RAA and CRISPR / Cas12a single-tube integrated detection device and detection method thereof

Abstract

The invention discloses an RAA and CRISPR / Cas12a single-tube integrated detection device, a detection method and application, and belongs to the technical field of biological detection. The device comprises an upper-layer RAA nucleic acid isothermal amplification system, a lower-layer Cas12a endonuclease detection system and middle semisolid gel, and an amplification product can be diffused to the detection system through the gel. An RAA system is adopted for amplification, and reaction is carried out for 20-40 minutes at 37-42 DEG C; the detection system guides Cas12a to cut target DNA through crRNA and activates a fluorescence signal. The detection method does not need to uncover and transfer products, can be completed at the constant temperature of 39 DEG C for 40 minutes, and can specifically detect livestock and poultry derived components such as chicken, duck, pig, cattle and sheep. The method provided by the invention solves the problems of easy pollution, tedious operation and high equipment dependence of traditional detection, has high sensitivity and specificity, can be used for authenticity identification of food such as duck blood products, and is suitable for on-site rapid detection and market supervision.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, specifically to a single-tube integrated detection device and its detection method based on the RAA and CRISPR / Cas12a system. Background Technology

[0002] In recent years, the authenticity and safety of animal-derived foods have attracted widespread global attention. Duck blood and its products, as an important part of traditional Chinese cuisine, are highly valued by consumers for their nutritional value and flavor. However, the market frequently sees the adulteration of duck blood with cheaper animal blood (such as chicken, pig, beef, and sheep blood), which not only harms consumers' rights but also poses potential food safety hazards and disrupts market order. While existing testing technologies can identify animal-derived components to some extent, they still face many challenges and limitations, especially in rapid screening and on-site testing.

[0003] Traditional detection methods, such as PCR-based species identification techniques, while highly accurate, are complex, requiring multiple steps including DNA extraction, PCR amplification, and electrophoretic separation, taking 4 to 6 hours, and relying on specialized thermal cyclers and other laboratory equipment. This makes them unsuitable for rapid testing or on-site applications. The cumbersome operation and equipment dependence of PCR technology limit its practicality and widespread adoption, especially in regulatory and quality control fields requiring immediate feedback. Another common detection strategy is enzyme-linked immunosorbent assay (ELISA) and immunochromatography (LFIA), which rely on the specific binding of antigens and antibodies for rapid screening. However, these methods have limitations in identifying animal-derived foods; their specificity and sensitivity are often lower than nucleic acid-based detection techniques, especially when handling food samples containing complex protein matrices or other additives, potentially leading to false positives or false negatives.

[0004] Basic metabolite detection techniques, such as chromatography-mass spectrometry (GC-MS) and untargeted metabolomics, identify species by analyzing differences in specific small-molecule metabolites. While offering unique detection perspectives in certain situations, these techniques have low sensitivity for detecting trace adulterants and limited application in complex food matrices. Among emerging molecular detection technologies, isothermal amplification techniques (such as RAA, LAMP, and RPA) have attracted considerable attention due to their ease of operation, speed, and low equipment requirements. However, when combined with CRISPR / Cas systems (especially CRISPR / Cas12a), the traditional two-step method (isothermal amplification followed by CRISPR detection) reveals significant drawbacks in practical applications. The main problem is that the isothermal amplification product needs to be transferred to the CRISPR detection system after opening the cap, a process highly susceptible to aerosol contamination, increasing the risk of false positives. Furthermore, the two-step method is cumbersome and unsuitable for on-site testing and large-scale screening.

[0005] While some studies have attempted to prevent amplification product transfer through physical separation (such as dual-tube systems or inner / outer tube designs) or phase separation (such as sucrose phase separation), these methods increase operational complexity (requiring additional centrifugation or inversion operations) and are not ideal for detecting certain complex samples (such as those containing high concentrations of inhibitors). Furthermore, even with the introduction of microfluidics, although it has improved detection efficiency and portability, the equipment requirements remain high, limiting its application in resource-scarce regions.

[0006] In summary, existing technologies for detecting the authenticity and safety of animal-derived foods such as duck blood products suffer from problems such as cumbersome procedures, poor testing timeliness, high equipment dependence, and susceptibility to aerosol contamination. Therefore, there is an urgent need for a single-tube integrated technology that can overcome these shortcomings and achieve rapid, simple, highly sensitive, and highly specific detection to meet the needs of on-site testing and large-scale regulatory oversight. Summary of the Invention

[0007] The core technical problem to be solved by this invention is to overcome the shortcomings of existing animal-derived component detection technologies, such as complex operation, insufficient sensitivity and specificity, and susceptibility to aerosol contamination, and to provide a rapid, simple, highly sensitive and highly specific single-tube integrated detection technology.

[0008] This invention addresses the aforementioned problems by constructing a single-tube integrated detection system based on RAA and CRISPR / Cas12a. First, based on the interspecific diversity and intraspecific conservation of the mitochondrial genome, universal RAA primers are designed and screened to construct a CRISPR / Cas12a detection system. Then, a semi-solid gel is used to integrate RAA amplification and CRISPR / Cas12a detection into a single reaction tube, achieving a sequential reaction of "amplification first, detection later."

[0009] The first aspect of the present invention provides a single-tube integrated detection device based on the RAA and CRISPR / Cas12a system.

[0010] Furthermore, the single-tube integrated detection device includes an upper nucleic acid isothermal amplification reaction system, a lower nucleic acid endonuclease detection system, and a semi-solid gel located between the two layers.

[0011] Furthermore, the nucleic acid isothermal amplification reaction system amplifies the nucleic acid in the sample under isothermal conditions, and the amplification products can diffuse through the semi-solid gel to the lower endonuclease detection system.

[0012] Furthermore, the semi-solid gel is selected from at least one of blue ribbon agarose, alginate, and polyacrylamide gel, with a concentration of 0.1%-1%, preferably 0.5%.

[0013] Furthermore, the nucleic acid isothermal amplification reaction system includes RAA reaction buffer, specific primer pairs, and nucleic acid template.

[0014] Furthermore, the specific primer pair is used to identify and amplify the conserved region of the mitochondrial 12S rRNA gene in livestock and poultry-derived components; the sources of the livestock and poultry-derived components include, but are not limited to, chickens, ducks, pigs, cattle, and sheep.

[0015] Furthermore, the specific primer pair is primer pair 1 and / or primer pair 2.

[0016] The sequence of the upstream primer F1 of primer pair 1 is SEQ ID No. 1: 5′-GCACGTACATACCGCCCGTCACCCTCTTCA-3′; The sequence of the downstream primer R1 of primer pair 1 is SEQ ID No. 2: 5′-CACTTTCCAGTATGCTTACCTTGTTACGACTT-3′.

[0017] The sequence of the upstream primer F2 of primer pair 2 is SEQ ID No. 3: 5′-GGGATTAGATACCCCACTATGCCTAGCCCTAA-3′; The sequence of the downstream primer R2 of primer pair 2 is SEQ ID No. 4: 5′-TGAGGAGGGTGACGGGCGGTATGTGCGTGC-3′.

[0018] Preferably, the specific primer pair is primer pair 2.

[0019] Furthermore, the nucleic acid template is selected from the genomic DNA of livestock and poultry-derived components, the sources of which include, but are not limited to, chickens, ducks, pigs, cattle, and sheep.

[0020] Furthermore, the endonuclease detection system comprises an endonuclease, a specific recognition sequence, and a fluorescent reporter group.

[0021] Furthermore, the endonuclease recognizes and cuts target DNA under the guidance of a specific recognition sequence, activates trans-cutting activity, and cuts the fluorescent reporter group to generate a detectable fluorescent signal for the detection of livestock and poultry-derived components.

[0022] Furthermore, the endonuclease is selected from the Cas12a family of proteins, including but not limited to LbCas12a, AsCas12a, and SaCas12a.

[0023] Furthermore, the specific recognition sequence includes crRNA, which is designed to recognize the 5'-TTTN-3' type PAM site downstream of the mitochondrial 12S rRNA gene in livestock and poultry-derived components, with a length ranging from 30 to 60 nucleotides.

[0024] Furthermore, the sources of the livestock and poultry-derived components include, but are not limited to, chickens, ducks, pigs, cattle, and sheep, and the sequence of the crRNA is: The chicken crRNA sequence is shown in SEQ ID No. 5: 5′-AAUUUCUACUAAGUGUAGAUGCAGUAAAGUGAGAUCAUACC-3′; The duck crRNA sequence is shown in SEQ ID No. 6: 5′-AAUUUCUACUAAGUGUAGAUGCAGUAAAGCGGGACAAUAAA-3′; The porcine crRNA sequence is shown in SEQ ID No. 7: 5′-AAUUUCUACUAAGUGUAGAUUUUCCACCCAUAAGCUACAC-3′; The bovine crRNA sequence is shown in SEQ ID No. 8: 5′-AAUUUCUACUAAGUGUAGAUGUUAUUGGUUUCAUAAAUACU-3′; The sheep crRNA sequence is shown in SEQ ID No. 9: 5′-AAUUUCUACUAAGUGUAGAUUGUGUUAUUAUUGAGCUUACU-3′.

