Method for verifying plant gene function based on combination of agrobacterium rhizogenes and movable element

Abstract

The invention provides a method for verifying gene functions based on combination of agrobacterium rhizogenes and a movable element. The provided method comprises the following steps: (1) constructing an expression vector fused by a target gene and a movable element, wherein the target gene is a functional gene to be verified of the plant; (2) transferring the expression vector into agrobacterium rhizogenes to obtain transformed agrobacterium rhizogenes; (3) infecting a plant by utilizing the transformed agrobacterium rhizogenes to obtain a positive plant with hairy roots; (4) determining the function of the target gene in the plant through the expression of the target gene in the upper end tissue of the positive plant and the phenotypic difference between the target gene and the control plant; wherein the movable element is a genetic material capable of transferring the target gene from the hairy root of the positive plant to the upper tissue. The method provided by the invention is simple to operate, high in transformation efficiency and stable and reliable in phenotype, and can be widely applied to plant gene function research.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and specifically to a method for verifying plant gene function based on Agrobacterium rhizogenes combined with mobile elements. Background Technology

[0002] Plant gene function verification often relies on genetic transformation using *Agrobacterium tumefaciens*. This bacterium carries a *Ti* (Tumour-inducing) plasmid with a segment of T-DNA (Transferring DNA). After infecting plant wounds and entering cells, it integrates the carried T-DNA fragment into the genome, resulting in stably transformed transgenic plants. Gene function is verified by identifying target gene expression and observing phenotypes. However, *Agrobacterium tumefaciens*-based plant genetic transformation suffers from low infection efficiency, genotype dependence, and long experimental cycles, significantly limiting gene function research. *Agrobacterium rhizogenes*, another species of *Agrobacterium*, carries a *Ri* (Root-inducing plasmid) plasmid, which can also integrate the carried T-DNA fragment into the genome, achieving stable genetic transformation. Furthermore, *Agrobacterium rhizogenes* has high infection efficiency and can infect most plants. Meanwhile, because the T-DNA fragment of Agrobacterium rhizogenes contains genes that determine hairy root growth and crown gall alkaloid synthesis, integration with these genes induces the production of hairy roots in plant tissues. Therefore, the target gene is generally expressed only in hairy roots. Based on the advantages of hairy root culture technology, such as its simplicity, short growth cycle, and high yield of secondary metabolites, it is widely used for the synthesis of secondary metabolites. Although some studies have induced shoot production by transferring hairy roots containing the target gene to a culture medium, followed by rooting culture to induce rooting and thus achieve plant regeneration, this process is technically challenging and time-consuming, and cannot be widely applied to plant gene function research.

[0003] Movable elements can act as RNA signals, enabling long-distance RNA transport within plants. This allows RNA to move from roots to vegetative organs such as stems and leaves, and even into reproductive organs. Ellison et al. (2020) found that fusing sgRNA from a TRV viral vector with a movable element allowed the sgRNA to enter germ cells, resulting in edited tobacco offspring. Yang et al. (2023) fused a movable element with a CRISPR / Cas9 sequence and obtained stably transgenic plants producing "mobile" CRISPR / Cas9 RNA via Agrobacterium tumefaciens. By grafting non-transgenic, unmodified wild-type scions onto the roots of plants containing movable CRISPR / Cas9 RNA, the CRISPR / Cas9 RNA was transported into the seed-producing flowers of the scion, directly yielding non-transgenic gene-edited offspring. These findings demonstrate the broad application prospects of movable elements.

[0004] Therefore, combining Agrobacterium rhizogenes-mediated genetic transformation with mobile element technology and applying it to gene function research leverages the advantages of both technologies to achieve simple operation, short cycle, and rapid verification of gene function. Summary of the Invention

[0005] This invention aims to at least partially solve one of the technical problems in related technologies. After *Agrobacterium rhizogenes* infects plants, the target gene is expressed only in the hairy roots, making it unsuitable for functional analysis of genes in the aboveground parts. The method provided by this invention involves screening the gene transfer ability of mobile elements to fuse the target gene with the mobile elements for expression; transforming *Agrobacterium rhizogenes* and infecting target plants with *Agrobacterium rhizogenes*; identifying plants containing positive hairy roots; and determining the function of the corresponding target gene through gene expression level detection and phenotypic observation.

