Hairpin probe capable of forming dimer palindromic sequence and application thereof

By embedding multiplex amplification and tandem CRISPR/Cas activation functions into a single hairpin probe, the complexity caused by probe dispersion design in existing technologies is solved, achieving highly sensitive and specific miRNA detection, which is suitable for the early diagnosis of breast cancer patients.

CN122038535APending Publication Date: 2026-05-15JIAXING UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610170441.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-05
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

In existing isothermal nucleic acid amplification-CRISPR/Cas12a strategies, probes, amplification templates, slice substrates, and Cas12a triggers are independent molecular components, resulting in complex designs and constraints between modules, which limit system simplification and sensitivity improvement.

Method used

Design a hairpin probe that can form a palindromic dimer sequence, embedding a crRNA recognition region, a nuclease recognition region, a stem region, and a miRNA recognition region, to achieve multiplex amplification and tandem dual CRISPR/Cas activation in a single probe, forming a dimer CRISPR/Cas complex and generating an amplified fluorescence signal.

Benefits of technology

It achieves highly sensitive and specific miRNA detection, simplifies the amplification process, provides a quantitative range of 0.0001 to 1000 pM, and has a detection limit of up to 56 aM, successfully distinguishing whole blood total miRNA extracts from healthy individuals and breast cancer patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122038535A_ABST
    Figure CN122038535A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biomolecular detection, in particular to a hairpin probe capable of forming a palindromic dimer sequence and application of the hairpin probe. Specifically, the hairpin probe provided by the invention comprises a palindromic sequence region (two hairpin probe monomers can be dimerized to form a dimeric palindromic hairpin probe Di-PaH); a crRNA recognition region; an endonuclease recognition region (e.g., Nt.BbvCI endonuclease); the two regions can form the stem of the hairpin probe through complementary base pairing; a miRNA recognition region; optionally, a PAM motif, for docking a Cas nuclease, is provided. The hairpin probe provided by the invention can be used for an isothermal nucleic acid amplification-CRISPR / Cas reaction system to generate an amplified fluorescence signal, so as to obtain ultra-sensitive and specific quantitative detection of miRNA (such as miRNA-155).
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomolecular detection technology, specifically to a hairpin probe capable of forming palindromic dimer sequences and its applications. Background Technology

[0002] Isothermal nucleic acid amplification (ALA) refers to an amplification strategy that operates at an isothermal temperature without thermal cycling. Compared to PCR, isothermal ALA offers simpler instrumentation, continuous reaction kinetics, lower operating temperatures, and better point-of-care compatibility. CRISPR / Cas12a is an RNA-guided nuclease that uses crRNA to recognize complementary nucleic acid targets and switches to a catalytically active state upon target binding, cleaving single-stranded DNA reporter proteins. Depending on the detection design, activation can be achieved via double-stranded DNA carrying appropriate PAMs or by complementary single-stranded DNA without PAM requirements. This mechanism possesses programmable sequence specificity, potential single-base discrimination capability, and strong catalytic signal amplification suitable for single-potentiometer readout. Methodologically, combining isothermal ALA with CRISPR / Cas12a transcleavage has become a powerful strategy for converting micro-volume nucleic acid targeting into strong fluorescent output. This overall approach leverages the ability of isothermal systems to generate abundant target-related sequences and the ability of Cas12a to amplify signals through side-branch reporter breaks, thereby achieving high sensitivity while maintaining molecular specificity. In recent years, this combined isothermal amplification-CRISPR / Cas12a strategy has been widely used to detect nucleic acid biomarkers, including miRNAs closely related to malignant transformation and tumor progression, and is therefore widely considered to be highly informative cancer biomarkers. For example, Deng et al. constructed a self-assembled cascade double-loop DNA circuit by integrating catalytic hairpin assembly and hybridization chain reaction to initiate a CRISPR system. Shen et al. achieved CRISPR / Cas12a activation by employing multiple amplification strategies, including rolling circular amplification and hybridization chain reaction.

[0003] However, a key structural feature of most existing systems is often underestimated: their amplification capabilities are achieved through a multi-unit architecture, where the recognition probe, amplification template, slice substrate, and Cas12a trigger are physically independent molecular components. While each reaction module is chemically sound, the entire workflow becomes a cascade of multiple probes and steps, inevitably increasing design overhead and introducing inter-module coupling constraints, ultimately limiting the simplification potential of these systems. In other words, increased sensitivity is often achieved by "stacking more amplification modules" rather than by rethinking whether amplification can be realized as an intrinsic property within a single molecular structure.

[0004] Therefore, embedding the desired functional structure directly into a single probe, rather than dispersing it across multiple interacting independent strands, while still maintaining amplification gain, is an approach not yet reported in isothermal amplification-CRISPR / Cas12a strategies. Summary of the Invention

[0005] To address the problems existing in the prior art, this invention provides a hairpin probe capable of forming a palindromic dimer sequence. The probe includes a palindromic sequence region (allowing two hairpin probe monomers to dimerize and form a dimeric palindromic hairpin probe Di-PaH); a crRNA recognition region; a nuclease recognition region (e.g., Nt.BbvCI nuclease); a region where two bases can pair complementaryly to form the stem of the hairpin probe; a miRNA recognition region; and optionally, a PAM motif for docking with Cas nucleases. This hairpin probe can be used in isothermal nucleic acid amplification-CRISPR / Cas reaction systems to form a detection system based on a dimerized palindromic hairpin-driven multiplex amplification coupled with tandem dual Cas activation. Specifically, in this detection system, a multiplex amplification system is constructed to generate extended double-stranded DNA, which is then used to activate the tandem dual CRISPR / Cas system, resulting in a dimerized CRISPR / Cas complex composed of two Cas-crRNA units. This generates an amplified fluorescence signal, enabling ultrasensitive and specific quantitative detection of miRNAs (e.g., miRNA-155).

[0006] In this regard, the present invention includes, but is not limited to, the following: In one embodiment, the present invention provides a hairpin probe capable of forming a dimer palindromic sequence, comprising: The palindromic sequence region, located at the 3' or 5' end, allows the hairpin probe monomers to dimerize and form a dimer palindromic hairpin probe through complementary base pairing in the palindromic sequence region. The crRNA recognition region is used for complementary base pairing with crRNA in the CRISPR / Cas system; The endonuclease recognizes a half-site, which can be specifically cleaved by the endonuclease when forming a double-stranded structure; The stem region is formed by spontaneous base pairing of two complementary single-stranded regions; Target recognition area; and Alternatively, PAM motifs; The hairpin probe comprises, from the 5' end to the 3' end, a palindromic sequence region, a PAM motif, a crRNA recognition region, a nuclease recognition half-site, a single-stranded region of the stem region, a target recognition region, and another single-stranded region of the stem region. After the single-stranded region of the stem region and the other single-stranded region are complementary, the target recognition region is on the loop of the hairpin probe, and the 3' end of the hairpin probe is capped by an inverted dT.