[0025] Furthermore, the fluorescent reporter group is composed of a fluorescent group and a quencher group, including but not limited to 6-FAM, VIC, ROX, HEX and Cy5, and is used to achieve visual detection of target nucleic acids through changes in fluorescence signal.

[0026] A second aspect of the present invention provides a detection method for component detection using the above-described single-tube integrated detection device based on RAA and CRISPR / Cas12a system.

[0027] Furthermore, the method includes the following steps: (1) Perform isothermal amplification of nucleic acids in a single reaction tube using universal primers designed for conserved regions of the mitochondrial genome; (2) After isothermal amplification, without changing the conditions in the reaction tube, endonuclease detection is performed in the same tube. A specific concentration of semi-solid gel is used as both the component isolation medium and the reaction medium, allowing the amplification product to diffuse from the upper layer to the lower layer of the gel. (3) The entire detection process is carried out under constant temperature conditions and the reaction time is set to complete the detection process.

[0028] Further, in step (1), the isothermal amplification adopts the RAA (Recombinase Aided Amplification) system, and the design of the universal primers is based on the conserved regions of mitochondrial 12S rRNA, 16S rRNA and / or COI genes; the nucleic acid isothermal amplification adopts the RAA system, the reaction temperature is 37-42℃, and the reaction time is 20-40 minutes; Preferably, the nucleic acid isothermal amplification uses the RAA system, with a reaction temperature of 39°C and a reaction time of 30 minutes; Further, in step (2), the semi-solid gel is selected from at least one of blue ribbon agarose, alginate and polyacrylamide gel, and has a concentration of 0.1%-1%, preferably 0.5%.

[0029] Furthermore, the reaction conditions of the nucleic acid endonuclease detection system are as follows: Cas12a protein concentration 200-800 nM, crRNA concentration 0.5-2 μM, ssDNA-Reporter concentration 400-1200 nM, reaction temperature 37-42℃, and reaction time 20-40 minutes.

[0030] Preferably, in the endonuclease detection system, the concentration of Cas12a is 500 nM, the concentration of crRNA is 1 µM, the concentration of ssDNA-Reporter is 800 nM, the reaction temperature is 37 °C, and the reaction time is 30 minutes.

[0031] Preferably, the concentration ratio of Cas12a to crRNA is 1:1 or 1:2; In some embodiments, the concentration ratio of Cas12a to crRNA is 1:1; In some embodiments, the concentration ratio of Cas12a to crRNA is 1:2; Preferably, the concentration ratio of Cas12a to crRNA is 1:2; Furthermore, the Cas12a includes, but is not limited to, AsCas12a, LbCas12a, FnCas12a, MbCas12a, BhCas12a, and BsCas12a; Furthermore, the ssDNA-Reporter is 5′-6-FAM-TTATTATT-BHQⅠ-3′; Furthermore, the source of the crRNA is chicken (Gallus gallus), duck (Anas platyrhynchos), pig (Sus scrofa), cow (Bos taurus) and / or sheep (Ovis aries). In some embodiments, the crRNA is chicken crRNA, with the sequence shown in SEQ ID No. 5; In some embodiments, the crRNA is duck crRNA, with the sequence shown in SEQ ID No. 6; In some embodiments, the crRNA is porcine crRNA, with the sequence shown in SEQ ID No. 7; In some embodiments, the crRNA is bovine crRNA, with the sequence shown in SEQ ID No. 8; In some embodiments, the crRNA is sheep crRNA, with the sequence shown in SEQ ID No. 9; Furthermore, in step (3), the constant temperature is 39°C and the set time is 40 minutes.

[0032] A third aspect of the present invention provides the application of the above-described detection device or the above-described detection method in the identification of the authenticity of food.

[0033] Furthermore, the application includes the rapid detection of poultry-derived components in duck blood products, the sources of which include, but are not limited to, chicken, duck, pig, cattle, and sheep.

[0034] Furthermore, in the method for detecting simulated adulterated samples, the DNA sources of the five species include cell extracts, tissue extracts, and blood extracts.

[0035] Furthermore, the concentration range of the dopant species DNA is 1×10⁻⁶.0 -1×10 6 Copies / μL are used to test the detection limit and sensitivity.

[0036] Furthermore, the detection method is applicable to multiple fields such as the food industry, biological product testing, and disease diagnosis, and can simultaneously detect the source components of five species: chicken, duck, pig, cattle, and sheep.

[0037] The present invention has the following beneficial effects: (1) Based on the two-step method system of "RAA amplification + CRISPR / Cas12a detection", this invention constructs a single-tube integrated RAA-CRISPR / Cas12a system with 0.5% agarose as the reaction medium. This system utilizes the molecular sieving effect of agarose gel to effectively block the upward migration of large Cas12a protein molecules, while allowing small molecule RAA amplification products to diffuse downward, realizing a sequential reaction of "amplification first, detection later". This single-tube system can complete the entire detection process within 40 minutes under a constant temperature of 39℃, without the need to open the cap to transfer the amplification products, effectively avoiding the risk of aerosol contamination.

[0038] (2) Performance verification results show that the single-tube integrated detection device and method provided by the present invention have strict specificity for livestock and poultry-derived components (mainly from chickens, ducks, pigs, cattle and sheep) and no cross-reactivity; the minimum detection sensitivity is 1×10⁻⁶. 0 -1×10 6 The detection limit was 1% (copies / μL). In simulated adulteration experiments, even with only 1% chicken, pig, bovine, or sheep-derived components added to the duck blood background, specific fluorescent signals could still be stably detected, and the detection limit met the actual adulteration screening requirements. Testing of 20 commercially available duck blood products from different e-commerce platforms, supermarkets, farmers' markets, and restaurants showed that 18 samples tested positive for duck-derived components only, 2 samples tested positive for both chicken and duck-derived components, and 1 sample tested positive for both duck and pig-derived components. This result was completely consistent with the results of the five-fold PCR test, confirming the high accuracy and reliability of the single-tube integrated detection device in actual sample testing.

[0039] (3) The RAA-CRISPR / Cas12a single-tube integrated detection technology successfully established by this invention has high specificity, high sensitivity and convenient operation. It can identify five common livestock and poultry-derived components (from chicken, duck, pig, cattle and sheep) in duck blood products within 40 minutes. It effectively solves the contamination problem and equipment dependence problem of the traditional two-step method. It can meet the needs of rapid detection and market supervision. It not only provides reliable technical support for the authenticity identification of duck blood products, but also opens up a new path for the rapid detection of other animal-derived foods. Attached Figure Description

[0040] Figure 1 The results are verified by PCR electrophoresis using RAA universal primers, where M is DNA Maker; lanes 1-5 are blood DNA samples from chicken, duck, pig, cow, and sheep, respectively; NC is the negative control. Figure 2 A represents the design location of crRNA for each species. Figure 2 B is the CRISPR-Cas12a fluorescence detection experiment, which determines the targeting and cleavage activity of different crRNAs by observing the intensity of green fluorescence in the reaction tube; Figure 3 To verify the CRISPR / Cas12a trans-cleavage activity using fluorescence signal intensity, the following groups were selected: Group 1 included Cas12a, crRNA, RAA amplification product, and ssDNA-Reporter; Group 2 lacked Cas12a; Group 3 lacked crRNA; Group 4 lacked RAA amplification product; Group 5 lacked ssDNA-Reporter; and Group 6 contained only ssDNA-Reporter. Figure 4 The optimal Cas12a and crRNA concentration ratio for the CRISPR / Cas12a system was determined. Figure 5 The results represent the specificity validation of the two-step RAA-CRISPR / Cas12a detection technology. AE represents the RAA-CRISPR / Cas12a reaction systems for chicken, duck, pig, cow, and sheep, respectively; NC is the negative control; and 1-5 represent the RAA amplification products for chicken, duck, pig, cow, and sheep, respectively. Figure 6 The results show the sensitivity validation of the RAA-CRISPR / Cas12a two-step detection technology. The AE tube contains RAA-CRISPR / Cas12a reaction systems for chickens, ducks, pigs, cattle, and sheep, respectively; NC is the negative control; from left to right, the samples are 10... 6 10 5 10 4 10 3 10 2 10 1 10 0 copies / µL; Figure 7 The results show the detection limit validation of the RAA-CRISPR / Cas12a two-step detection technology, where AD represents duck adulterated with chicken, duck adulterated with pork, duck adulterated with beef, and duck adulterated with sheep, respectively; NC represents the negative control; and the doping ratios from left to right are 70% / 30%, 90% / 10%, 95% / 5%, and 99% / 1%, respectively. Figure 8 This is a schematic diagram of an integrated single-tube agarose tube. Figure 9The results of optimizing the concentration of agarose gel in a single tube of RAA-CRISPR / Cas12a are shown. Group 1 has an agarose gel concentration of 0.25%; Group 2 has an agarose gel concentration of 0.50%; Group 3 has an agarose gel concentration of 0.75%; Group 4 has an agarose gel concentration of 1.0%; Group 5 has no gel; and Group 6 is a blank control. Figure 10 The results of the RAA-CRISPR / Cas12a single-tube integrated reaction time optimization; Figure 11 This is the specificity validation result for the RAA-CRISPR / Cas12a single-tube integrated detection technology. The AE tube contains chicken, duck, pig, cow, and sheep crRNA, respectively; NC: negative control; 1-5 are chicken, duck, pig, cow, and sheep DNA, respectively. Figure 12 The results show the sensitivity validation of the RAA-CRISPR / Cas12a single-tube integrated detection technology. The AE tube contains chicken, duck, pig, bovine, and sheep crRNA, respectively; NC is the negative control; from left to right, they represent 10... 6 10 5 10 4 10 3 10 2 10 1 10 0 copies / uL; Figure 13 The results represent the detection limit validation of the RAA-CRISPR / Cas12a single-tube integrated detection technology, where AD represents duck adulterated with chicken, duck adulterated with pig, duck adulterated with cow, and duck adulterated with sheep, respectively; NC represents the negative control; and the doping ratios from left to right are 70% / 30%, 90% / 10%, 95% / 5%, and 99% / 1%, respectively. Figure 14 This is for the clinical application of RAA-CRISPR / Cas12a single-tube integrated detection technology, where ae represents the single-tube integrated specific detection system for chicken, duck, pig, cattle, and sheep, respectively; f: negative control; 1-20 represent DNA from different duck blood samples. Figure 15 The results are from a five-fold PCR validation, where M represents DNA Maker; 1-20 represent DNA from different duck blood samples; and NC represents the negative control. Detailed Implementation