[0006] Specifically, the present invention provides the following technical solution:

[0007] In a first aspect of the invention, a method for verifying plant gene function based on Agrobacterium rhizogenes binding to mobile elements is provided, comprising:

[0008] (1) Construct an expression vector that fuses a target gene and a mobile element, wherein the target gene is a functional gene of the plant to be verified;

[0009] (2) The expression vector is transferred into Agrobacterium rhizogenes, so that the expression vector enters the cells of Agrobacterium rhizogenes and transforms Agrobacterium rhizogenes.

[0010] (3) The plant was infected with the transformed Agrobacterium rhizogenes to obtain positive plants that produce hairy roots;

[0011] (4) The function of the target gene in the plant is determined by the expression of the target gene in the upper tissue of the positive plant and the phenotypic differences with the control plant.

[0012] The movable element is genetic material capable of transporting the target gene from the hairy roots of the positive plant to the upper tissue.

[0013] The present invention provides a solution based on mobile element technology, which fuses a gene with the function to be verified with a mobile element, combined with efficient genetic transformation mediated by Agrobacterium rhizogenes, to generate positive hairy roots. The target gene is transcribed in the hairy roots, moves to the aboveground parts, is translated, and performs its function. The gene function is verified by observing the phenotype. The provided method is simple to operate, has high transformation efficiency, and produces stable and reliable phenotypes. It can be widely used in plant gene function research, and has significant application value, especially for verifying the function of genes that function during the vegetative growth stage.

[0014] According to embodiments of the present invention, the method for verifying plant gene function based on Agrobacterium rhizogenes and mobile elements provided above may further include the following technical features:

[0015] In some embodiments of the invention, the movable element is an RNA sequence capable of moving from the hairy roots of the positive plant to the upper tissue.

[0016] In some embodiments of the present invention, the movable element is selected from mFT, tRNA, etc. Ile tRNA Met tRNA Gly At least one of , or other tRNA variants.

[0017] In some embodiments of the present invention, the expression vector further includes a reporter gene, and step (1) includes: constructing an expression vector that fuses the target gene, a mobile element and a reporter gene.

[0018] In some embodiments of the present invention, the reporter gene is selected from fluorescent protein genes or other non-fluorescent protein genes.

[0019] In some embodiments of the present invention, step (4) further includes:

[0020] (4-1) Statistically analyze the target gene coding in the upper tissue of the positive plants, compare it with the phenotype in the upper tissue of the control plants, and determine the differential phenotype. The control plants are wild plants.

[0021] (4-2) Based on the differential phenotype, determine the function of the target gene in the plant.

[0022] In some embodiments of the present invention, the determination of differential phenotype in step (4-1) is that the phenotypes in the upper tissue of the positive plant and the upper tissue of the control plant show significant differences and are reproducible.

[0023] In some embodiments of the present invention, the plant is selected from at least one of the following species that can be infected by different Rhizoctonia solani strains: melon, cucumber, loofah, pumpkin, tobacco, pea, corn, rice, tomato, Arabidopsis thaliana, potato, soybean, radish, cabbage, sweet potato, etc.

[0024] A second aspect of the present invention provides a method for verifying plant gene function based on Agrobacterium rhizogenes binding to mobile elements, comprising:

[0025] (1) Construct an expression vector that fuses a target gene, a mobile element, and a reporter gene, wherein the target gene is a functional gene of the plant to be verified;

[0026] (2) The expression vector is transferred into Agrobacterium rhizogenes, so that the expression vector enters the cells of Agrobacterium rhizogenes and transforms Agrobacterium rhizogenes.

[0027] (3) The plant was infected with the transformed Agrobacterium rhizogenes to obtain positive plants that produce hairy roots;

[0028] (4) Detect and statistically analyze the expression and phenotype of the target gene in the upper tissues of the positive plants and wild plants, and determine the function of the target gene in the plants based on the differential expression and differential phenotype between the two.

[0029] The movable element is genetic material capable of transporting the target gene and reporter gene from the hairy roots of the positive plant to the upper tissue.

