice long non-coding RNA OslncBR3
[0035] Based on the transcriptome annotation information of OslncBR3, its full length is 200 nt. A pair of specific primers, OslncBR3-F (5'-GCATGTGCATTAACACAAG-3') and OslncBR3-R (5'-GATATTTCTTAGCCACACT3'), were designed using Primer 5.0. Total RNA was extracted from three-leaf stage rice seedlings using the Trizol reagent method and reverse transcribed into cDNA, which was used as a template for PCR reaction. The amplification reaction was performed using Vazyme Phanta Max Super-Fidelity DNA Polymerase (Vazyme, China), and the amplification system is shown in Table 1.
[0036] The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min → (95℃ denaturation for 30 s → 58℃ annealing for 15 s → 72℃ extension for 30 s) × 30 cycles → 65℃ complete extension for 5 min → storage at 4℃.
[0037] Table 1. PCR reaction system for amplifying the OslncBR3 gene.
[0038]
[0039] PCR products were detected and purified by 1% agarose gel electrophoresis (e.g.) Figure 1 As shown in the image, the cells were then treated with DNA A-Tailing Kit (Takara 6109) for TA cloning. The vector was pMD18-T. Three positive clones were selected and sequenced to obtain the full-length OslncBR3 (SEQ ID NO.1). The TA cloning steps are as follows:
[0040] An "A" tail was added to the 3' end of the recovered DNA fragments, and the reaction system is shown in Table 2. The reaction conditions were 72°C for 20 minutes in a PCR instrument.
[0041] Table 2. A-tailing reaction of purified PCR products
[0042]
[0043] Then, it was ligated with the pMD-18T support from TAKARA, and the reaction system is shown in Table 3. The reaction conditions were overnight ligation in a metal bath at 16°C to obtain the support pMD18-T-OslncBR3.
[0044] Table 3. Ligation reaction of pMD-18T cloning vector
[0045]
[0046] Example 2 Construction of OslncBR3 gene knockout vector
[0047] This embodiment provides a method for constructing an OslncBR3 gene knockout vector, including the following steps:
[0048] (1) Material preparation: Knockout vector: pYLCRISPR / Cas9Pubi-H, Agrobacterium EHA105. The above vectors can be purchased from Wuhan Boyuan Biotechnology Co., Ltd., and Agrobacterium EHA105 can be purchased from Shanghai Weidi Biotechnology Co., Ltd.
[0049] (2) Based on the nucleotide sequence of OslncBR3, the knockout target was predicted using the online CRISPR-P software (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR), and target primers Target-F (CAGTGGTCTCaTGCAACACAAGAGTCTTCAGGTGGGTTTTAGAGCTAGAAATAGC) and Target-R (CAGTGGTCTCaAAACCTGGGGATGCTCGCATCACATGCACCAGCCGGGAATCGA) were designed.
[0050] A);
[0051] (3) Subsequently, the target fragment was amplified. The PCR reaction conditions were as follows: 98℃ pre-denaturation for 3 min → (98℃ denaturation for 15 s → 55℃ annealing for 15 s → 72℃ extension for 30 s) × 25 cycles → 72℃ complete extension for 5 min → storage at 4℃. The reaction system is shown in Table 4.
[0052] (4) Detection of PCR products by agarose gel electrophoresis. Figure 2a) After confirming the target band, the amplified fragment was recovered and ligated into the pYLCRISPR / Cas9Pubi-H knockout vector using Goldden Gate cloning. Reaction conditions: incubation at 37℃ for 30-60 min, followed by termination at 65℃ for 20 min. The reaction system is shown in Table 5.
[0053] Table 4 Dual-target fragment amplification reaction system
[0054]
[0055] Table 5. Reaction system for Goldden Gate cloning
[0056]
[0057] (5) Subsequently, the ligation product was transformed into E. coli DH5α, and positive clones were selected for sequencing. Figure 2 b). Plasmids were extracted using the TaKaRaMiniBEST Plasmid Purification Kit Ver.4.0 (9760) and transformed into Agrobacterium EHA105. Positive clones were selected and stored at -80°C for later use.
[0058] Example 3 Construction of OslncBR3 gene overexpression vector
[0059] This embodiment provides a method for constructing an OslncBR3 gene overexpression vector, including the following steps:
[0060] (1) Material preparation: pMD18-T-OslncBR3, overexpression vector pCambia3301, Agrobacterium EHA105, which can be purchased from Shanghai Weidi Biotechnology Co., Ltd.
[0061] (2) Obtaining the linearized vector fragment: The pCambia3301 vector plasmid was used, and two restriction sites, QcutⅠ and QcutⅡ, were selected according to its vector map. Double restriction endonuclease from TAKARA was used for digestion. The digestion system is shown in Table 6. After mixing the components, the digestion was performed at 37℃ for 45 min in a PCR instrument. The digestion products were detected by 1% agarose gel electrophoresis and purified using a gel extraction kit. The recovered products were stored at -20℃.