[0041] 1. Source of experimental samples The test samples were obtained from e-commerce platforms, chain supermarkets, farmers' markets, and restaurants in Hefei. The *E. coli* strains used to prepare DH5α competent cells were all preserved in Laboratory A629 of the Biotechnology Building at Anhui Agricultural University.

[0042] 2. Main Reagents Table 1 Main Reagents

[0043] Example 1 This embodiment provides a single-tube integrated detection device based on RAA and the CRISPR / Cas12a system, aiming to address the challenges faced in the detection of adulteration in duck blood products in existing technologies. Traditional methods for detecting adulteration in duck blood products, such as PCR technology, are complex, time-consuming, and dependent on specialized equipment, making them difficult to meet the needs of rapid screening. Even the two-step method based on recombinase-mediated isothermal nucleic acid amplification (RAA) combined with the CRISPR / Cas12a system carries the risk of aerosol contamination due to the transfer of amplified products after opening the cap, increasing the false positive rate and operational difficulty, thus limiting its application in rapid on-site detection.

[0044] To address this issue, this embodiment proposes a single-tube integrated detection device based on the RAA and CRISPR / Cas12a systems. This device integrates the upper nucleic acid isothermal amplification reaction system, the lower nuclease detection system, and the semi-solid gel located between the two layers into a single reaction tube. The nucleic acid isothermal amplification reaction system amplifies the nucleic acids in the sample under isothermal conditions. The amplification products can diffuse through the semi-solid gel to the lower nuclease detection system, thereby achieving seamless integration of nucleic acid amplification and detection. This effectively avoids the risk of aerosol contamination caused by opening the tube, simplifies the detection process, and improves the reliability and convenience of rapid on-site detection.

[0045] Furthermore, the nucleic acid isothermal amplification reaction system amplifies nucleic acids in a sample under isothermal conditions. This means that the amplification process does not require complex temperature cycling; simply placing the reaction tube in a constant-temperature environment is sufficient to initiate and maintain amplification. For example, this can be achieved by placing the reaction tube in a constant-temperature water bath, a constant-temperature metal bath, or a portable heating device with a constant-temperature function. The recombinase, strand displacement polymerase, and primers in the amplification system work synergistically to efficiently replicate the target nucleic acid sequence at a constant temperature, producing a large amount of amplification products.

[0046] Thus, the amplification products can diffuse through the semi-solid gel to the lower nuclease detection system. After the upper amplification reaction proceeds and generates the target nucleic acid amplification products, these products diffuse through the intermediate semi-solid gel layer. The semi-solid nature of the gel allows small molecules (such as amplification products) to move slowly and stably within it, while effectively preventing macroscopic mixing of the upper and lower liquid layers. Once the amplification products diffuse to the lower detection system, they can bind to the nucleases and recognition sequences therein, triggering the detection reaction. The semi-solid gel is selected from at least one of blue ribbon agarose, alginate, and polyacrylamide gel, with a concentration of 0.1%-1%, preferably 0.5%.

[0047] This embodiment integrates nucleic acid amplification and detection into a single reaction tube through a single-tube integrated design, effectively avoiding the risk of aerosol contamination caused by opening the tube to transfer amplified products in traditional methods, and significantly reducing the false positive rate and operational difficulty. The device operates under constant temperature conditions, requiring no complex equipment, greatly simplifying the operation process for detecting adulteration in duck blood products. It achieves rapid, convenient, and highly reliable on-site detection, providing an efficient solution for food authenticity identification.

[0048] Example 2 This study designed, screened, and validated universal primers for the isothermal nucleic acid amplification (RAA) system, and the reaction conditions and procedures are as follows: 1. RAA universal primer screening To cover the detection needs of common livestock and poultry-derived components, this embodiment selected five typical target species: chicken (Gallus gallus), duck (Anasplatyrhynchos), pig (Sus scrofa), cattle (Bos taurus), and sheep (Ovis aries). The mitochondrial whole genome sequences of each species were retrieved from the GenBank database (https: / / www.ncbi.nlm.nih.gov / genbank / ), and the corresponding mtDNA whole genome reference sequences for each species are shown in Table 2.

[0049] Table 2 Primer design information for each species

[0050] Multidimensional bioinformatics analysis tools were used to systematically align the whole mtDNA genome sequences of five species and screen for highly conserved regions that met the requirements. The specific steps are as follows: Open MEGA11 and import the FASTA format of the whole mtDNA genome sequences of the five species for DNA sequence alignment; import the processed MEGA format sequence files into ClustalW2.0 and repeat the alignment three times to ensure that there are no obvious alignment errors.

[0051] During the design process, the following core conditions must be strictly followed to ensure that the primers are suitable for subsequent experimental requirements: (1) Primer length 30-35nt, GC content 40%-60%, amplicon length ≤500bp; (2) It possesses universality among five species: cattle, sheep, pigs, chickens, and ducks, and the amplification efficiency should not differ significantly; (3) It contains the PAM site recognized by the LbaCas12a protein, and 5'-TTTN-3' (N is any base) provides a target for the design of subsequent species-specific crRNAs.

[0052] The highly conserved mtDNA region sequences obtained from screening were imported into Premier 6.0, and primer design parameters were set as follows: primer length 30-35 nt, GC content 40%-60%, Tm value 60-65℃, avoiding primer self-dimerization and inter-primer dimerization. After generating the initial primer combination, the secondary structure and binding specificity of each primer were evaluated, and candidate primers were screened. The dissolution temperature, GC content, and base distribution of the candidate primers were further calculated using an Oligo analyzer (Sangon Biotech (Shanghai) Co., Ltd.), and finally two pairs of universal primers that met the requirements were determined. The primer sequence information is shown in Table 3. The designed primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. After appropriate centrifugation of the obtained dry powder primers, an appropriate amount of ddH2O was added for preparation, and the prepared primers were stored in a -20°C refrigerator for long-term storage.

[0053] Table 3 RAA universal primer sequences

[0054] 2. Validation of RAA universal primers and optimization of reaction conditions ①RAA universal primer verification Take an appropriate amount of sample, first use clean absorbent paper to dry its surface moisture, and then transfer it into a tissue homogenizer for homogenization. Then place the homogenized sample into an 80℃ constant temperature drying oven and continue drying for 6 hours to ensure that the moisture is completely removed.

[0055] Follow the instructions step-by-step using the Universal Genomic DNA Kit for blood / cell / tissue extraction. Turn on the water bath; add anhydrous ethanol to the buffer and wash buffer respectively, shake to mix, label the vials, and set aside for later use.

[0056] (1) Weigh 50 mg of the treated sample and use a homogenizer to treat the sample. Before homogenization, add 80 μL of Buffer GTL to the sample and after homogenization, add 100 μL of Buffer GTL.

[0057] (2) Add 20 μL Proteinase K and vortex to thoroughly mix the sample. Incubate in a 56°C water bath until the tissue is completely lysed. During incubation, the centrifuge tube can be inverted or shaken periodically to disperse the sample.

[0058] (3) Add 200 μL Buffer GL, vortex to mix thoroughly, and incubate in a 70°C water bath for 10 minutes. After a short centrifugation, add 200 μL of anhydrous ethanol and vortex to mix thoroughly.

[0059] (4) After a brief centrifugation, add all the solution obtained in step (3) into the adsorption column (SpinColumns DM) that has been loaded into the collection tube. If the solution cannot be added all at once, it can be added in multiple batches. Centrifuge at 12,000 rpm for 1 minute, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0060] (5) Add 500 μL of Buffer GW1 to the adsorption column, centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0061] (6) Add 500 μL of Buffer GW2 to the adsorption column, centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0062] (7) Repeat step (6).