[0030] In some embodiments of the present invention, the above-mentioned method pre-selects the target gene by the following methods before steps (1) to (4): (a) determining candidate gene intervals based on plant traits, the candidate gene intervals including at least one or more genes; (b) determining the target gene based on homologous gene analysis between species.

[0031] The beneficial effects achieved by this invention are at least as follows:

[0032] (1) The method provided by this invention is simple to verify the function of plant genes, and Agrobacterium rhizogenes has high infection efficiency and simple infection operation steps.

[0033] (2) The method provided by the present invention has a short experimental cycle, requires no regeneration process, and has a short plant growth time.

[0034] (3) Select plants with positive hairy roots for phenotypic observation. The phenotypic pattern is easy to observe and the differences are easy to determine. Attached Figure Description

[0035] Figure 1 These are the observation results of roots and leaves after infection with four types of Agrobacterium rhizogenes provided in the embodiments of the present invention; A and E represent the transformation effect of the RUBY control vector, B and F represent the RUBY-mFT vector, and C and G represent the RUBY-tRNA. Ile Vector, D and H are RUBY-tRNA Met Carrier.

[0036] Figure 2 The expression level of RUBY in the aboveground parts of three vectors provided according to embodiments of the present invention was detected (**: p<0.05).

[0037] Figure 3 This is the phenotype of Agrobacterium infection after using eYGFP as a reporter gene, as provided in an embodiment of the present invention.

[0038] Figure 4 The results are rapid functional verification results of melon MELO3C024507 provided according to an embodiment of the present invention; A and B are photographs under visible light, C and D are photographs under ultraviolet excitation light, A and C are controls, and B and D are transgenic plants containing the target gene; the red arrows indicate the indentations of the leaves.

[0039] Figure 5 The results are rapid functional verification results of melon MELO3C007377 provided according to an embodiment of the present invention; A, B and C are controls, D, E and F are positive plants, B and E are photos under ultraviolet excitation light, and the rest are photos under visible light. Detailed Implementation

[0040] The embodiments of the present invention are described in detail below. Examples of these embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the present invention, but should not be construed as limiting the present invention. Furthermore, some terms used in the present invention are explained and described. It should be noted that these explanations and descriptions are only for the convenience of those skilled in the art and should not be considered as limiting the scope of protection of the present invention.

[0041] The term "fusion" as used in this article refers to the fusion of partial or complete sequences of at least two genes or at least two nucleic acid molecules to form a new transcript. For example, when discussing the fusion of a target gene and a mobile element, the genes are expressed together.

[0042] The “mobile elements” mentioned in this article are RNA sequences that can move in plants.

[0043] The term "upper tissue" as used in this article refers to the above-ground tissue of the plant.

[0044] The target gene mentioned is a gene with an undetermined function found in plants. During plant development, we often encounter plant traits that can be mapped to specific candidate regions through genetic mapping or association analysis. However, these candidate regions usually contain multiple genes, making it difficult to determine which gene within the region is associated with the trait. Therefore, the function of these genes needs to be verified. According to specific implementation methods, this includes: (a) determining candidate gene regions based on plant traits, wherein the candidate gene regions include at least one gene; and (b) identifying the target gene based on interspecies homologous gene analysis. By combining genetic mapping of plant traits with interspecies homologous gene analysis, target genes can be effectively identified, thus providing important basis for subsequent gene function research and breeding applications.

[0045] One method for identifying candidate gene regions based on plant traits is as follows: First, by studying specific plant traits, genetic maps and QTL analysis can be used to locate candidate gene regions associated with these traits. For example, by constructing genetic linkage maps and performing quantitative trait locus (QTL) analysis, the chromosomal region where the target gene is located can be narrowed down.

[0046] Then, target genes are identified based on homologous gene analysis across species: After identifying candidate gene regions, further screening can be performed by comparing homologous genes across different species. Homologous genes are genes inherited from a common ancestor in different species, and they may have similar functions. Using bioinformatics tools, such as PICARA, information from genome-wide association studies (GWAS), gene homology, and other pathways can be integrated to make probabilistic inferences about candidate genes. Furthermore, through sequence alignment and homologous gene search, homologous genes associated with the target trait can be identified, and their functional characteristics can be verified.