[0007] In one embodiment, the length of the palindromic sequence region of the present invention is 8 nt or more, preferably 10 nt; And / or, the length of the crRNA recognition region is 16-24 nt, preferably 20 nt; And / or, the length of the stem region is 10-16 bp, preferably 10 bp; And / or, the length of the target recognition region is 19-23 nt, preferably 20 nt.

[0008] In one embodiment, the target recognition region of the present invention is used to bind to a miRNA selected from: miRNA-155, miRNA-21, miRNA-1290, miRNA-19a, miRNA-16, miRNA-141, miRNA-145, or a miRNA having at most two base mutations compared to any of the aforementioned miRNAs, preferably, binding to miRNA-155.

[0009] In one embodiment, the sequence of the palindromic sequence region of the present invention is as shown in SEQ ID NO: 16; And / or, the sequence of the crRNA recognition region is shown in SEQ ID NO: 18; And / or, the sequence of the endonuclease recognition half-site is shown in SEQ ID NO: 19; And / or, the stem region is formed by complementary base pairing of the sequences shown in SEQ ID NO: 21 and SEQ ID NO: 22; And / or, the sequence of the PAM motif is shown in SEQ ID NO: 17; And / or, the target recognition region binds to miRNA-155 and has at most two base mutations compared to the sequence shown in SEQ ID NO: 18, preferably, the sequence of the target recognition region is as shown in SEQ ID NO: 18.

[0010] In one embodiment, the present invention also provides the use of the hairpin probe of the present invention in the detection of miRNA, preferably, wherein the miRNA has at most two base mutations compared to the sequence shown in SEQ ID NO: 2. In another embodiment, the present invention provides the use of the hairpin probe of the present invention in the preparation of a kit for detecting breast cancer patients, wherein the levels of miRNA-155 in the blood of breast cancer patients are significantly higher than in healthy individuals, and wherein the miRNA-155 has at most two base mutations compared to the sequence shown in SEQ ID NO: 2.

[0011] In yet another embodiment, the present invention provides a method for detecting miRNA, the method comprising: mixing the hairpin probe of the present invention with a solution of DNA polymerase, endonuclease, dNTP, Cas nuclease, crRNA and reporter gene probe and a sample suspected of containing the miRNA to be tested, and detecting the fluorescence intensity of the mixture. When the fluorescence intensity of the mixture is higher than the background level, it indicates that the sample contains the miRNA to be tested. Preferably, the miRNA has at most two base mutations compared with the sequence shown in SEQ ID NO: 2.

[0012] In one embodiment, the DNA polymerase of the present invention is selected from phi29 DNA polymerase or Klenow polymerase; And / or, the endonuclease is Nt.BbvCI endonuclease; And / or, the Cas nuclease is Cas12a and the sequence of the crRNA is as shown in SEQ ID NO: 4; And / or, the sequence of the reporter gene probe is shown in SEQ ID NO: 5; And / or, the sample suspected of containing the miRNA to be tested is selected from whole blood, serum, plasma, or tissue homogenate.

[0013] In one embodiment, the amount of DNA polymerase and endonuclease in the mixture of the present invention is 1 U or more, preferably 3 U or more; And / or, the mixture is incubated for at least 30 minutes, preferably at least 60 minutes.

[0014] In one embodiment, the miRNA of the present invention is miRNA-155 and has at most two base mutations compared to the sequence shown in SEQ ID NO: 2.

[0015] In one embodiment, the miRNA of the present invention is miRNA-155 and has at most one base mutation compared to the sequence shown in SEQ ID NO: 2. In one embodiment, the present invention also provides a kit for detecting miRNA-155, the kit comprising the hairpin probe according to the present invention.

[0016] In one embodiment of the present invention, a method for detecting miRNA-155 based on a dimer palindromic hairpin-driven multiplex amplification system is also provided, comprising constructing a multiplex amplification system to generate extended double-stranded DNA and using it to activate a tandem dual CRISPR / Cas12a system to obtain a dimer CRISPR / Cas12a complex composed of two Cas12a-crRNA units, generating an amplified fluorescence signal, and obtaining quantitative detection of miRNA-155.

[0017] In one embodiment of the present invention, the multiplex amplification system comprises hybridizing a dimerized palindromic hairpin probe Di-PaH with miRNA-155, followed by extension with a DNA polymerase (e.g., phi29 DNA polymerase) to obtain a polymerized product, and simultaneously cleaving with a restriction endonuclease (e.g., Nt.BbvCI endonuclease) to form a large number of trigger strands. Because the trigger strands are palindromic, they undergo intermolecular pairing and polymerase-driven elongation to form an extended double-stranded DNA.

[0018] In one embodiment of the present invention, the extended double-stranded DNA acts as an activator to activate a CRISPR / Cas system (e.g., a CRISPR / Cas12a system) to obtain a tandem dual CRISPR / Cas complex consisting of two Cas-crRNA units.

[0019] In one embodiment of the present invention, the tandem dual CRISPR / Cas complex comprises the extended double-stranded DNA carrying two independent crRNA binding sites, thereby simultaneously activating two Cas complexes at the same output.

[0020] In one embodiment of the present invention, the 3' of the hairpin probe is modified with an inverted T to prevent its own non-specific extension.

[0021] In one embodiment, the sequence of the hairpin probe of the present invention is shown in SEQ. ID NO: 1.

[0022] In one embodiment, the miRNA of the present invention is miRNA-155, the sequence of which is shown in SEQ ID NO: 2.

[0023] In another embodiment, the present invention provides a method for detecting miRNA-155, the specific steps of which include: (1) Prepare TE buffer, DEPC-treated water, phi29 buffer, dimer-palindrome hairpin probe (Di-PaH), phi29 DNA polymerase, dNTPs, Nt.BbvCI endonuclease and miRNA. After mixing 155, incubate at 37°C for 30-70 minutes, then heat to 80°C for 10 minutes to inactivate enzyme activity, to obtain reaction solution 1; (2) The reaction solution 1 was mixed with NE buffer™ r2.1, DEPC-treated water, Lba Cas12a, crRNA and reporter gene and incubated at 30~37℃ for 60 minutes to obtain reaction solution 2; (3) After diluting the reaction solution 2, the fluorescence intensity of miRNA-155 was detected.

[0024] In one embodiment, the preparation method of the dimer palindromic hairpin probe Di-PaH of the present invention includes: dissolving a single strand of hairpin probe DNA with the sequence shown in SEQ ID NO: 1 in TAE / Na... + / Mg 2+ The hairpin probe solution was denatured at 90-95°C for 2-5 minutes and then gradually cooled to room temperature to obtain the dimer hairpin probe Di-PaH.