[0063] (8) Centrifuge at 12000 rpm for 2 minutes and discard the waste liquid in the collection tube. Place the adsorption column at room temperature for several minutes to allow it to dry completely.

[0064] (9) Place the adsorption column in a new centrifuge tube, add 50-200 μL of Buffer GE or sterile water to the middle of the adsorption column, let it stand at room temperature for 2-5 minutes, centrifuge at 12,000 rpm for 1 minute, collect the DNA solution, and store the DNA at -20℃.

[0065] After dilution, the DNA sample dissolved in Buffer GE was used as a blank control. The concentration and purity of the extracted DNA were measured using a Nano Drop 2000 spectrophotometer. The light absorption at wavelengths of 260 nm and 280 nm was examined, and the purity of the DNA was estimated based on the OD260 nm / OD280 nm ratio.

[0066] Subsequently, using blood DNA from five species as templates, and employing two pairs of universal RAA primers (F1+R1, F2+R2) synthesized in this invention, with ddH2O as a negative control, a PCR reaction system was set up. PCR reactions were performed by varying the annealing temperature (60 ℃, 65 ℃) and the number of reaction cycles (30 cycles). The PCR reaction system and PCR reaction procedure are shown in Tables 4 and 5.

[0067] Table 4 PCR reaction system

[0068] Table 5 PCR reaction procedure

[0069] After the reaction, equal amounts of PCR products were subjected to 1.5% agarose gel electrophoresis. The bands (brightness, clarity, presence of impurities, primer dimers) were observed using a gel imaging system to determine the effectiveness and specificity of primer amplification and to screen for the optimal primers.

[0070] ② RAA isothermal amplification temperature optimization After systematically referring to the instructions of the Hangzhou Crowdtesting RAA Nucleic Acid Kit, the reaction system was appropriately modified and improved according to the actual needs of the experiment. The specific operation steps are as follows: Using the target genes of five species as templates, the optimal RAA universal primer combination (F2+R2) was used to construct RAA reaction systems for four preset temperatures of 33℃, 35℃, 37℃, and 39℃, respectively. The RAA reaction systems were then added to the reaction powder tubes and reacted for 30 min. The RAA reaction systems are shown in Table 6.

[0071] Table 6 RAA Reaction System

[0072] After the reaction was completed, 50 µL of phenol:chloroform:isoamyl alcohol (25:24:1) extraction buffer was added to the reaction unit tube. After thorough mixing, the amplification product was purified by centrifugation at 12000 rpm / min for 5 min (to remove protein components in the reaction system that may affect electrophoresis). Then, an equal volume of supernatant was taken for 1.5% agarose gel electrophoresis. The band specificity and brightness were analyzed by a gel imaging system to determine the optimal amplification temperature.

[0073] ③ Optimization of RAA isothermal amplification time Based on the determined optimal reaction temperature and optimal RAA primer combination, time gradient reaction systems were constructed for four preset reaction times of 10 min, 15 min, 20 min and 30 min. The target genes of five species were used as reaction templates to construct RAA reaction systems for the corresponding time. These were then added to reaction powder tubes and reacted for 30 min. The RAA reaction systems are shown in the table above.

[0074] To meet the need for simultaneous amplification of multiple species and to screen for highly specific recombinase-mediated amplification (RAA) universal primers, this embodiment selects five target species of 12S rRNA genes—chicken, duck, pig, cattle, and sheep—to design two pairs of universal primers, F1 / R1 and F2 / R2.

[0075] The amplification products were analyzed by 1.5% agarose gel electrophoresis. The electrophoresis results are as follows: Figure 1 As shown, comprehensive analysis of primers F2 / R2 indicates that primer F2+R2 not only has high amplification efficiency but also good specificity, enabling it to efficiently identify and bind to the target sequence for amplification. Based on these results, this embodiment determines primer F2+R2 as the optimal universal primer for RAA and uses it in subsequent related experiments.

[0076] Further optimization of amplification temperature and time showed that the RAA amplification system at 39℃ had the best amplification efficiency, which not only achieved efficient amplification of the target sequence but also minimized non-specific amplification interference. Four time gradient RAA amplification systems were set up at 10 min, 15 min, 20 min, and 30 min, and the optimal time for the RAA amplification reaction was 30 min.

[0077] Example 3 This embodiment provides the design and screening process for specific crRNAs, as detailed below: For five target species—chicken, duck, pig, cattle, and sheep—mitochondrial 12S rRNA gene reference sequences from 10 different geographical or commercial strains of the same genus were obtained from NCBI. Using the multiple sequence alignment (MSA) analysis functions of MEGA 11.0 and DNASTAR software, the target gene sequences obtained from previous sequencing experiments were compared with the corresponding 12S rRNA gene reference sequences. The percentage of homology between the target gene sequences and the reference sequences was calculated, and the sequence conservation of the target gene amplicon sequences obtained from experimental amplification was further verified among different geographical or commercial strains of the same species.

[0078] Based on the sequencing data and homology comparison results of the target genes of five species obtained in the previous experiment, screening of 5'-TTTN-3' type prototype adjacent motif (PAM) sites specifically recognized by Cas12a protein was carried out in the downstream region of the target sequence of each species.

[0079] First, the core region boundaries of the target sequences of each species were identified based on the homology comparison results. Then, using the sequence retrieval function of SnapGene, a 5'-TTTN-3' sequence was set (where N represents any deoxynucleotide, i.e., any one of A, T, C, G) to compare and confirm the sites of the downstream regions of the target sequences of each species one by one.

[0080] Based on the location results of the 5'-TTTN-3' type PAM site in each species determined in previous experiments, and combined with the sequence characteristics of the conserved region of the target gene, the design specifications of the CRISPR / Cas12a system crRNA were followed to ensure sequence targeting and functionality: (1) Precise selection of target region: 22 bases are truncated downstream of the PAM site in each species as the core target region for the binding of crRNA to the target sequence. This length is in line with the optimal range of target recognition mediated by Cas12a protein, which can ensure the binding efficiency of crRNA to the target sequence. (2) Specific Protospacer screening: The selected 22-base sequence was repeatedly compared with the target sequence of closely related non-target species. Through sequence difference analysis, specific Protospacer sequences that only match the target species and do not cross-species binding were screened to eliminate the risk of off-target. (3) Structural-functional optimization: In order to promote the correct assembly of crRNA and Cas12a protein and improve the efficiency of subsequent target sequence recognition, a fixed hairpin structure sequence (specific sequence: AAUUUCUACUAAGUGUAGAU) is added to the 5' end of crRNA. This structure can enhance the spatial stability of crRNA and avoid non-specific folding.

[0081] Based on the above design process, five crRNAs were finally synthesized by Sangon Biotech (Shanghai) Co., Ltd. The sequences are shown in Table 7 below. They were diluted to the required concentration with ddH2O, aliquoted into tubes, and stored at -80°C for later use.

[0082] Table 7 crRNA primer sequences

[0083] After Cas12a forms a complex with crRNA, its cleavage ability is activated once the target sequence is recognized and a match is formed, effectively cutting single-stranded DNA. Because this probe does not fluoresce under normal conditions, once the target sequence is identified, the Cas12a protein can be activated under specific conditions to recognize and cleave ssDNA by binding to crRNA to form a complex. Subsequently, the distance between the fluorophore and the quencher increases, and the quenching effect weakens or disappears, resulting in a significant increase in fluorescence that can be detected when the fluorophore is excited at a specific wavelength.

[0084] In constructing the ssDNA fluorescently labeled probe, 6-carboxyfluorescein (6-FAM) was placed at the 5′ end of the basic sequence “TTATTATT”, while black hole quencher-I (BHQⅠ) was attached to the 3′ end, forming the ssDNA fluorescent reporter probe: 5′-6-FAM-TTATTATT-BHQⅠ-3′. It was synthesized by Sangon Biotech (Shanghai) Co., Ltd., diluted to the required concentration with ddH2O, aliquoted into tubes, and stored at -20°C for later use.

[0085] Based on sequencing data and homology alignment results, the amplicon sequences of each species all possess crRNA functional design regions suitable for CRISPR / Cas12a system-mediated nucleic acid detection. Accordingly, this study further analyzed the key functional element of the system—the protospacer adjacent motif (PAM), and the results are as follows: Figure 2 As shown, the downstream regions of the target sequences in five target species—chicken (Gallus gallus), duck (Anasplatyrhynchos), pig (Sus scrofa), cattle (Bos taurus), and sheep (Ovis aries)—all contain 5'-TTTN-3' type PAM sites that support the specific binding of the Cas12a protein to the target sequence and its nucleic acid cleavage function. Following the CRISPR / Cas12a system crRNA design principles, this study designed species-specific crRNA sequences, providing key molecular tools and experimental foundations for subsequent in vitro activity validation experiments of the CRISPR / Cas12a system and the construction of species-specific nucleic acid detection systems for chicken, duck, pig, cattle, and sheep.

[0086] Example 4 This embodiment validates the trans-cleavage activity of the CRISPR / Cas12a system and optimizes the reaction conditions.