[0047] This invention provides a method for verifying plant gene function based on Agrobacterium rhizogenes binding to mobile elements, comprising:

[0048] (1) Construct an expression vector that fuses a target gene and a mobile element, wherein the target gene is a functional gene of the plant to be verified;

[0049] (2) The expression vector is transferred into Agrobacterium rhizogenes, so that the expression vector enters the cells of Agrobacterium rhizogenes and transforms Agrobacterium rhizogenes.

[0050] (3) The transformed Agrobacterium rhizogenes was used to infect the plant to obtain positive plants expressing hairy roots;

[0051] (4) The function of the target gene in the plant is determined by detecting the expression of the target gene in the upper tissue of the positive plant and the difference in expression with the control plant;

[0052] The movable element can transport the target gene from the hairy roots of the positive plant to the upper tissue.

[0053] The method provided in this invention is based on mobile element technology. It fuses the gene whose function to be verified with a mobile element, and combines this with highly efficient Agrobacterium rhizogenes-mediated genetic transformation to obtain positive hairy roots. The target gene is transcribed in the hairy roots, moves to the aboveground parts, is translated, and then performs its function. Gene function is verified by observing the phenotype. The provided method is simple to operate, has high transformation efficiency, and produces stable and reliable phenotypes. It can be widely used in plant gene function research, and is particularly valuable for verifying the function of genes that function during the vegetative growth stage.

[0054] The movable element is an RNA sequence that can move from the root system of the plant to the upper tissue.

[0055] According to a specific implementation, the movable element is selected from mFT, tRNA, etc. Ile tRNA Met tRNA Gly At least one of other tRNA variants. These mobile elements can effectively transport target genes from the plant roots to upper tissues for studying plant gene function.

[0056] The mFT mentioned is a truncated sequence of the mRNA of the FT (FLOWERING LOCUS T) gene, and its corresponding DNA sequence is SEQ ID NO:1.

[0057] The tRNA mentioned Ile It is an isoleucine tRNA, and its corresponding DNA sequence is SEQ ID NO:2.

[0058] The tRNA mentioned Met It is a methionine tRNA, and its corresponding DNA sequence is SEQ ID NO:3.

[0059] The tRNA mentioned Gly It is a glycine tRNA, and its corresponding DNA sequence is SEQ ID NO:4.

[0060] SEQ ID NO:1 is shown below:

[0061] TAGTCTATAAATATAAGAGACCCTCTTATAGTAAGCAGAGTTGTTGGAGACGTTCT TGATCCGTTTAATAGATCAATCACTCTAAAGGTTACTTATGGCCAA

[0062] SEQ ID NO:2 is shown below:

[0063] CCGTAGCTCAGTTGGTTAGAGCGTTGGTCTTATGAGCCGAAGGTCGCGGGTTCGAGCCCCGCCGGAAGCA

[0064] SEQ ID NO:3 is shown below:

[0065] ATTATCAGAGTGGCGCAGCGGAAGCGTGGTGGGCCCATAACCCACAGGTCCCAGGATCGAAACCTGGCTCTGAT

[0066] SEQ ID NO:4 is shown below:

[0067] TGAGCACCAGTGGTCTAGTGGCATGATAGTACCCTGCCACGGTACAGACCCGGGTTCAATTCCCGGCTGGTGCACCCGGG

[0068] In some embodiments of the present invention, the reporter gene is selected from fluorescent proteins or other reporter genes.

[0069] In some embodiments of the present invention, step (4) further includes:

[0070] (4-1) Statistically analyze the phenotypes in the upper tissues of the positive plants and the phenotypes in the upper tissues of the control plants to determine the differential phenotypes. The control plants are wild plants.

[0071] (4-2) Based on the differential phenotype, determine the function of the target gene in the plant.