[0025] In one embodiment, the TAE / Na of the present invention + / Mg 2+ The buffer solution consists of 10 mM Tris, 1 mM EDTA, 50 mM NaCl and 15 mM MgCl2•6H2O.

[0026] In one embodiment, the present invention detects miRNA-155 at an excitation wavelength of 490 nm and measures the fluorescence emission intensity at 520 nm. More specifically, the miRNA-155 fluorescence measurement specifically includes: excitation of a 4SGelred fluorescent dye at 490 nm, recording the emission spectrum in the range of 500 to 650 nm, and measuring the fluorescence emission intensity at 520 nm. Both the excitation and emission slits are set to 10 nm, and the PMT voltage is maintained at 650 V.

[0027] In some preferred embodiments, the method for preparing the dimer-palindromic hairpin probe Di-PaH includes: dissolving a single strand of palindromic hairpin probe DNA with the sequence shown in SEQ. ID NO: 1 in 1×TAE / Na... + / Mg 2+ The buffer solution was prepared to a final concentration of 10 μM, denatured at 95 °C for 5 minutes, and then gradually cooled to room temperature to obtain the dimer-palindromic hairpin probe Di-PaH. The prepared Di-PaH was stored at -20 °C for long-term preservation.

[0028] Furthermore, the concentration of the palindromic hairpin probe DNA single strand is 100 μM.

[0029] In some preferred embodiments, the Di-PaH is combined with microRNA Hybridization at 155 initiates phi29-mediated elongation, completing the Nt.BbvCI recognition site. Subsequent cyclic clefting regenerates new 3' initiating ends, continuously generating trigger strands. Because these trigger strands are palindromic, they undergo intermolecular pairing and polymerase-driven elongation to form an extended double strand, further enhancing the signal. In one specific implementation, the method for detecting miRNA-155 according to the present invention includes: Mix 11 μL 1×TE buffer, 3 μL DEPC-treated water, 2.5 μL 10×phi29 buffer, 2.5 μL 5 μM Di-PaH, 0.5 μL phi29 (3 U), 0.5 μL Nt.BbvCI endonuclease (3 U), 2.5 μL dNTP (25 mM), and 2.5 μL of a solution containing miRNA-155. Incubate at 37°C for 30–70 minutes, then heat at 80°C for 20 minutes to terminate the enzymatic reaction, yielding reaction solution 1. 25 μL of reaction solution 1 was mixed with 8 μL of NEBuffer™ r2.1, 8 μL of DEPC-treated water, 1 μL of LbCas12a (1 μM), 1 μL of CrRNA (1 μM), and 2 μL of reporter gene probe (5 μM), and incubated at 37°C for 60 minutes to activate CRISPR / Cas12a, yielding reaction solution 2; and 45 μL of reaction solution 2 was diluted with ultrapure water to a final volume of 120 μL. The emission spectrum was recorded in the range of 500 to 650 nm at an excitation wavelength of 490 nm, and the fluorescence emission intensity was measured at 520 nm. Both the excitation and emission slits were set to 10 nm, and the PMT voltage was maintained at 650 V for fluorescence measurement.

[0030] Furthermore, in the reaction solution 1, the amount of phi29 DNA polymerase used in each 25 μL of the reaction solution is 1~5 U; preferably, the amount of phi29 DNA polymerase used is 3 U.

[0031] Furthermore, in the reaction solution 1, the amount of Nt.BbvCI cleaving enzyme in each 25 μL of the reaction solution is 1~5 U; preferably, the amount of Nt.BbvCI cleaving enzyme is 3 U.

[0032] Furthermore, the concentration of the dimer palindromic hairpin probe Di-PaH is 5 μM.

[0033] Furthermore, the concentration of the dNTP is 25 mM.

[0034] Furthermore, the Di-PaH is prepared using 1× TAE / Na + / Mg 2+ Dilute the buffer to 5 μM.

[0035] Furthermore, the concentration of LbCas12a is 1 μM.

[0036] Furthermore, the concentration of crRNA was 1 μM.

[0037] Furthermore, the concentration of the reporter gene was 5 μM.

[0038] In some preferred embodiments, the method for monitoring fluorescence signals in whole blood miRNA samples from cancer patients includes: miRNA was extracted from fresh anticoagulated whole blood of breast cancer patients and healthy individuals using a whole blood miRNA extraction kit, serving as the experimental group and control group, respectively. The integrated amplification system provided in this invention was used to detect and compare the miRNA in the experimental group and control group. The specific steps included: (1) Dilute the extracted and purified whole blood miRNA tenfold with DEPC-treated water.

[0039] (2) Mix 11 μL 1×TE buffer, 3 μL DEPC-treated water, 2.5 μL 10×phi29 buffer, 2.5 μL 5 μM Di-PaH, 0.5 μL phi29 (3 U), 0.5 μL Nt.BbvCI endonuclease (3 U), 2.5 μL dNTP (25 mM) and 2.5 μL diluted whole blood total miRNAs, incubate at 37°C for 30-70 minutes, and then heat at 80°C for 20 minutes to terminate the enzymatic reaction to obtain reaction solution 1.

[0040] (3) Mix reaction solution 1 with 8 μL NEBuffer™ r2.1, 8 μL DEPC-treated water, 1 μL LbCas12a (1 μM), 1 μL CrRNA (1 μM) and 2 μL reporter gene probe (5 μM), and incubate at 37°C for 60 minutes to activate CRISPR / Cas12a to obtain reaction solution 2.

[0041] (4) Dilute 45 μL of reaction solution 2 with ultrapure water to a final volume of 120 μL. Record the emission spectrum in the range of 500 to 650 nm at an excitation wavelength of 490 nm, and measure the fluorescence emission intensity at 520 nm. Both the excitation and emission slits are set to 10 nm, and the PMT voltage is maintained at 650 V for fluorescence measurement.

[0042] The beneficial technical effects obtained by this invention include at least the following: The hairpin probe provided by this invention, capable of forming a dimer palindrome series (Di-PaH), incorporates all the functional domains required for trigger generation, enabling intrinsic programming of two Cas12a activations at the probe level. It allows for the establishment of a simplified yet high-gain framework using a single probe.

[0043] The multiplex amplification coupled tandem dual Cas12a system provided by this invention offers high analytical performance, with a quantitation range of 0.0001 to 1000 pM and a detection limit of up to 56 aM. This system also exhibits strong sequence specificity and successfully distinguishes whole blood total miRNA extracts from healthy individuals and breast cancer patients, highlighting its practicality.