[0087] 1. Validation of Cas12a protein trans-cleavage activity In this embodiment, a positive standard containing duck-derived genes was used as the target DNA. The experiment was conducted using a two-step method of "RAA amplification + CRISPR / Cas12a detection". The specific operation is as follows: First, perform the RAA amplification reaction: Prepare the reaction system, which includes positive standard template, RAA reaction buffer, specific primer pairs, enzyme mixture, etc. Adjust the total volume to the specified amount with nuclease-free water; after mixing the system, incubate it at 39°C for 30 minutes in a PCR instrument.

[0088] After amplification, construct the CRISPR / Cas12a detection system: prepare the reaction mixture according to the table below. After the system is constructed, incubate it at 37°C for 30 min in a PCR instrument.

[0089] Table 8 CRISPR / Cas12a reaction system

[0090] To verify the trans-cleavage activity of Cas12a, this embodiment designed six sets of variable experiments, as shown in the table below. One set is a complete CRISPR / Cas12a system (containing Cas12a protein; crRNA; ssDNA-Reporter; RAA amplification product; 10×HOLMES Buffer); sets 2-5 each lack one major component; set 6 only adds the probe and observes the state of the probe after the reaction.

[0091] Table 9. Experimental group for verification of trans-cleavage activity

[0092] Note: + indicates that the ingredient has been added; - indicates that the ingredient has not been added. After the reaction was completed, the fluorescence signal was observed using a blue light gel cutter. Then, the reaction solution was transferred to a 96-well plate containing 80 μL ddH2O, and the fluorescence value was quantitatively detected at 565 nm using a multi-functional microplate reader with an excitation wavelength of 530 nm.

[0093] To verify the key components required for Cas12a protein trans-cleavage activation, this study set up experimental and control groups: Group 1 included all components that activate Cas12a protein trans-cleavage; Groups 2-5 were experimental groups lacking key components (Cas12a protein, crRNA, target DNA, and fluorescent reporter group, respectively); and Group 6 was a blank control group containing only ssDNA-Reporter. After the reaction, the reaction systems of each group were observed using a blue light gel excision instrument. A significant fluorescence signal was observed only in Group 1, such as... Figure 3As shown, groups 2-5 were missing a key component, and no obvious fluorescence was observed under blue light gel excision. The fluorescence values ​​were also comparable to the background levels of group 6 when quantitatively detected by a multi-functional microplate reader, indicating that the absence of the key component directly prevented the Cas12a protein from initiating trans-cleavage.

[0094] The results showed that the Cas12a protein must first assemble with crRNA to form a Cas12a / crRNA binary complex with target recognition function before it can specifically recognize target DNA and activate its trans-cleavage activity. In this study, ssDNA reporter molecules were used as dual-labeled probes, with a fluorescent (FAM) group labeled at the 5' end and a quencher (BHQ1) group labeled at the 3' end. When the trans-cleavage activity of the Cas12a protein was activated, it specifically cleaved the ssDNA reporter molecule in the system, causing the fluorescent group and the quencher group to separate, releasing a fluorescent signal and thus enabling the visual detection of the target nucleic acid.

[0095] 2. Optimization method for the concentration ratio of Cas12a to crRNA By setting concentration gradients and systematically optimizing the system, the optimal concentration ratio of Cas12a protein to crRNA was explored to improve the reaction efficiency of the CRISPR / Cas12a detection system. The specific procedures are as follows: First, in this embodiment, a positive standard containing duck-derived genes was used as the target DNA for RAA amplification at a reaction time of 30 min and a reaction temperature of 39°C. The reaction system was prepared according to Table 10. After amplification, a CRISPR / Cas12a detection system was constructed and reacted at a reaction time of 30 min and a temperature of 37°C. The reaction mixture was prepared according to the table below: the amount of RAA amplification product added to the reaction system remained constant; the concentration of ssDNA-Reporter was also kept constant.

[0096] Based on this, and considering the stoichiometric relationship between Cas12a and crRNA in forming a functional complex, two concentration gradients were established: one with a 1:1 molar ratio of Cas12a to crRNA, and the other with a 1:2 molar ratio. For these two ratios, Cas12a concentration gradients were set at 50 nM, 100 nM, 200 nM, 300 nM, and 500 nM, respectively. Simultaneously, the crRNA concentration was adjusted accordingly based on the preset ratios (e.g., when the Cas12a concentration was 50 nM, the crRNA concentration was 50 nM at the 1:1 ratio, and 100 nM at the 1:2 ratio; the other concentration gradients were calculated similarly). Fluorescence signals were detected after the reaction was complete.

[0097] Table 10 CRISPR / Cas12a reaction system

[0098] Based on the established optimal concentration ratio of Cas12a to crRNA, this study investigated the effect of ssDNA-Reporter concentration on the signal output of the CRISPR / Cas12a detection system. The optimal probe concentration for fluorescence response was screened by setting a concentration gradient. The specific procedures are as follows: First, in this embodiment, a positive standard containing duck-derived genes was used as the target DNA for RAA amplification at a reaction time of 30 min and a reaction temperature of 39℃. The reaction system is shown in Table 10. After amplification, the concentration gradient of ssDNA-Reporter was set to 200 nM, 400 nM, 600 nM, 800 nM, and 1 μM to construct a CRISPR / Cas12a detection system, which was then reacted at a temperature of 37℃ for 30 min. The concentrations of Cas12a protein, crRNA, and RAA amplification products in the system were all fixed at the optimal values ​​determined in the previous optimization to eliminate the interference of the above component concentration fluctuations on the experimental results and ensure that only the concentration of ssDNA-Reporter was the only variable. The fluorescence signal was detected after the reaction was completed.

[0099] Table 11 CRISPR / Cas12a reaction system

[0100] Based on the determined optimal component concentrations, this embodiment uses a positive standard containing duck-derived genes as target DNA for RAA amplification and prepares the reaction system. After amplification, a CRISPR / Cas12a detection system is constructed. The reaction mixture is prepared according to Table 12 below, and temperature gradients of 33℃, 35℃, 37℃, and 39℃ are set, with a fixed reaction time of 30 min. The fluorescence signal is detected after the reaction is complete.

[0101] Table 12 CRISPR / Cas12a reaction system

[0102] Based on the established optimal reaction temperature, this embodiment uses a positive standard containing duck-derived genes as target DNA for RAA amplification and prepares the reaction system. After amplification, a CRISPR / Cas12a detection system is constructed according to the table above, with reaction time gradients of 10 min, 15 min, 20 min, and 30 min, and the reaction is carried out at a fixed temperature of 39℃. The fluorescence signal is detected after the reaction is complete.

[0103] To optimize the concentration ratio of Cas12a protein to crRNA and maximize its trans-cleavage activity, this embodiment, with fixed concentrations of RAA amplification products and ssDNA fluorescent reporter molecules, established five concentration gradients (50 nM, 100 nM, 200 nM, 300 nM, and 500 nM) at Cas12a to crRNA ratios of 1:1 and 1:2, with corresponding crRNA concentrations adjusted synchronously. After the reaction, fluorescence intensity was observed using a blue light gel excision instrument and quantitatively detected using a multi-functional microplate reader.

[0104] The optimal fluorescence signal was obtained when the Cas12a concentration was 500 nM and the crRNA concentration was 1 µM, as shown by the trans-cleavage of the fluorescent reporter group. Figure 4 As shown, when the Cas12a protein concentration was 50 nM, the trans-cleavage activity was weak, and the fluorescence signal was not obvious. At concentrations of 100 nM, 200 nM, and 300 nM, the fluorescence signal gradually increased with increasing Cas12a concentration. However, at the same protein concentration, the fluorescence intensity difference produced by adding crRNA at a ratio of 1:1 or 1:2 was small. Therefore, the optimal concentration ratio of Cas12a (500 nM) to crRNA (1 µM) for this detection system was determined.

[0105] Example 5 This embodiment verifies the technical performance of the RAA-CRISPR / Cas12a two-step detection method.

[0106] To evaluate the specific recognition capability of the CRISPR / Cas12a detection system for target species, this embodiment constructs five species-specific reaction systems to assess its species resolution efficacy. The specific procedures are as follows: First, based on the optimal reaction parameters determined in the previous optimization, specific CRISPR / Cas12a reaction systems for five species were constructed. Each reaction system contained species-specific crRNA (ensuring complementary pairing with the target species' gene sequence). Then, RAA amplification reactions were performed at 39℃ using positive standard plasmids from chicken, duck, pig, cattle, and sheep as templates. After amplification, the RAA amplification products from chicken, duck, pig, cattle, and sheep were added sequentially to each of the above specific reaction systems, and a CRISPR / Cas12a detection system was constructed and incubated at 37℃ for 30 min. Fluorescence signals were detected after the reaction was complete.

[0107] To evaluate the detection sensitivity of the CRISPR / Cas12a detection system for target DNA from different species, and to ensure the accuracy and repeatability of the dilution concentrations, each concentration gradient was prepared independently three times, as follows: Recombinant plasmids from five species were selected as initial positive templates. Serial dilutions were performed using nuclease-free water as the dilution medium in a clean bench (to avoid concentration deviations caused by nuclease contamination and cross-contamination), ultimately reaching a final concentration of 10⁻⁶. 6 10 5 10 4 10³, 10², 10¹, 10 0 Diluted positive standard plasmids at seven concentration gradients (copies / μL) were used as templates for amplification at 39℃ for 30 min. The RAA amplification system is shown in the previous table. After amplification, RAA amplification products were added sequentially to the above-mentioned specific reaction systems, and a CRISPR / Cas12a detection system was constructed and incubated at 37℃ for 30 min. Fluorescence signals were detected after the reaction was completed.