[0072] According to a specific implementation, the determination of differential phenotype in step (4-1) refers to a significant difference in phenotype between the upper tissue of the positive plant and the upper tissue of the control plant, and this difference is reproducible. The significant difference refers to a detectable difference between the positive plant and the wild-type plant. According to a specific implementation, reproducibility means that the results can be repeated between multiple experiments, or that in the same experiment, significant differences in phenotype are observed between the upper tissue of more than one positive plant and the upper tissue of the control plant, with at least 50%, 60%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, and 100% of the upper tissues of the positive plants and the upper tissues of the control plants showing significant differences in phenotype.

[0073] Agrobacterium rhizogenes is a Gram-negative soil cell capable of infecting most dicotyledonous plants and a few monocotyledonous plants, as well as some gymnosperms, inducing the production of hairy roots. Specifically, Agrobacterium rhizogenes can infect plants from multiple families, including Asteraceae, Brassicaceae, Convolvulaceae, and Cucurbitaceae. It can also induce hairy roots in plants such as tobacco (Nicotiana abacum), coffee (Coffea arabica), alfalfa (Medicago sativa), and peas (Pisum sativum). Agrobacterium rhizogenes can induce hairy roots in monocotyledonous plants such as maize (Zea mays) and rice (Oryza sativa). Furthermore, leguminous forage grasses such as birdseed (Medicago sativa) and alfalfa (Lotus corniculatus) have also undergone genetic transformation mediated by Agrobacterium rhizogenes. Depending on the specific implementation method, the plants mentioned herein include, but are not limited to, melons, cucumbers, loofahs, pumpkins, tobacco, peas, maize, rice, tomatoes, Arabidopsis thaliana, potatoes, soybeans, radishes, cabbages, and sweet potatoes.

[0074] The size of the target gene is not particularly limited, but is generally below 4000bp, such as below 3500bp, below 3000bp, below 2500bp, or below 2000bp, etc.

[0075] When constructing expression vectors, reporter genes can be further included. Therefore, the provided methods for verifying plant gene function based on Agrobacterium rhizogenes binding to mobile elements include:

[0076] (1) Construct an expression vector that fuses a target gene, a mobile element, and a reporter gene, wherein the target gene is a functional gene of the plant to be verified;

[0077] (2) The expression vector is transferred into Agrobacterium rhizogenes, so that the expression vector enters the cells of Agrobacterium rhizogenes and transforms Agrobacterium rhizogenes.

[0078] (3) The plant was infected with the transformed Agrobacterium rhizogenes to obtain positive plants that produce hairy roots;

[0079] (4) Statistically analyze the phenotypes in the upper tissues of the positive plants and wild plants, determine the differential phenotypes, and determine the function of the target gene in the plants based on the differential phenotypes;

[0080] The movable element can transport the target gene and reporter gene from the hairy roots of the positive plant to the upper tissue.

[0081] The reporter genes mentioned include, but are not limited to, fluorescent protein genes, such as green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), etc., as well as other non-fluorescent protein genes, such as β-glucuronidase (GUS, a bacterial enzyme used for in situ histochemical localization of β-glucuronidase activity in cells and tissues), luciferase (derived from fireflies, used to catalyze the oxidative decarboxylation reaction of luciferin to produce light, often used in RNA-level genetic transformation reporter systems), the RUBY system (using betaine as a reporter molecule, which can non-destructively observe gene expression and genetic transformation in plants), neomycin phosphotransferase, hygromycin phosphotransferase, etc., as long as they can be used to conveniently indicate that the target gene has been successfully transformed into the plant.

[0082] The technical solution of the present invention will be described below through specific embodiments. It should be noted that these embodiments are only used to facilitate the understanding of those skilled in the art and should not be regarded as a limitation on the scope of protection of the present invention.

[0083] Example 1

[0084] Example 1 uses several different mobile elements (mFT, tRNA) Ile tRNA Met Taking this as an example, the mobility of these movable components was analyzed, specifically including:

[0085] Betalain is a natural product synthesized from tyrosine using three enzymes (CYP76AD1, DODA, and GT) as a substrate. Tyrosine is one of the most commonly used amino acids in various organisms. Since every cell contains tyrosine, using tyrosine as a substrate for betalain synthesis avoids the need for an exogenous substrate. By inserting reading frames (RUBY) containing the three enzymes CYP76AD1, DODA, and GT into the binary T-DNA vector, gene expression can be visualized.