[0062] Table 6. Vector double enzyme digestion reaction
[0063]
[0064] (3) Construction of OslncBR3 gene overexpression vector: A pair of adapter primers, OslncBR3-CF (5'-ATGTGCATTAACACAAG-3') and OslncBR3-CR (5'-ATATTTCTTAGCCACACT-3'), were designed using Primer 5.0. Using pMD18-T-OslncBR3 plasmid as a template, the target fragment was amplified by PCR. Subsequently, using in-fusion seamless cloning technology, the PCR-amplified target fragment was recombinantly ligated with the double-digested linearized pCambia3301 vector. The ligation system is shown in Table 7. After gentle mixing, ligation was performed at 50℃ for 18 min in a PCR instrument. The ligation product was transformed into Escherichia coli DH5α, positive clones were picked for sequencing, and plasmids were extracted from the correctly sequenced bacterial cultures and stored at -20℃ for later use.
[0065] Table 7. Target fragment and linearized vector linkage reaction
[0066]
[0067] Example 4: Agrobacterium-mediated genetic transformation method for rice
[0068] A schematic diagram of the rice genetic transformation process is shown below. Figure 3 As shown, it includes the following steps:
[0069] 1000 mature rice seeds were collected, the husks were removed, and the seeds were disinfected by soaking in 2.5% sodium hypochlorite for 30 minutes. They were then rinsed five times with sterile water. The disinfected seeds were inoculated into callus induction medium and cultured at 28°C under light for 7 days. Agrobacterium tumefaciens EHA105 containing the target vector was cultured in YEB medium (50 mg / L kanamycin, 50 mg / L rifampin) until OD600 = 0.5. The bacterial pellet was collected by centrifugation at 4000 rpm for 10 minutes and resuspended in AAM (100 μM acetylsyl syringone) medium to prepare an engineered bacterial suspension with OD600 = 0.2. This suspension was placed on ice for 1 hour. Rice callus tissue was then immersed in the engineered bacterial suspension for 10 minutes. n. Blot dry the surface bacterial solution with sterile filter paper, inoculate into co-culture medium, and incubate in the dark at 25℃ for 3 days; immerse the infected callus tissue in 500mg / L carbenicillin solution for 15min, repeat twice, blot dry the surface moisture of the callus tissue with filter paper, inoculate into selection medium, and incubate under light at 28℃; subculture the newly grown resistant callus tissue blocks into bud induction medium, and incubate under light at 30℃ (1-2 weeks) until adventitious buds emerge; subculture the adventitious buds into rooting medium, and incubate under light at 30℃ (1-2 weeks) until the seedlings have grown most of the adventitious roots; remove the rooted seedlings, wash off the medium, immerse the roots of the seedlings in sterile water for 3-7 days to harden them off, and then transplant them to the field or greenhouse.
[0070] DNA was extracted from the transformed plants for molecular identification. Hygromycin primers Hyg-F (5'-CCGGAAGTGCTTGACATTGG-3') and Hyg-R (5'-GCCGAATTAATTCGGGG-3') were designed to amplify the hygromycin gene in the transgenic plants. Plants that amplified a 1035bp fragment were considered positive.
[0071] Seeds from OslncBR3 gene-positive knockout plants were collected. After sowing, DNA was extracted from young leaves for target mutation detection. Primers for target PCR were OslncBR3-F and OslncBR3-R. The amplified target fragment was then sequenced for analysis. Results are as follows: Figure 4 As shown, positive plants with significantly altered secondary structure of OslncBR3 were selected for cultivation, and the offspring were homozygous mutant plants (oslncbr3-1 and oslncbr3-2).
[0072] Seeds from plants positive for OslncBR3 gene overexpression were collected. RNA was extracted from young leaves after sowing and reverse transcribed into cDNA. RT-qPCR primers qOslncBR3-F (5'-TGCATTAACACAAGAGTCT-3') and qOslncBR3-R (5'-GATATTTCTTAGCCACACT-3') were designed to quantify the expression of the target gene. Results are shown below. Figure 5 Overexpression lines with significantly increased expression levels were selected and cultured, and the offspring became OslncBR3 gene overexpression plants (OslncBR3-OE#1 and OslncBR3-OE#9).