[0044] The hairpin probes of the Di-Palindromic series (Di-PaH) provided by this invention can be used for the detection of other miRNAs or DNA through simple design, and can become a universal high-sensitivity detection method. Attached Figure Description

[0045] Figure 1 This diagram shows the structural design and functional analysis of the PaH probe in a typical example.

[0046] Figure 2 This diagram illustrates the mechanistic working principle of Di-PaH-driven multiplex amplification and tandem dual Cas12a activation in a typical example.

[0047] Figure 3 The fluorescence curves and schematic diagrams shown are obtained under three representative reaction configurations provided in Example 1: one lacking polymerase (A), one lacking cleavage enzyme (B), and one containing both polymerase and cleavage enzyme (C).

[0048] Figure 4 This shows a gel electrophoresis image of the Di-PaH directional signal amplification provided in Example 2.

[0049] Figure 5 The graphs shown in Example 4 are: sensitivity fluorescence curve (A), fluorescence intensity thermogram (B), fluorescence intensity comparison graph (C), and linear fitting graph (D).

[0050] Figure 6 The images show a comparison of fluorescence intensity (A and B) between non-target miRNAs and single-base mutations and multiple-base mutations (C and D) using the multiplex amplification coupled tandem dual Cas12a activation system provided in Example 5.

[0051] Figure 7This diagram (A) shows the detection of miRNA-155 in blood samples from breast cancer patients and healthy controls using the method in Example 1 in Example 6, along with a comparison of fluorescence intensity (B).

[0052] Figure 8 This shows gel electrophoresis images of the triggering of the method provided in Example 2 under different reaction configurations and its intermolecular interactions.

[0053] Figure 9 The comparison diagrams (A and B) show the fluorescence intensity and signal-to-noise ratio of the multiplex amplification coupled tandem dual Cas12a activation system under different amounts of phi29 DNA polymerase and Nt.BbvCI added, as provided in Example 3. Detailed Implementation

[0054] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, and not all embodiments.

[0055] See Figure 1 This is an exemplary schematic diagram illustrating the structural design and functional analysis of the palindromic hairpin single probe PaH provided by this invention. As shown in the figure, to achieve the goal of encoding the entire amplification logic within a single molecular scaffold, the PaH is rationally designed as a modular yet continuous domain organization (Scheme 1). At the 5' end, a 10 nt palindromic segment (“GAGATATCTC”) is added to drive the palindromic-guided PaH dimerization into Di-PaH, followed by the addition of a typical TTTG palindromic PAM motif for Cas12a docking. The sequence TCAACATCAGTCTGATAAGC is isochronous with the corresponding crRNA's 3' region (different only in T / U substitution), and “GCTGAGG” constitutes the half-site recognized by Nt.BbvCI. The two complementary regions GTACGTAACA and TGTTACGTAC self-hybridize to form the hairpin stem. To prevent unnecessary self-elongation, the 3' end is capped with an inverted dT, effectively inhibiting intramolecular polymerization. The ACCCCTATCACGATTAGCATT segment serves as the recognition domain for miRNA-155. These characteristics work together to ensure that target binding, motif completion, cuts, and trigger generation can all be initiated and propagated within a single probe architecture.

[0056] See Figure 2The diagram illustrates the mechanistic working principle of Di-PaH-driven multiplex amplification and tandem dual Cas12a activation provided by this invention. As shown, during target recognition, two miRNA-155 molecules hybridize with Di-PaH to form a stable Di-PaH / (miRNA-155)2 double strand. In the presence of phi29 DNA polymerase, the 3' end of miRNA-155 acts as a primer, extending continuously along the two PaH templates. During this extension process, the initially incomplete Nt.BbvCI half-site (GCTGAGG) is converted into a complete recognition cassette (GCTGAGG and CCTCAGC). Once the complete site is established, Nt.BbvCI cleaves the newly formed double lock, creating a specific nick and releasing a new 3'-hydroxyl end. The newly generated 3'-hydroxyl hydrogen acts as another polymerase initiation site, driving further strand extension and displacing downstream regions. This repeated cycle of recognition site completion, Nt.BbvCI nicking, polymerase extension, and strand displacement produces a large number of short trigger strands with palindromic encoding and 3' protrusions. These triggers pair intermolecularly with the phi29 polymerase via their palindromic complementary ends, subsequently driving bidirectional elongation from both ends to form an extended trigger duplex. The resulting double strand exposes two spatially separated crRNA-binding domains within a single molecular product, allowing simultaneous binding of two Cas12a-crRNA complexes. Once each complex binds to its crRNA-binding domain, cis activation of both nucleases synergistically enhances the trans-cleavage rate of the fluorescence reporter, significantly boosting fluorescence output. In the absence of miRNA-155, Di-PaH remains in an unextended hairpin state. The Nt.BbvCI recognition cassette is incomplete, the cleavage polymerization cycle is not initiated, no trigger strand is generated, no dimerized trigger duplex is formed, and Cas12a cannot be co-recruited. Therefore, the fluorescence signal remains at background levels.

[0057] The platform uses a strategy of using a dimer palindromic hairpin Di-PaH composed of a single probe to drive multiplex amplification and couple tandem dual Cas12a activation, which simplifies most signal amplification processes that rely on multi-unit architectures. Furthermore, compared with single Cas12a systems, it can significantly enhance the side branch cleavage of ssDNA reporter genes and generate a large amount of amplified fluorescence signals.

[0058] The detection kit using the above technical solution has a linear detection range of 0.0001 pM to 1000 pM and a detection limit of 56 aM. Specificity tests have confirmed that the dimer-palindromic hairpin (Di-PaH) driven multiplex amplification coupled with tandem dual Cas12a activation system provided by this invention can accurately distinguish miRNA-155 from closely related sequences and point mutations.

[0059] Furthermore, the fluorescence signal was significantly increased when applied to whole blood miRNA samples from cancer patients, validating its clinical potential for early diagnosis and monitoring.

[0060] The technical solution of the present invention will be further described in detail below with reference to several preferred embodiments and accompanying drawings. This embodiment is implemented on the premise of the technical solution of the invention, and provides detailed implementation methods and specific operation processes. However, the protection scope of the present invention is not limited to the following embodiments.

[0061] Unless otherwise specified, the experimental materials used in the examples below can be purchased from conventional biochemical reagent companies.

[0062] All HPLC-purified DNA and RNA sequences (sequence listing) were synthesized and quantified by Sangon Biotechnology Co., Ltd. (Shanghai, China).