[0108] To evaluate the adulteration detection capability of the CRISPR / Cas12a detection system, this experiment simulated adulterated samples containing duck-derived and non-duck-derived components by artificially mixing recombinant plasmids. The specific procedures are as follows: Recombinant plasmids from four non-duck species were selected as exogenous adulterants. Simultaneously, duck-derived recombinant plasmids were selected as the target species component. All concentrations were uniformly calibrated to 1×10⁻⁶. 6 Copies / μL are used to ensure the consistency of the initial concentration in the adulterated system and to eliminate experimental interference caused by concentration differences.

[0109] Based on the potential range of exogenous species adulteration ratios, four gradient adulteration ratios were set: in each sample, the proportions of non-duck-derived components were 30%, 10%, 5%, and 1%, respectively, while the proportions of duck-derived components were 70%, 90%, 95%, and 99% (all simulated sample mixing was performed under sterile conditions to avoid cross-contamination affecting sample authenticity). Using the simulated samples constructed above as templates, amplification was performed at 39℃ for 30 min, with the RAA amplification system referenced in the previous table. After amplification, RAA amplification products were added sequentially to the specific reaction systems of each group, and a CRISPR / Cas12a detection system was constructed and incubated at 37℃ for 30 min. Fluorescence signals were detected after the reaction was complete.

[0110] To systematically evaluate the specificity of the RAA-CRISPR / Cas12a two-step detection system for identifying target species, this embodiment constructed species-specific reaction tubes. RAA amplification products of positive standard plasmids for five target species—chicken, duck, pig, cattle, and sheep—were added to each group of specific reaction tubes. After the reaction, the fluorescence signals of each group were observed using a blue light gel cutting imaging system, and the fluorescence intensity was quantitatively detected using a multi-functional microplate reader.

[0111] The results are as follows Figure 5 As shown: the specific trans-cleavage activity of the Cas12a protein in the system can only be activated when the RAA amplification product added to the specific reaction tube is completely identical to the target species corresponding to the Cas12a / crRNA binary complex contained in the reaction tube. This activates the Cas12a protein, which then cleaves the fluorescent reporter group in the system, releasing a detectable fluorescent signal. Conversely, if the added amplification product does not match the crRNA in the reaction tube, the crRNA cannot guide the Cas12a protein to recognize the non-target sequence, and the Cas12a trans-cleavage activity remains inactive, resulting in no fluorescent signal. These results demonstrate that the RAA-CRISPR / Cas12a two-step detection system established in this embodiment can specifically recognize the target amplification products of the target species and shows no cross-positive reactions to the amplification products of the other four non-target species. This system can accurately and reliably identify five species: chicken, duck, pig, cattle, and sheep.

[0112] To clarify the sensitivity of the established RAA-CRISPR / Cas12a two-step detection system, this embodiment used recombinant plasmids containing target sequences of five target species as positive templates and performed tenfold serial dilutions to construct seven concentration gradients (10T). 6 10 5 10 4 10 3 10 2 10 1 10 0 The reaction was performed using the established optimal conditions for the RAA-CRISPR / Cas12a two-step method (copies / μL). After the reaction, the fluorescence signals of each concentration group were observed using a blue light gel cutting imaging system, and the fluorescence intensity was quantitatively detected using a multi-functional microplate reader. The results are shown in Figure 6: the minimum detection sensitivity of the RAA-CRISPR / Cas12a two-step reaction system for each target species for chicken, duck, pig, cattle, and sheep can reach 10² copies / μL; the fluorescence intensity decreased with decreasing template concentration, and when the template concentration decreased to 10... 2 Even at a template concentration of 10 copies / μL, a specific fluorescence signal could still be detected, and the signal intensity was higher than that of the blank control group; however, when the template concentration was further reduced to 10... 1 10 0 At a concentration of copies / μL, no significant fluorescence signal was generated in any group, indicating that the target concentration was below the limit of detection of the reaction system. These results demonstrate that the RAA-CRISPR / Cas12a two-step detection system established in this embodiment possesses high sensitivity.

[0113] To evaluate the detection capability of the RAA-CRISPR / Cas12 two-step reaction system for low-level non-target components in adulterated samples, this example describes the incorporation of four non-duck-derived adulterant templates into a duck-derived background template at concentrations of 30%, 10%, 5%, and 1% (to ensure the accuracy of the incorporation ratio, all adulterated samples were recombinant plasmids with a uniform concentration of 1×10⁻⁶). 6 Simulated samples with different adulteration levels were constructed (copies / μL). After the reaction, the fluorescence signal of the system was observed using a blue light gel cutting imaging system, and then the fluorescence intensity was quantitatively detected using a multi-functional microplate reader. At four adulteration ratios of 30%, 10%, 5%, and 1%, regardless of which non-duck species was added, the RAA-CRISPR / Cas12a detection system could detect the specific fluorescence signal corresponding to the non-duck component. Even at the 1% adulteration level, the fluorescence intensity values ​​of each adulteration group were higher than those of the control group. Figure 7 As shown above, the RAA-CRISPR / Cas12a two-step reaction detection system constructed in this embodiment has high detection sensitivity for various non-duck-derived components such as chicken, pig, cattle, and sheep, and has good ability to detect low-content adulteration.

[0114] Example 6 This embodiment establishes a single-tube integrated detection device (system) for RAA-CRISPR / Cas12a and explores and optimizes the optimal agarose concentration and reaction time.

[0115] The experimental principle of RAA-CRISPR / Cas12a single-tube integrated system based on agarose as a medium is as follows: Figure 8 As shown: Due to the small pore size of agarose hydrogel (usually tens to hundreds of nanometers), it can restrict the free migration of macromolecules. Therefore, in the early stage of the single-tube RAA-CRISPR / Cas12a reaction, the RAA amplification system and the CRISPR / Cas12a system are physically separated. The larger Cas12a protein is stably captured by the network structure of the agarose hydrogel and cannot move to the upper layer.

[0116] The RAA reagent located in the upper layer of the reaction tube can efficiently amplify the target DNA fragment under its optimal temperature conditions. This process is not interfered with by the Cas12a protein trapped in the lower layer, thus ensuring the specificity and efficiency of the RAA amplification stage. As the RAA reaction continues, the amplification product (target DNA) accumulated in the system, due to its small molecular size, can slowly permeate through the porous structure of the agarose gel and gradually diffuse into the CRISPR / Cas12a detection system located in the lower layer.

[0117] Subsequently, the amplification products diffused to the lower layer are specifically recognized by the Cas12a protein, which is pre-captured in the agarose hydrogel network. The specific crRNA pairs complementaryly with the target DNA fragment, thereby activating its own activity. The activated Cas12a protein then non-specifically cleaves the single-stranded DNA reporter molecule (ssDNA-Reporter) added to the system. When the ssDNA-Reporter is cleaved by the Cas12a protein, the previously close-proximity fluorophores and quenching groups on its molecule separate, releasing the inhibitory effect of the quenching groups on the fluorophores and ultimately enabling the fluorophores to produce a detectable fluorescent signal.

[0118] To achieve single-tube integration and visual analysis of the CRISPR / Cas12a detection system, this experiment uses the optimal parameters of the two-step method (RAA amplification + CRISPR / Cas12a detection) as the basic framework. An integrated reaction system is constructed by introducing agarose as a matrix. The specific operation is as follows: The agarose single-tube detection system consists of two parts: an upper layer of 20 μL RAA reagent and a lower layer of 20 μL CRISPR / Cas12a-agarose gel. Refer to Tables 13 and 14 to prepare the RAA premix and CRISPR / Cas12a premix, respectively. To prevent the agarose solution from solidifying, the agarose solution and CRISPR-agarose mixture were kept at 43°C, and aseptic techniques were strictly followed when assembling them into a single-tube system.

[0119] Table 13 Agarose Single-Tube Integrated RAA Reaction System (Upper Layer)

[0120] Table 14. Agarose Single-Tube Integrated CRISPR / Cas12a Reaction System (Lower Layer)

[0121] To screen for suitable agarose concentrations to balance system stability and reaction efficiency, four concentration gradients were established: 0.025 g, 0.05 g, 0.075 g, and 0.10 g of agarose powder were dissolved in 10 ml of ddH2O, and autoclaved at 121 °C for 20 min to completely dissolve the agarose, yielding 0.25%, 0.50%, 0.75%, and 1.0% agarose solutions, respectively. A control group without added agarose was also included to eliminate interference from the agarose matrix itself. Using a positive standard template containing duck-derived genes as the target DNA, single-tube reaction systems were prepared strictly according to the formulation and operating procedures outlined in the above embodiments, and reacted at a constant temperature of 39 °C for 60 min. Fluorescence signals were detected after the reaction was completed.