[0073] Example 5: Identification of rice blast resistance
[0074] This embodiment provides a method for identifying rice blast resistance in rice long non-coding RNA OslncBR3 knockout mutant plants (oslncbr3-1 and oslncbr3-2), overexpression plants (OslncBR3-OE#1 and OslncBR3-OE#9), and wild-type plants (WT) obtained in Example 4, including the following steps:
[0075] (1) Take rice long non-coding RNA OslncBR3 knockout mutant plants, overexpressing plants and their wild-type seeds, soak them in water and germinate them in a 30℃ incubator for 2-3 days. Then sow the germinated rice seeds in small flower pots (10cm in diameter) filled with soil, 8-10 seeds per pot, and set up 3 replicates for each treatment. Cultivate rice seedlings in a greenhouse with a light intensity of 10000Lx, a photoperiod of 14h light / 10h dark, and 28℃ until the rice grows to three leaves and one heart or four leaves and one heart.
[0076] (2) The activated rice blast fungus was cultured in the dark on rice bran medium for 8-10 days until the mycelium covered the culture dish. A layer of mycelium was scraped off from the surface of the medium, and the fungus was cultured under 60% light for 3-5 days to induce spore production. Then, the rice bran plate after spore production was washed with 3-5 mL of sterile water containing 0.02% Tween-20. The washing and scraping solution was filtered through a single layer of lens paper, and the filtrate was counted using a cell counting chamber to achieve a final spore suspension concentration of 1.0×10⁵-2.0×10⁵. 5 The diluted spore suspension was evenly sprayed onto rice leaves using a high-pressure atomizer, with 15 mL of spore suspension sprayed onto each leaf. The inoculated seedlings were then placed in an inoculation room at 26°C and humidity above 90% for 24 hours in the dark. Afterward, the photoperiod was changed to 12 hours of light / 12 hours of darkness, and the seedlings were cultured for another 7 days.
[0077] (3) Figure 6 Comparison of leaves and leaf lesion area 7 days after inoculation of OslncBR3 knockout mutant plants, overexpression plants, and wild-type plants with rice blast fungus. Figure 6 As shown in figure a, rice leaves from OslncBR3 knockout mutants (oslncbr3-1, oslncbr3-2) were more susceptible to rice blast fungus after inoculation, exhibiting more spindle-shaped lesions and a larger affected area. Conversely, leaves from OslncBR3 overexpressing plants (OslncBR3-OE#1 and OslncBR3-OE#9) were more resistant to rice blast fungus after inoculation, showing fewer spindle-shaped lesions and a smaller affected area.
[0078] (4) The leaf lesion area of OslncBR3 knockout mutant plants, overexpression plants, and wild-type plants 7 days after inoculation with rice blast fungus was statistically analyzed using ImageJ software. The statistical results of lesion area are shown in the figure below. Figure 6 As shown in b, on day 7 after infection with *OslncBR3*, the OslncBR3 gene knockout mutants (oslncbr3-1, oslncbr3-2) had the highest diseased leaf area, ranging from 20% to 40%, with a disease resistance score (DRS) of 3-5, indicating susceptibility. The wild type was second, with a diseased area between 5% and 10%, and a resistance score of 2-3. The OslncBR3 overexpressing plants (OslncBR3-OE#1 and OslncBR3-OE#9) had the smallest diseased area, less than 5%, with a resistance score of 0-1, indicating resistance. The diseased leaf area of the OslncBR3 gene knockout mutants was significantly higher than that of the wild type, while the diseased leaf area of the OslncBR3 overexpressing plants was significantly lower than that of the wild type. These results indicate that the long non-coding RNA OslncBR3 in rice can enhance the rice's resistance to *OslncBR3*.
[0079] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.
Claims
1. A long non-coding RNA gene in rice OslncBR3 Its features are: The OslncBR3 The nucleotide sequence is shown in SEQ ID NO.
1.
2. A rice long non-coding RNA gene containing the one described in claim 1 OslncBR3 Recombinant carriers.
3. A rice long non-coding RNA gene containing the one described in claim 1 OslncBR3 Recombinant engineered bacteria.
4. The rice long non-coding RNA gene as described in claim 1. OslncBR3, The application of the recombinant vector as described in claim 2 and the recombinant engineered bacteria as described in claim 3 in regulating plant resistance to rice blast.
5. The application according to claim 4, characterized in that: The plant in question is rice.
6. The application according to claim 4, characterized in that: Overexpression in rice OslncBR3 To improve rice's resistance to rice blast; by knocking out [a specific pathogen] in rice. OslncBR3 To reduce the resistance of rice to rice blast.
7. The rice long non-coding RNA gene as described in claim 1 OslncBR3, The application of the recombinant vector as described in claim 2 and the recombinant engineered bacteria as described in claim 3 in the cultivation of rice varieties resistant to rice blast.
8. The application according to claim 7, characterized in that: Introducing a long non-coding RNA gene into recipient rice OslncBR3 ,make OslncBR3 The gene was overexpressed in recipient rice to obtain transgenic rice, which showed increased resistance to rice blast compared to the recipient rice.
9. A method for improving resistance to rice blast, characterized in that: Overexpression of the expression as described in claim 1 in rice OslncBR3 To improve the resistance of rice to rice blast.