[0063] Enzymes and their corresponding buffers, including Phi29 DNA polymerase and 10×Phi29 buffer (50 mM Tris-HCl, 10 mM MgCl2, 10 mM (NH4)2SO4, 4 mM DTT, pH 7.5, 25 ℃), Nt.BbvCI endonuclease and 1×rCutSmart TM Buffer (50 mM KOAc, 20 mM Tris-acetate, 10 mM Mg(OAc)2, 100 µg / mL Recombinant Albumin, pH 7.9, 25 ℃), EnGen® Lba Cas12a (Cpf1) and NE buffer TM r2.1 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg / mL Recombinant Albumin, pH 7.9, 25℃) and EnGen® Lba Cas12a diluent (500 mM NaCl, 20 mM NaOAc, 0.1 mM EDTA, 0.1 mM Tris(2-chloroethyl) phosphate TCEP, 50% Glycerol, pH 6, 25℃) were all purchased from New England Biolabs (USA) Ltd. (Beijing, China).

[0064] Other reagents, including 1×TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0), DEPC-treated water, dNTPs (including 100 mM dATP, 100 mM dGTP, 100 mM dCTP and 100 mM dTTP), N,N,N',N'-tetramethylethylenediamine (TEMED), 30% acrylamide:bisacrylamide (29:1), 6×DNA loading buffer, 25-500 bp DNA marker, 4S Gelred nucleic acid dye (10000×), and 1×TBE (89 mM Tris-boric acid, 2 mM EDTA, pH 8.2~8.4 at 25℃), were all purchased from Sangon Biotech Co., Ltd. (Shanghai, China).

[0065] The whole blood miRNA extraction kit was purchased from HaiGene Biotech Co., Ltd (product number: B1803).

[0066] Ultrapure water (resistivity 18.2 MΩ / cm) was used with the Milli-A10 system (Millipore) and throughout the experiment.

[0067] Instruments and Meters: Fluorescence spectra were measured using an F97 Pro fluorescence spectrophotometer (Shanghai Lingguang Technology Co., Ltd.).

[0068] The electrophoresis results were analyzed using the GelDoc Go gel imaging system and Image Lab analysis software (Bio-Rad Laboratories, Inc.).

[0069] The sequences used in this invention are shown in Table 1.

[0070] Table 1 Sequence List

[0071] The technical solution of the present invention will be further described in detail below through specific embodiments.

[0072] Example 1 evaluated the feasibility of using hairpin probes capable of forming dimer palindromic sequences to detect miRNA-155. This embodiment provides a method for detecting miRNA-155 based on a dimer palindromic hairpin-driven multiplex amplification coupled tandem dual Cas12a activation system, specifically including the evaluation of the feasibility of the system under three different reaction configurations.

[0073] In experimental condition I, the main reaction components of the reaction system include: Di-PaH, miRNA-155, Nt.BbvCI endonuclease, dNTP, Cas12a, crRNA, and ssDNA reporter gene.

[0074] Concentrations of each component in the reaction system: [Di-PaH] = 5 μM, [miRNA-155] = 1 μM, [phi29 polymerase] = 5 U, [Nt.BbvCI endonuclease] = 5 U, [dNTPs] = 25 mM, [Cas12a] = 1 μM, [crRNA] = 1 μM, [ssDNA reporter gene] = 5 μM.

[0075] The response was also compared with that with and without the addition of the target miRNA-155.

[0076] The specific operating steps include: First, a dimer palindromic hairpin probe, Di-PaH, is provided.

[0077] Dissolve the Di-PaH DNA single strand (concentration 100 μM) with the sequence shown in SEQ. ID NO: 1 in 1×TAE / Na + The sample was denatured in Mg2+ buffer to a final concentration of 10 μM at 95 °C for 5 minutes, and then gradually cooled to room temperature to obtain the dimer-palindromic hairpin probe Di-PaH.

[0078] The prepared Di-PaH was used with 1× TAE / Na + Dilute the Di-PaH solution to 5 μM with Mg2+ buffer for later use, or store the prepared Di-PaH solution at -20 °C for long-term preservation.

[0079] Then, 11 μL of 1×TE buffer, 3 μL of DEPC-treated water, 2.5 μL of 10×phi29 buffer, 2.5 μL of 5 μM Di-PaH, 0.5 μL of phi29 (3 U), 0.5 μL of Nt.BbvCI (3 U), 2.5 μL of dNTP (25 mM), and 2.5 μL of miRNA-155 (concentrations of 50 aM, 500 aM, 5 fM, 50 fM, 500 fM, 5 pM, 50 pM, 500 pM, 5 nM, 50 nM, respectively) were mixed and incubated at 37°C for 30–70 minutes. The enzymatic reaction was then terminated by heating at 80°C for 20 minutes to obtain reaction solution 1.

[0080] Add NEBuffer™ r2.1, LbCas12a, crRNA, and reporter gene probe to reaction solution 1. Specifically, mix 25 μL of reaction solution 1 with the above components.

[0081] 25 μL of reaction solution 1 was mixed with 8 μL of NEBuffer™ r2.1, 8 μL of DEPC-treated water, 1 μL of LbCas12a (1 μM), 1 μL of CrRNA (1 μM), and 2 μL of reporter gene probe (5 μM), and incubated at 37°C for 60 minutes to activate CRISPR / Cas12a, to obtain reaction solution 2.

[0082] 45 μL of reaction solution 2 was diluted with ultrapure water to a final volume of 120 μL. The emission spectrum was recorded in the range of 500 to 650 nm at an excitation wavelength of 490 nm, and the fluorescence emission intensity was measured at 520 nm. Both the excitation and emission slits were set to 10 nm, and the PMT voltage was maintained at 650 V for fluorescence measurement.

[0083] In Experimental Condition II, the difference from Experimental Condition I is that the Nt.BbvCI endonuclease is replaced with phi29 DNA polymerase.

[0084] In Experimental Condition III, the difference from Experimental Condition I is that phi29 DNA polymerase and Nt.BbvCI endonuclease are added.

[0085] like Figure 3 Figure A shows the fluorescence reaction curve under experimental condition I. As can be seen from the figure, the phi29 DNA polymerase was omitted, while Di-PaH, dNTPs, and Nt.BbvCI were retained. Under this structure, miRNA-155 could not be elongated because the polymerase did not initiate template expansion. There was no double-strand extension, the half-Nt.BbvCI motif was incomplete, no effective cleavage occurred, no trigger strand was generated, and the fluorescence signal remained at the background level.

[0086] like Figure 3 As shown in Figure B, in the absence of Nt.BbvCI endonuclease, phi29 polymerase and dNTPs are present. miRNA-155 hybridizes with Di-PaH and triggers polymerase extension, producing extended Di-PaH-derived products. However, due to the lack of serration and the absence of regeneration of new 3′-OH ends, the system performs only one extension step instead of a regeneration amplification cycle. Therefore, a small amount of extended Di-PaH / miRNA-155 double strands are produced. These products can activate single-Cas12a to a limited extent, resulting in only a slight increase in fluorescence.