[0086] To verify and compare the mobility of the aforementioned mobile elements, the RUBY gene vector driven by the constitutive promoter 35S was first modified. mFT (corresponding DNA sequence SEQ ID NO:1) and tRNA were inserted after the stop codon of the RUBY gene via homologous recombination. Ile (The corresponding DNA sequence is SEQ ID NO:2), tRNA Met (The corresponding DNA sequence is SEQ ID NO:3), and they are named RUBY-mFT and RUBY-tRNA, respectively. Ile and RUBY-tRNA Met Using 35S-RUBY as a control vector, Agrobacterium rhizogenes K599 was transformed into melon seedlings with flattened cotyledons using a one-step method. The seedlings were then cultured in vermiculite containing nutrient solution, and the plants were removed for observation after two weeks.

[0087] from Figure 1 As we can see, all four vectors, after infection with *Agrobacterium rhizogenes*, produced hairy roots containing the RUBY signal. Furthermore, only the control vector (35S-RUBY) transformed plants did not show the RUBY signal in the upper vegetative growth region; the other three vectors all showed the RUBY signal in the upper vegetative growth region, indicating that all three mobile elements can facilitate the transport of large RNA fragments from the roots to the upper part of the plant. qRT-PCR detection revealed the presence of the RUBY-tRNA signal. Ile The expression level of RUBY in the aerial part was significantly higher than that of the other two mobile elements, clearly indicating tRNA expression. Ile Its mobility is stronger than that of the other two types of movable elements (such as...) Figure 2 (As shown). Therefore, we confirm that all three types of mobile elements can be used for target gene function verification, but their mobility differs. We prefer tRNA, which has superior mobility. Ile Further validation of the target gene function will be conducted.

[0088] Example 2: Target Gene Function Verification

[0089] Example 2 uses the method provided by this invention to verify the function of a target gene with an unknown function in a melon. This includes:

[0090] Because the RUBY gene sequence is relatively long, it is not suitable for vectors to carry large target gene fragments. Therefore, the reporter gene was first modified by introducing eYGFPuv, which is excited under ordinary ultraviolet light and is visible to the naked eye, as a reporter gene. A one-step method was used to infect cotyledon-flattened melon seedlings, which were then cultured in vermiculite containing nutrient solution. The plants were harvested after two weeks for observation. After ultraviolet light excitation, bright eYGFPuv signals (e.g., ...) were observed in most hairy roots. Figure 3 As shown in the figure, the effectiveness of the reporter gene in the vector was verified.

[0091] The melon gene MELO3C024507 encodes a leucine zipper domain protein, a homolog of the pumpkin leaf deep lobes gene, but its function in melon is unknown. To quickly verify the function of this gene, we first cloned the CDS sequence of MELO3C024507 and then inserted the entire CDS sequence into the 35S promoter and tRNA of the backbone vector using a homologous recombination strategy. Ile Similarly, melon seedlings with flattened cotyledons were infected using a one-step method and cultured in vermiculite containing nutrient solution. Two weeks later, the plants were removed for observation. First, plants with bright eYGFPuv signals in their hairy roots were selected using UV excitation and confirmed as positive plants. Comparison of leaf phenotypes between the control and positive plants revealed that the first leaf of the positive plants exhibited a distinct concave phenotype. Figure 4 The control plant's leaves had more rounded edges. Therefore, we can confirm that the melon homologous gene MELO3C024507, which is related to the deep leaf lobes gene in pumpkin, also positively regulates the leaf notch trait. Verifying the function of this gene is beneficial for subsequent cultivation of high-light-efficiency melon plants, confirming the effectiveness of the method provided in this invention.

[0092] Example 3

[0093] Following the same method as in Example 2, we obtained a pubescence gene MELO3C007377 on melons through genetic mapping. This trait was mapped to a region containing only one gene. Then, combined with forward and reverse experiments, we confirmed that (by silencing this pubescence gene, pubescence no longer appeared on the melons; and then, using the method provided in this invention with Agrobacterium rhizogenes combined with movable elements, we found that the pubescence became denser and longer). This pubescence gene can control the growth of melon pubescence.