[0122] This embodiment uses agarose as the reaction medium. Agarose powder is pre-dissolved and integrated into a single-tube reaction system. After cooling, a semi-solid gel matrix is ​​formed, achieving "single-tube encapsulation" of the entire process of RAA amplification, CRISPR / Cas12a-mediated signal cleavage, and fluorescence release. To optimize the agarose concentration in the CRISPR / Cas12a single-tube integrated reaction system, four concentration gradients (0.25%, 0.50%, 0.75%, and 1.0%) were set based on the previously determined optimal reaction conditions for the CRISPR / Cas12a two-step reaction system. A control group without added agarose was also included.

[0123] After the reaction, the distribution morphology of fluorescence signals in each group was observed using a blue light gel cutting imaging system, and the fluorescence intensity of each group was quantitatively detected using a multi-functional microplate reader. The average fluorescence intensities of groups 1-6 were 7866.67, 9133.33, 7066.67, 6933.33, 3866.67, and 340, respectively. The results are as follows: Figure 9 As shown, when the agarose concentration was 0.50%, the reaction system exhibited a bright and uniformly distributed fluorescence signal with no local differences in signal intensity. This result indicates that a 0.50% agarose concentration can maintain the amplification reaction and the Cas12a trans-cleavage reaction sufficiently while ensuring a uniform distribution of fluorescence signal. In the 0.25%, 0.75%, and 1.0% agarose concentration groups, although fluorescence signals could be detected in all groups, the fluorescence distribution showed obvious regional unevenness: the 0.25% group had poor fluorescence signal due to insufficient reaction caused by the low agarose concentration; the 0.75% and 1.0% groups had uneven distribution due to the high agarose concentration, resulting in a dense gel network structure that hindered the effective diffusion of reaction components, causing uneven distribution of local signal accumulation and weak local signals. The fluorescence signal intensity of the blank control group without added agarose was significantly lower than that of the agarose-added groups, indicating that the reaction system without agarose lacked a stable microenvironment support, leading to insufficient activation of the Cas12a protein trans-cleavage activity, which is not conducive to the effective generation and accumulation of fluorescence signal. Based on the combined fluorescence signal intensity and distribution uniformity of the various agarose concentration groups, 0.50% was ultimately determined to be the optimal agarose concentration for the CRISPR / Cas12a single-tube integrated reaction system.

[0124] To investigate the effect of reaction time on the detection efficiency and signal stability of the single-tube detection system, this experiment established four reaction time gradients of 25 min, 30 min, 35 min, and 40 min, based on the previously determined optimal reaction conditions. Using a recombinant plasmid containing a duck-derived gene as the target DNA, the single-tube reaction system was prepared strictly according to the formula and operating procedure described above, and the entire reaction was carried out at a constant temperature of 39 ℃. The fluorescence signal was detected after the reaction was completed.

[0125] To further optimize the reaction time of the CRISPR / Cas12a single-tube integrated system, this embodiment established four time gradients of 25 min, 30 min, 35 min, and 40 min based on the determined optimal reaction conditions for the single-tube integrated system (reaction temperature 39℃, Cas12a concentration 500 nM, crRNA concentration 1 μM, fluorescent reporter group concentration 800 nM, and agarose concentration 0.50%). After the reaction, the brightness of the fluorescence signal in each group was observed using a blue light gel cutting imaging system, and the fluorescence intensity was quantitatively detected using a multi-functional microplate reader.

[0126] The average fluorescence intensities of each group were 2900, 5200, 8800, and 9266.67, respectively. The fluorescence signal intensity gradually increased with the extension of reaction time, as shown in the results. Figure 10 As shown, the fluorescence intensity and signal mediated by the trans-cleavage activity of the Cas12a protein were optimal at 40 min, and were similar to those under the 1-hour reaction condition. This result indicates that a reaction time of 40 min ensures sufficient diffusion and specific interaction of all reaction components within the single-tube integrated system in the agarose microenvironment. The fluorescence signal intensity was lowest in the 25-min reaction group, and increased sequentially in the 30-min and 35-min reaction groups, suggesting that the trans-cleavage reaction of the Cas12a protein was not yet fully completed. In conclusion, 40 min was determined to be the optimal time condition for the CRISPR / Cas12a single-tube integrated reaction system.

[0127] Example 7 This embodiment verifies the technical performance of the RAA-CRISPR / Cas12a single-tube integrated system in detection applications.

[0128] ① Specificity verification method for single-tube integrated detection technology To evaluate the specificity of the RAA-CRISPR / Cas12a single-tube integrated detection system for target species, this experiment constructed specific single-tube integrated reaction systems for chickens, ducks, pigs, cattle, and sheep based on the optimal ratio of components in the single-tube system described above. The positive standard plasmids for the five species were used as templates and added sequentially to each single-tube system, incubated at 39°C for 40 min. Fluorescence signals were detected after the reaction was complete.

[0129] To systematically evaluate the specificity of the constructed RAA-CRISPR / Cas12a single-tube integrated detection system, in this embodiment, positive standard plasmids of chicken, duck, pig, cow, and sheep were sequentially added to the established agarose single-tube reaction systems for each species. After amplification and signal release were completed, the fluorescence signal was observed using a blue light gel cutter, and the fluorescence intensity released in the gel system was quantitatively analyzed using a multi-functional microplate reader.

[0130] The results are as follows Figure 11 As shown: the trans-cleavage activity of the Cas12a protein in the system is activated only when the target species-specific amplification product generated inside the agarose gel by the RAA amplification reaction is a perfect match with the pre-set CRISPR / Cas12a detection system (specific crRNA designed for the target species) in the single-tube system. This non-specific cleavage of the pre-mixed fluorescent reporter molecule diffuses within the agarose gel matrix, separating the fluorophore from the quencher, thus releasing a fluorescent signal within the gel system. Conversely, if the RAA amplification product does not match the recognition sequence of the crRNA in the system, its trans-cleavage activity cannot be activated, the fluorescent reporter molecule remains intact, and no fluorescence is released. Therefore, no fluorescence signal higher than that in the control group was detected in any of the agarose single-tube reaction systems corresponding to non-target species.

[0131] The above results indicate that the RAA-CRISPR / Cas12a single-tube integrated detection system constructed using agarose as the reaction medium exhibits good detection specificity, with no cross-reaction between the systems, and can achieve accurate identification of the target species.

[0132] ② Sensitivity Verification Method for Single-Tube Integrated Detection Technology To evaluate the detection sensitivity of the RAA-CRISPR / Cas12a single-tube integrated detection system for target DNA from different species, this experiment prepared target dilutions of various concentrations according to the optimal ratio of each component in the single-tube system described in section 2.7. The dilutions were incubated at 39°C for 40 min to complete the integrated amplification and detection reaction. Fluorescence signals were then detected after the reaction was complete.

[0133] To systematically evaluate the sensitivity of the RAA-CRISPR / Cas12a single-tube integrated detection system using agarose as the reaction medium, this embodiment used recombinant plasmids of five species as standard templates and performed 10-fold serial dilutions to prepare 10 μL / mL samples. 6 10 5 10 4 10³, 10², 10¹ and 10 0Diluents of copies / μL were added to the corresponding agarose single-tube reaction systems for each species. After the simultaneous intra-tube reaction of RAA and CRISPR / Cas12a systems was completed, the fluorescence signal was observed using a blue light gel cutting imaging system, and the fluorescence intensity was quantitatively detected using a multi-functional microplate reader. As the template concentration gradually decreased, the fluorescence intensity in the agarose single-tube systems corresponding to the five species showed varying degrees of decrease, as shown in the results below. Figure 12 As shown: The RAA-CRISPR / Cas12a agarose single-tube detection system constructed for five species—chicken, duck, pig, cattle, and sheep—all exhibited good detection sensitivity, with a detection limit of 10² copies / μL; when the template concentration was reduced to 10... 2 At a concentration of 10 copies / μL, the reaction systems of each species still showed significantly higher fluorescence signals than the control group, indicating that the target sequence could still be effectively amplified at this concentration and successfully activated the trans-cleavage activity of the Cas12a protein; however, when the template concentration was further reduced to 10... 1 With 10 0 When the number of copies / μL was 1, the fluorescence signal generated by the system was comparable to that of the control group, and the effective detection threshold was not reached.

[0134] The above results demonstrate that the established RAA-CRISPR / Cas12a agarose single-tube detection system has the ability to effectively detect low copy number target sequences.

[0135] ③ Single-tube integrated detection technology simulates adulteration detection limit verification method To evaluate the doping detection capability of the RAA-CRISPR / Cas12a single-tube integrated detection system, this experiment constructed a simulated doping sample based on the optimal component ratio of the single-tube system determined above, and completed the integrated amplification and detection reaction by incubation at 39℃ for 40 min. Fluorescence signals were then detected after the reaction was complete.