[0087] like Figure 3As shown in Figure C, miRNA-155, phi29 polymerase, dNTPs, and Nt.BbvCI endonuclease are present simultaneously. In this complete configuration, miRNA-155 initiates polymerase extension, completing the Nt.BbvCI recognition cassette. Subsequently, the Nt.BbvCI endonuclease introduces strand cleavage, generating a new 3'-OH terminus, and immediately restarts extension, realizing a cycle of extension, cleavage, strand regeneration, and triggered release.

[0088] Example 2: Investigation of products at each stage in a reaction system containing a Di-PaH probe To further elucidate the reaction mechanism, this embodiment, based on Example 1, analyzed the products generated under six reaction configurations using native-PAGE, including the complete reactions of (a) Di-PaH, (b) miRNA-155, (c) miRNA-155+Di-PaH, (d) miRNA-155+Di-PaH+Phi29 DNA polymerase+dNTPs, (e) Di-PaH+Phi29 DNA polymerase+dNTPs+Nt.BbvCI endonuclease, and (f) miRNA-155+Di-PaH+Phi29 DNA polymerase+dNTPs. PAGE band analysis was performed.

[0089] The concentrations of each component were: [Di-PaH] = 2.5 μM, [miRNA-155] = 1 μM, [phi29 DNA polymerase] = 5 U, [Nt.BbvCI] = 5 U, and [dNTPs] = 25 mM.

[0090] See results Figure 4 Lane a only displays the bands corresponding to Di-PaH.

[0091] In lane b, the formation of the Di-PaH / (miRNA-155)2 complex was characterized by a new, slower-migrating band appearing 100 base pairs above the Di-PaH band. This band corresponds to the expected size of the Di-PaH / (miRNA-155)2 double strand, indicating that a Di-PaH scaffold can simultaneously bind two miRNA-155 molecules through its paired recognition domains.

[0092] Channel c contains Di-PaH, Phi29 DNA polymerase, and dNTPs, but lacks miRNA-155. The electrophoretic pattern is consistent with channel a, indicating that extension initiated by a primer without the target RNA does not occur.

[0093] In the d channel, Di-PaH and miRNA-155 were incubated with Phi29 polymerase and dNTPs, and a new band appeared above the Di-PaH position. This band represents the Phi29 polymerase-mediated extension of miRNA-155 along the PaH template. Simultaneously, the original Di-PaH band significantly weakened, reflecting substantial template consumption during polymerization.

[0094] The e channel contains Di-PaH, Phi29 polymerase, Nt.BbvCI, and dNTPs, but also lacks miRNA-155. Its banding pattern remains unchanged relative to the a and c channels, confirming that it neither initiates extension nor triggers scratching in the absence of target initiation.

[0095] In the fully assembled reaction (channel f), all components, including miRNA-155, Phi29 polymerase, Nt.BbvCI endonuclease, and dNTPs, were present, resulting in multiple distinct DNA fragments. These included the extended product generated by miRNA-155-initiated polymerization on PaH, as well as shorter fragments resulting from the incorporation and release of the trigger strand mediated by Nt.BbvCI endonuclease, followed by palindromic dimerization (forming Di-trigger). Lane c shows the banding pattern after incubating the PP / miRNA-155 complex with T4 DNA ligase (at 16°C for 30 minutes). Since ligation has minimal impact on molecular weight, no significant changes in band position were observed.

[0096] Furthermore, based on Example 2, to provide further direct structural evidence that the triggered generation indeed originates from PaH-guided stretching and slicing, gel electrophoresis was performed under different reaction configurations. For example... Figure 8 As shown, the synthesis trigger (channel a) exhibits a distinct monomeric band and a small amount of dimer. When the trigger is incubated with phi29 DNA polymerase and dNTPs (channel b), most of the monomeric trigger is consumed, the remaining trigger dimer remains detectable, and a higher molecular weight product appears, indicating that the palindromic ends of the trigger can undergo polymerase-supported intermolecular polymerization. In contrast, when Di-PaH, miRNA-155, phi29 DNA polymerase, dNTPs, and Nt.BbvCI endonuclease are present simultaneously (channel c), a significant high molecular weight species is observed at the position corresponding to the Di trigger's elongation. These results confirm that under Di-PaH-guided elongation / cut-in conditions, the trigger is not only generated but also undergoes controlled dimerization, producing a structurally definable product capable of supporting tandem activation of two Cas12a molecules.

[0097] Example 3: Optimization of a detection system driven by dimer-palindromic hairpins (Di-PaH) with multiplex amplification coupled in tandem with dual Cas12a activation. Specifically, in order to improve the performance of the amplification system, this embodiment also analyzed the activity of phi29 DNA polymerase, the enzyme dosage of Nt.BbvCI endonuclease, and the multiplex amplification reaction time.

[0098] The experimental method was the same as in Example 1, and the concentrations of each component were as follows: [Di-PaH] = 5 μM; [miRNA-155] = 1 μM; [Cas12a] = 1 μM; [crRNA] = 1 μM; [Reporter] = 5 μM, [dNTPs] = 25 mM; The reactions were conducted with [phi29 DNA polymerase] and [Nt.BbvCI endonuclease] at concentrations of 1 U, 2 U, 3 U, 4 U, and 5 U, respectively. Fluorescence intensity was measured under different concentrations of phi29 DNA polymerase and Nt.BbvCI endonuclease at each reaction condition, with the presence of miRNA-155 as the final detection result. Fluorescence intensity was also measured using the absence of target miRNA-155 as a negative control.

[0099] See results Figure 9 A. When the concentrations of Phi29 DNA polymerase and Nt.BbvCI endonuclease were increased from 1 U to 5 U while keeping the reaction time constant, the fluorescence background without a template control remained essentially unchanged. In contrast, the fluorescence signal obtained in the presence of miRNA-155 gradually increased, reaching a maximum of 3 U, at which point the signal-to-noise ratio (SNR) was approximately 7.6. This is attributed to the higher enzyme load promoting more efficient trigger generation and accumulation, resulting in more dsDNA amplification products that can activate the Cas12a-crRNA dimer and enhance the transcleavage of the fluorescent reporter protein. Beyond 3 U, the signal growth tended to plateau, and the SNR remained stable, indicating that the Cas12a-crRNA recognition site was approaching saturation, and further increases in DSD triggering did not translate into improved reporter cleavage efficiency. Therefore, 3 U was determined to be the optimal concentration of Phi29 DNA polymerase and Nt.BbvCI endonuclease.