[0094] For reference Figure 5 The image shows the results of rapid verification of the function of the MELO3C007377 gene in melon using the method provided in this invention. Figure 5Photographs A, B, and C are of control plants, while photographs D, E, and F are of positive plants. Photographs B and E are taken under ultraviolet excitation, and the rest are taken under visible light. On positive melon plants, the trichomes were found to be denser and longer than those on control plants, verifying that the trichome gene controls the growth of melon trichomes, which is consistent with existing research on this gene. The experiment demonstrates that the method of this invention is highly reliable for verifying the function of plant genes.

[0095] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "detailed description," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0096] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A method for verifying plant gene function based on Agrobacterium rhizogenes binding to mobile elements, characterized in that, include: (1) Construct an expression vector that fuses a target gene and a mobile element, wherein the target gene is a functional gene of the plant to be verified; (2) The expression vector is transferred into Agrobacterium rhizogenes, so that the expression vector enters the cells of Agrobacterium rhizogenes and transforms Agrobacterium rhizogenes. (3) The transformed Agrobacterium rhizogenes was used to infect the plant to obtain positive plants that produce hairy roots; (4) The function of the target gene in the plant is determined by the expression of the target gene in the upper tissue of the positive plant and the phenotypic differences with the control plant. The movable element is genetic material capable of transporting the target gene from the hairy roots of the positive plant to the upper tissue.

2. The method according to claim 1, characterized in that, The movable element is an RNA sequence capable of moving from the hairy roots of the positive plant to the upper tissue.

3. The method according to claim 1, characterized in that, The movable element is selected from mFT, tRNA Ile tRNA Met tRNA Gly At least one of , or other tRNA variants; Optionally, the mFT, tRNA Ile tRNA Met tRNA Gly The corresponding DNA sequences are SEQ ID NO:1 to SEQ ID NO:

4.

4. The method according to claim 1, characterized in that, The expression vector further includes a reporter gene, and step (1) includes: constructing an expression vector that fuses the target gene, a mobile element and a reporter gene.

5. The method according to claim 4, characterized in that, The reporter gene is selected from fluorescent protein genes or other non-fluorescent protein genes.

6. The method according to claim 1, characterized in that, Step (4) further includes: (4-1) Statistically analyze the expression of target genes in the upper tissue of the positive plants, compare the phenotype of the upper tissue of the control plants, and determine the differential phenotypes. The control plants are wild plants. (4-2) Based on the differential phenotype, determine the function of the target gene in the plant.

7. The method according to claim 6, characterized in that, The differential phenotype described in (4-1) is defined as a significant difference in phenotype between the upper tissue of the positive plant and the upper tissue of the control plant, and is reproducible.

8. The method according to claim 1, characterized in that, The plant is selected from at least one of the following: melon, cucumber, loofah, pumpkin, tobacco, pea, corn, rice, tomato, Arabidopsis thaliana, potato, soybean, radish, cabbage, and sweet potato, which can be infected by different Rhizopus agronomica strains.

9. A method for verifying plant gene function based on Agrobacterium rhizogenes binding to mobile elements, characterized in that, include: (1) Construct an expression vector that fuses a target gene, a mobile element, and a reporter gene, wherein the target gene is a functional gene of the plant to be verified; (2) The expression vector is transferred into Agrobacterium rhizogenes, so that the expression vector enters the cells of Agrobacterium rhizogenes and transforms Agrobacterium rhizogenes. (3) The transformed Agrobacterium rhizogenes was used to infect the plant to obtain positive plants that produce hairy roots; (4) Detect and statistically analyze the expression and phenotype of the target gene in the upper tissues of the positive plants and wild plants, and determine the function of the target gene in the plants based on the differential expression and differential phenotype between the two. The movable element is genetic material capable of transporting the target gene and reporter gene from the hairy roots of the positive plant to the upper tissue.

10. The method according to any one of claims 1 to 9, characterized in that, Before steps (1) to (4), the target gene is determined in advance by the following method: (a) Determine candidate gene intervals based on plant traits, wherein the candidate gene intervals include at least one gene; (b) Target genes identified based on homologous gene analysis among species.

Images