[0136] To evaluate the detection capability of the agarose-based RAA-CRISPR / Cas12a single-tube detection system for low levels of non-target components in adulterated samples, this example uses duck-derived specific recombinant plasmids as the matrix, and incorporates non-duck-derived recombinant plasmids from chicken, pig, cattle, and sheep at adulteration ratios of 30%, 10%, 5%, and 1% (sample concentrations were all 10). 6 Simulated adulterated samples (copies / μL) were used to systematically validate the detection limit in a single-tube reaction system. After the reaction, the fluorescence signal was observed using a blue light gel cutting imaging system, and then the fluorescence intensity was quantitatively detected using a multi-functional microplate reader. The results are as follows: Figure 13As shown, in samples with only 1% non-duck-derived components at all adulteration ratios, significantly higher specific fluorescence signals than the control could be detected. This indicates that the system can effectively capture genomic sequences of low proportions of non-target components and release specific signals through RAA amplification and Cas12a trans-cleavage activation, without detection interference from the presence of high proportions of duck-derived components in the matrix. In summary, the RAA-CRISPR / Cas12a agarose single-tube detection system established in this embodiment still exhibits good detection capabilities in mixed templates.

[0137] ④ Clinical application verification method of single-tube integrated detection technology To verify the effectiveness of the RAA-CRISPR / Cas12a single-tube integrated detection system in actual commercial products, this experiment collected 20 duck blood products from e-commerce platforms and major chain supermarkets, farmers' markets and restaurants in Hefei, Anhui Province, and extracted genomic DNA according to the method described above.

[0138] In this embodiment, the RAA-CRISPR / Cas12a single-tube integrated detection system was constructed strictly according to Table 15. 2 µL of genomic DNA was added to the detection unit tube, and the cap was closed. The system was incubated at 39°C for 40 min to complete the integrated amplification and detection reaction. After the reaction was complete, the fluorescence signal was observed using a blue light gel cutter to determine whether duck-derived components and other animal-derived components were detected.

[0139] Table 15 Agarose Single-Tube Integrated Reaction System

[0140] DNA samples after single-tube integrated reaction and detection were double-verified using five-fold PCR technology. After PCR amplification, equal volumes of PCR products were added to a 1.5% agarose gel for electrophoretic separation. Finally, the band results observed by the gel imaging system were compared with the single-tube integrated reaction detection results to determine whether the sample components detected by the two detection methods were consistent. Primer sequences are referenced in Table 16, PCR reaction systems are set according to Table 17, and PCR reaction procedures are based on Table 18.

[0141] Table 16 PCR Primer Sequences

[0142] Table 17 PCR Reaction System

[0143] Table 18 PCR Reaction Procedure

[0144] To verify the applicability and accuracy of the agarose-based RAA-CRISPR / Cas12a single-tube integrated detection technology in actual samples, this embodiment tested 20 duck blood product samples: Genomic DNA was first extracted from the samples, and then used as a template to perform CRISPR / Cas12a detection and PCR amplification sequentially in a single-tube reaction system. After the reaction, the fluorescence signal and band position were observed using a blue light gel cutting imaging system and a gel imaging system, respectively. The specific results are shown in Table 19. In 18 samples, only specific fluorescence signals and target bands of duck-derived components were detected, and no other animal-derived components such as chicken, pig, cattle, or sheep were found. Samples 6 and 19 simultaneously detected specific fluorescence signals and target bands of both chicken and duck-derived components. Sample 18 detected specific fluorescence signals and target bands of both duck and pig-derived components. The results of the five-fold PCR verification were completely consistent with the results of this single-tube integrated detection. Figure 14 and Figure 15 As shown.

[0145] The above results demonstrate that the RAA-CRISPR / Cas12a agarose single-tube detection system established in this embodiment not only performs excellently in simulated samples, but also exhibits high species specificity and detection accuracy in the detection of commercially available duck blood products, effectively identifying target source components in duck blood products.

[0146] Table 19 Detection results for each sample

[0147] Note: + indicates detected; - indicates not detected. The above embodiments successfully constructed a rapid detection system for animal-derived components based on RAA and CRISPR / Cas12a systems. Using five common livestock and poultry species—chicken, duck, pig, cattle, and sheep—as detection targets, and targeting the conserved region of their mitochondrial 12S rRNA gene, a universal primer F2+R2 was designed and screened after multiple sequence alignment analysis. This primer stably amplified the specific target fragment after reacting at 39℃ for 40 min.

[0148] During the systematic optimization of the CRISPR / Cas12a detection system, the optimal combination of reaction conditions was determined through single-factor experiments: Cas12a protein concentration of 500 nM, crRNA concentration of 1 µM, ssDNA-Reporter concentration of 800 nM, reaction temperature of 39℃, and reaction time of 40 min. Under these conditions, the fluorescence signal intensity released by the trans-cleavage of the system was optimal.

Claims

1. A single-tube integrated detection device based on RAA and CRISPR / Cas12a systems, characterized in that, The system comprises an upper layer of nucleic acid isothermal amplification reaction system, a lower layer of endonuclease detection system, and a semi-solid gel between the two layers. The nucleic acid isothermal amplification reaction system adopts the RAA system, which amplifies the nucleic acid in the sample under isothermal conditions. The amplification products can diffuse through the semi-solid gel to the lower layer of endonuclease detection system.

2. The detection device according to claim 1, characterized in that, The semi-solid gel is selected from at least one of blue ribbon agarose, alginate, and polyacrylamide gel, with a concentration of 0.1%-1%, preferably 0.5%.

3. The single-tube integrated testing device according to claim 1, characterized in that, The nucleic acid isothermal amplification reaction system includes RAA reaction buffer and specific primer pairs, which are used to identify and amplify conserved regions in livestock and poultry-derived genes. The nucleic acid template is selected from the genomic DNA of livestock and poultry-derived components, the sources of which include, but are not limited to, chickens, ducks, pigs, cattle and sheep.

4. The single-tube integrated detection device according to claim 3, characterized in that, The specific primer pair comprises primer pair 1 and primer pair 2. The sequence of the upstream primer F1 of primer pair 1 is shown in SEQ ID No. 1, the sequence of the downstream primer R1 of primer pair 1 is shown in SEQ ID No. 2, the sequence of the upstream primer F2 of primer pair 2 is shown in SEQ ID No. 3, and the sequence of the downstream primer R2 of primer pair 2 is shown in SEQ ID No. 4; the specific primer pair is preferably primer pair 2.

5. The single-tube integrated testing device according to claim 1, characterized in that, The endonuclease detection system comprises an endonuclease, a specific recognition sequence, and a fluorescent reporter group. Guided by the specific recognition sequence, the endonuclease recognizes and cleaves the target DNA, activating its trans-cleavage activity. This cleaves the fluorescent reporter group to generate a detectable fluorescent signal for detecting livestock-derived components. The fluorescent reporter group consists of a fluorescent group and a quencher group, including but not limited to 6-FAM, VIC, ROX, HEX, and Cy5, and is used to achieve visual detection of the target nucleic acid through changes in fluorescence signal.

6. The single-tube integrated testing device according to claim 5, characterized in that, The endonuclease is selected from the Cas12a family of proteins, including but not limited to LbCas12a, AsCas12a, and SaCas12a; the specific recognition sequence includes crRNA, which is 30-60 nucleotides in length and is used to recognize the 5'-TTTN-3' type PAM site downstream of the mitochondrial 12SrRNA gene in livestock and poultry-derived components; the sources of the livestock and poultry-derived components include, but are not limited to, chickens, ducks, pigs, cattle, and sheep.

7. The single-tube integrated testing device according to claim 6, characterized in that, The crRNA includes chicken crRNA, the sequence of which is shown in SEQ ID No. 5; duck crRNA, the sequence of which is shown in SEQ ID No. 6; porcine crRNA, the sequence of which is shown in SEQ ID No. 7; bovine crRNA, the sequence of which is shown in SEQ ID No. 8; and sheep crRNA, the sequence of which is shown in SEQ ID No.

9.

8. A detection method using the detection device according to any one of claims 1-7, characterized in that, The method includes the following steps: (1) Perform isothermal amplification of nucleic acids in a single reaction tube using universal primers designed for conserved regions of the mitochondrial genome; (2) After isothermal amplification, without changing the conditions in the reaction tube, endonuclease detection is performed in the same tube. A specific concentration of semi-solid gel is used as both the component isolation medium and the reaction medium, allowing the amplification product to diffuse from the upper layer to the lower layer of the gel. (3) The entire detection process is carried out under constant temperature conditions and the reaction time is set to complete the detection process.

9. The detection method according to claim 8, characterized in that, In step (1), the universal primers are designed based on conserved regions of mitochondrial 12S rRNA, 16S rRNA and / or COI genes; the nucleic acid isothermal amplification uses the RAA system, with a reaction temperature of 37-42℃ and a reaction time of 20-40 minutes; in step (2), the concentration of the semi-solid gel is 0.5%; the reaction conditions of the endonuclease detection system are: Cas12a protein concentration 200-800nM, crRNA concentration 0.5-2μM, ssDNA-Reporter concentration 400-1200nM, reaction temperature 37-42℃, and reaction time 20-40 minutes; in step (3), the constant temperature is 39℃ and the set time is 40 minutes.

10. The application of a detection device as described in any one of claims 1-7, or a detection method as described in claim 8 or 9, in the identification of genuine and counterfeit food, characterized in that, The application includes the rapid detection of poultry-derived components in duck blood products, the sources of which include, but are not limited to, chicken, duck, pig, cattle, and sheep.

Images