[0100] The optimal enzyme dosage was determined by [phi29 DNA polymerase] = [Nt.BbvCI endonuclease] = 3 U. Other conditions were: [Di-PaH] = 5 μM; [miRNA-155] = 1 μM; [Cas12a] = 1 μM; [crRNA] = 1 μM; [Reporter] = 5 μM; [dNTPs] = 25 mM. Signal changes before and after the addition of target miRNA-155 were monitored within 30 to 70 minutes to examine the effect of reaction time on the system's fluorescence response. Results are shown in [link to results]. Figure 9 Data in Figure B show that as the reaction time increased from 30 minutes to 70 minutes, the fluorescence intensity of the miRNA-155-containing sample continuously increased, reaching a maximum at 60 minutes, corresponding to a signal-to-noise ratio of approximately 7.6, while the NTC remained almost unchanged. This indicates that longer polymerization promotes the formation and accumulation of the trigger dimer, thereby activating more Cas12a complexes and enhancing fluorescence output. When the reaction time exceeded 60 minutes, both signal enhancement and signal-to-noise ratio reached saturation, indicating that Cas12a's binding and cleavage capabilities for cumulative trigger duplexing had reached their limit. Therefore, 60 minutes was selected as the optimal polymerization time for Di-Trigger formation.

[0101] Example 4: Sensitivity Evaluation of a Detection System Driven by Di-Palindrome Hairpin (Di-PaH)-Driven Multiplex Amplification Coupled with Tandem Dual Cas12a Activation This embodiment uses the integrated amplification system for detecting miRNA155 provided in Example 1 to determine the sensitivity. The specific steps include: The concentration of miRNA155 in Example 1 was adjusted from 0.0001 pM to 1000 pM, with concentrations of 0, 0.0001 pM, 0.001 pM, 0.01 pM, 0.1 pM, 1 pM, 10 pM, 100 pM, and 1000 pM. Other experimental conditions were: [Di-PaH] = 5 μM, [phi29 DNA polymerase] = [Nt.BbvCI endonuclease] = 3 U, [dNTPs] = 25 mM, [Cas12a] = 1 μM, [crRNA] = 1 μM, and [Reporter] = 5 μM. Error bars were obtained from three replicate tests.

[0102] Finally, the fluorescence intensity was measured.

[0103] See Figure 5 A represents the fluorescence spectrum of miRNA-155 concentrations from 0 to 1000 pM. As the miRNA-155 concentration increases from 0 to 1000 pM, higher miRNA-155 levels produce progressively enhanced fluorescence within the emission range, consistent with dose-dependent Cas12a double transfection.

[0104] Figure 5 B is a fluorescence intensity heatmap, which further visualizes the changes in fluorescence intensity at different target concentrations, showing that as miRNA-155 increases from low nanomolar levels to high femtomolar levels, it smoothly evolves from NTC-level background to high signal output. The peak fluorescence intensity at the emission maximum is plotted against the miRNA-155 concentration.

[0105] Figure 5C represents the peak fluorescence intensity, which increases with the target miRNA concentration from 0 to 1000 pM. Within the range of 0.0001 pM to 1000 pM, a strong linear correlation was observed between the peak fluorescence intensity at 520 nm and the logarithm of the miRNA-155 concentration.

[0106] Figure 5 D represents the calibration curve of 520 nm fluorescence intensity versus the logarithm of miRNA155 concentration. The calibration curve equation fitted to the data is F520 = 204.19 lgCmiRNA-155+1180, with correlation coefficient R. 2 = 0.9942.

[0107] Based on the method recommended by IUPAC and using the 3σ criterion (mean_NTC + 3SD), the detection limit is calculated to be 56 aM, revealing the ultra-high signal gain brought about by the Cas12a tandem activation that triggers dimerization.

[0108] Example 5: Specificity Evaluation of a Detection System Driven by Di-Palindrome Hairpin (Di-PaH)-Driven Multiplex Amplification Coupled with Tandem Dual Cas12a Activation The specificity of miRNA-155 was determined according to the method of detecting miRNA-155 by Di-PaH driven multiplex amplification coupled tandem dual Cas12a activation system in Example 1. The specific steps included comparing the reaction of miRNA-155 with the reaction of several non-target miRNAs, including miRNA19a, miRNA21, miRNA16, miRNA-141 and miRNA-145, the sequences of which are shown in SEQ. ID NO: 6-10, respectively.

[0109] The operating procedures were the same as in Example 1, and the experimental conditions included: [Di-PaH] = 5 μM, [miRNA-155] = 100 nM, [miRNA-19a] = [miRNA-21] = [miRNA-16] = [miRNA-141] = [miRNA-145] = 1 μM, [phi29 DNA polymerase] = [Nt.BbvCI] = 3 U, [dNTPs] = 25 mM, [Cas12a] = 1 μM, [crRNA] = 1 μM, [Reporter] = 5 μM. Error bars were obtained from three replicate tests.

[0110] See results Figure 6 A and Figure 6Figure B shows a comparison of fluorescence intensity and a heatmap of miRNA155 (100 nM) and non-target miRNAs (1 μM), respectively. The five non-target members (miRNA-19a, miRNA-21, miRNA-141, miRNA-145, and miRNA-16; each 1 μM) only produced background-level signals, while wild-type miRNA-155 showed a significant response at 100 nM (>2000 a.u.), demonstrating strong differentiation at the family level.

[0111] Furthermore, this embodiment also includes an evaluation experiment to assess the ability to distinguish between single and multiple base mutations.

[0112] join Figure 6 C. The ability to distinguish single and multiple base mutations from perfectly matched miRNA-155 targets. Variants with one base mutation (MT-1a and MT-1b, sequences as shown in SEQ. ID NO: 11 and SEQ. ID NO: 12), two base mutations (MT-2, sequence as shown in SEQ. ID NO: 13), three base mutations (MT-3, sequence as shown in SEQ. ID NO: 14), and four base mutations (MT-4, sequence as shown in SEQ. ID NO: 15) were analyzed. Single base substitution (MT-1a / MT-1b; 100 nM) significantly reduced signal intensity compared to wild type, while two- and three-base variants (MT-2 / MT-3) further suppressed reads, and the four-base variant (MT-4) showed near-template-free background. This monotonous, mismatch-dependent signal attenuation reflects impaired Di-PaH target extension, incomplete formation of Nt.BbvCI cleavage sites, reduced trigger generation, and insufficient dimer trigger accumulation to achieve dual Cas12a activation.

[0113] See results Figure 6 A. The heatmap shows that the wild-type channel occupies the high-intensity region, while the increased mutation load causes the signal to gradually shift towards the low-intensity region closer to the NTC. In summary, these results demonstrate that the Di-PaH-triggered tandem dual Cas12a platform exhibits strict selectivity for wild-type miRNA-155, enabling family-level discrimination and precise mismatch load resolution at single-base resolution.

[0114] The results show that the integrated amplification system of this application not only achieves ultrasensitive detection of miRNA-155, but also has excellent specificity, and can accurately distinguish closely related miRNA sequences.

[0115] Example 6: Evaluation of a detection system driven by dimer-palindromic hairpins (Di-PaH) with tandem dual Cas12a activation in actual samples. The multiplex amplification-coupled tandem dual Cas12a activation system for detecting miRNA-155, as provided in Example 1, was used to test actual samples. Whole blood samples were collected from 10 healthy donors and 10 clinically diagnosed breast cancer patients. A detailed schematic diagram of the detection process can be found in [reference needed]. Figure 7 A.

[0116] The specific steps are the same as in Example 1. Experimental conditions: Total miRNA was extracted using a commercial serum / whole blood miRNA purification kit, and the elution buffer was diluted tenfold with DEPC-treated water before analysis.

[0117] Other component concentrations: [Di-PaH] = 5 μM, [phi29 DNA polymerase] = [Nt.BbvCI] = 3 U, [dNTP] = 25 mM, [Cas12a] = 1 μM, [crRNA] = 1 μM, [ssDNA reporter gene] = 5 μM. Error bars were obtained from three replicate tests.

[0118] like Figure 7 As shown in Figure B, the fluorescence intensity of samples from breast cancer patients was significantly higher than that from healthy individuals. P The expression level (<0.0001) indicates that miRNA-155 expression was significantly higher in breast cancer patients than in the normal control group. This observation is consistent with previous reports of significant upregulation of miRNA-155 in breast cancer patients, supporting its role as a biomarker for breast cancer in the existing literature.

[0119] The results above demonstrate that these findings indicate that single-probe amplification structures have good practical application value and can distinguish disease-related miRNA-155 elevations in real biological samples.

[0120] The above are merely preferred embodiments of the present invention and do not limit the scope of protection of the present invention. For those skilled in the art, the present invention can have various modifications and variations. Any changes, modifications, substitutions, integrations, and parameter alterations to these embodiments within the spirit and principles of the present invention, achieved through conventional substitutions or by achieving the same function without departing from the principles and spirit of the present invention, fall within the scope of protection of the present invention.

Claims

1. A hairpin probe capable of forming a dimer palindromic sequence, characterized in that, It includes: The palindromic sequence region, located at the 5' end, allows the hairpin probe monomers to dimerize and form a dimer palindromic hairpin probe through complementary base pairing in this palindromic sequence region. The crRNA recognition region is used for complementary base pairing with crRNA in the CRISPR / Cas system; The endonuclease recognizes a half-site, which can be specifically cleaved by the endonuclease when forming a double-stranded structure; The stem region is formed by spontaneous base pairing of two complementary single-stranded regions; Target recognition area; and Alternatively, PAM motifs; The hairpin probe comprises, from the 5' end to the 3' end, a palindromic sequence region, a PAM motif, a crRNA recognition region, a nuclease recognition half-site, a single-stranded region of the stem region, a target recognition region, and another single-stranded region of the stem region. After the single-stranded region of the stem region and the other single-stranded region are complementary, the target recognition region is on the loop of the hairpin probe, and the 3' end of the hairpin probe is capped by an inverted dT.

2. The hairpin probe according to claim 1, characterized in that, The length of the palindromic sequence region is 8 nt or more, preferably 10 nt; And / or, the length of the crRNA recognition region is 16-24 nt, preferably 20 nt; And / or, the length of the stem region is 10-16 bp, preferably 10 bp, and preferably, one of the single strands of the stem region is located at the other end opposite to the palindromic sequence region; And / or, the length of the target recognition region is 19-23 nt, preferably 20 nt.

3. The hairpin probe according to claim 1, characterized in that, The target recognition region binds to miRNAs selected from the following: miRNA-155, miRNA-21, miRNA-1290, miRNA-19a, miRNA-16, miRNA-141, miRNA-145, or miRNAs with up to two base mutations compared to the aforementioned miRNAs, preferably, miRNA-155.

4. The hairpin probe according to claim 3, characterized in that, The sequence of the palindromic sequence region is shown in SEQ ID NO:16; And / or, the sequence of the crRNA recognition region is shown in SEQ ID NO: 18; And / or, the sequence of the endonuclease recognition half-site is shown in SEQ ID NO: 19; And / or, the stem region is formed by complementary base pairing of the sequences shown in SEQ ID NO: 21 and SEQ ID NO: 22; And / or, the sequence of the PAM motif is shown in SEQ ID NO: 17; And / or, the target recognition region binds to miRNA-155 and has at most two base mutations compared to the sequence shown in SEQ ID NO: 18, preferably, the sequence of the target recognition region is as shown in SEQ ID NO:

18.

5. The application of the hairpin probe according to claim 1 in detecting miRNA, preferably, the miRNA has at most two base mutations compared with the sequence shown in SEQ ID NO:

2.

6. Use of the hairpin probe according to claim 1 in the preparation of a kit for detecting breast cancer patients, wherein the level of miRNA-155 in the blood of the breast cancer patients is significantly higher than that in healthy individuals, and the miRNA-155 has at most two base mutations compared with the sequence shown in SEQ ID NO:

2.

7. A method for detecting miRNA, characterized in that, The method comprises: mixing the hairpin probe according to any one of claims 1-4 with a solution of DNA polymerase, endonuclease, dNTP, CRISPR / Cas reaction system and reporter gene probe, and a sample suspected of containing the miRNA to be tested, and detecting the fluorescence intensity of the mixture. When the fluorescence intensity of the mixture is higher than the background level, it indicates that the sample contains the miRNA to be tested. Preferably, the miRNA has at most two base mutations compared with the sequence shown in SEQ ID NO:

2.

8. The method according to claim 7, characterized in that, The DNA polymerase is selected from phi29 DNA polymerase or Klenow polymerase; And / or, the endonuclease is Nt.BbvCI endonuclease; And / or, the CRISPR / Cas reaction system contains Cas nuclease and crRNA, wherein the Cas nuclease is Cas12a, and the sequence of the crRNA is as shown in SEQ ID NO: 4; And / or, the sequence of the reporter gene probe is shown in SEQ ID NO: 5; And / or, the sample suspected of containing the miRNA to be tested is selected from whole blood, serum, plasma, or tissue homogenate.

9. The method according to claim 7, characterized in that, In the mixture, the concentration of the hairpin probe is 5 μM; And / or, the amount of DNA polymerase and endonuclease used is 1 U or more, preferably 3 U or more; And / or, the mixture is incubated for at least 30 minutes, preferably at least 60 minutes.

10. A kit for detecting miRNA-155, characterized in that, The kit contains the hairpin probe according to claim 1.