Application of CSNK1D, YWHAQ and MSN as biomarkers in preparation of products for diagnosing metabolic dysfunction related fatty liver diseases

By screening CSNK1D, YWHAQ, and MSN genes through large-scale Mendelian proteomics randomization analysis, a real-time quantitative PCR detection kit was developed, which solved the problem of early screening and accurate diagnosis of fatty liver disease related to metabolic dysfunction and provided a highly sensitive and specific multi-gene joint detection solution.

CN122038560APending Publication Date: 2026-05-15SOUTH CHINA UNIV OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-23
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing technologies lack highly sensitive and specific multi-gene combined diagnostic methods, making it difficult to achieve early screening and accurate diagnosis of fatty liver disease related to metabolic dysfunction.

Method used

Through large-scale Mendelian randomization analysis of proteomics, the CSNK1D, YWHAQ, and MSN genes were screened from 5,086 proteins. Combined with multi-level validation, a detection kit based on real-time quantitative PCR technology was developed to detect the expression levels of these genes.

Benefits of technology

It enables efficient and accurate auxiliary diagnosis of fatty liver disease related to metabolic dysfunction, improves the accuracy and reliability of diagnosis, provides non-invasive or minimally invasive auxiliary diagnostic tools, simplifies the operation process, and facilitates its promotion and application in medical institutions at all levels.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122038560A_ABST
    Figure CN122038560A_ABST
Patent Text Reader

Abstract

The invention relates to the field of biological medicine, and particularly discloses application of CSNK1D, YWHAQ and MSN as biomarkers in preparation of products for diagnosing metabolic dysfunction-related fatty liver diseases. According to the invention, large-scale plasma protein quantitative character site data and metabolic dysfunction-related fatty liver disease whole genome association research data are integrated; candidate proteins having causal association with diseases are screened from more than five thousands of proteins by Mendel randomization analysis, and through co-localization analysis, transcriptome verification and cell model experiment verification, it is revealed for the first time that CSNK1D, YWHAQ and MSN genes have stable causal association with metabolic dysfunction related fatty liver diseases. On the basis, the invention provides a reagent for detecting the expression levels of the three genes and a kit prepared from the reagent, the diagnosis accuracy and reliability are remarkably improved through multi-gene joint detection, and a new technical means is provided for early screening and auxiliary diagnosis of the metabolic dysfunction related fatty liver disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically the application of CSNK1D, YWHAQ, and MSN as biomarkers in the preparation of products for diagnosing fatty liver disease related to metabolic dysfunction. Background Technology

[0002] Metabolic dysfunction-associated fatty liver disease (MDFL) is a chronic liver disease closely related to insulin resistance and metabolic syndrome. It is characterized by abnormal triglyceride accumulation in hepatocytes, and its spectrum includes simple steatosis, non-alcoholic steatohepatitis (NAFLD), liver fibrosis, cirrhosis, and even hepatocellular carcinoma. With the continued rise in global obesity and diabetes prevalence, MDFL has become one of the most common chronic liver diseases, affecting approximately one-quarter of the global adult population and placing a heavy burden on public health systems. The disease has an insidious onset, with atypical early clinical symptoms, and most patients are diagnosed at an advanced stage, missing the optimal intervention window. Therefore, developing early and accurate diagnostic methods is crucial for improving patient prognosis.

[0003] Currently, the diagnosis of metabolic dysfunction-related fatty liver disease mainly relies on imaging examinations and liver biopsy. While abdominal ultrasound is simple and non-invasive, its sensitivity for detecting mild steatosis is low, and it cannot accurately distinguish between simple steatosis and steatohepatitis. Liver biopsy, although considered the gold standard, has limitations such as high invasiveness, sampling error, bleeding risk, and poor patient compliance, making it unsuitable as a routine screening method. Serological markers such as transaminases and gamma-glutamyl transferase are often abnormal in patients with metabolic dysfunction-related fatty liver disease, but their sensitivity and specificity are not ideal, and they are easily interfered with by other liver disease factors. In recent years, genome-wide association studies have identified several genetic loci associated with metabolic dysfunction-related fatty liver disease, but these loci only explain a small portion of the disease's heritability and are difficult to directly translate into clinically usable diagnostic tools.

[0004] The existing technology lacks a highly sensitive and specific diagnostic method based on multi-gene joint detection, which makes it difficult to meet the clinical needs for early screening and accurate diagnosis of fatty liver disease related to metabolic dysfunction. Therefore, developing new and reliable biomarkers and corresponding detection technologies to achieve efficient auxiliary diagnosis of this disease has become an urgent technical problem to be solved in this field.

[0005] In recent years, Mendelian randomization analysis in proteomics has provided a new technical means for screening disease-related proteins from large-scale populations. By integrating quantitative trait locus data of plasma proteins with genome-wide association studies of diseases, proteins with causal relationships to diseases can be effectively identified, providing a reliable basis for biomarker development. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides the application of CSNK1D, YWHAQ, and MSN as biomarkers in the preparation of products for diagnosing metabolic dysfunction-related fatty liver disease. This addresses the lack of highly sensitive and specific multi-gene combined diagnostic biomarkers in existing technologies, which makes it difficult to achieve early screening and accurate diagnosis of metabolic dysfunction-related fatty liver disease.

[0007] Application of reagents for detecting the expression levels of CSNK1D, YWHAQ, and MSN genes in the preparation of products for diagnosing metabolic dysfunction-related fatty liver disease.

[0008] Preferably, the reagents for detecting the expression levels of CSNK1D, YWHAQ, and MSN genes include:

[0009] a) Primer pairs for specific amplification of the CSNK1D gene;

[0010] b) Primer pairs for specific amplification of the YWHAQ gene; and

[0011] c) Primer pairs for specific amplification of the MSN gene.

[0012] Preferably, the primer pair for specifically amplifying the CSNK1D gene comprises the nucleotide sequence shown in SEQ ID NO:1 for the forward primer and the nucleotide sequence shown in SEQ ID NO:2 for the reverse primer;

[0013] The primer pair for specifically amplifying the YWHAQ gene contains the nucleotide sequence shown in the forward primer SEQ ID NO:3 and the nucleotide sequence shown in the reverse primer SEQ ID NO:4;

[0014] The primer pair for specifically amplifying the MSN gene contains the nucleotide sequence shown in the forward primer SEQ ID NO:5 and the nucleotide sequence shown in the reverse primer SEQ ID NO:6.

[0015] Preferably, the product is a reagent kit or a biochip.

[0016] Preferably, the detection is performed by qRT-PCR.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] This invention, for the first time, systematically screened candidate proteins causally associated with MASLD from 5,086 proteins using large-scale Mendelian randomization analysis in proteomics, and ultimately identified CSNK1D, YWHAQ, and MSN through multi-level validation. This screening method overcomes the limitations of traditional single-marker studies and provides a novel multi-gene joint detection scheme for the diagnosis of MASLD.

[0019] By integrating large-scale plasma protein quantitative trait locus data with genome-wide association study data of fatty liver disease associated with metabolic dysfunction, Mendelian randomization analysis was used to screen out candidate proteins with causal association with the disease from more than 5,000 proteins. After colocalization analysis, transcriptome validation and cell model experiments, three genes, CSNK1D, YWHAQ and MSN, were finally identified as diagnostic biomarkers. Based on this, a detection kit was developed, which realizes efficient and accurate auxiliary diagnosis of fatty liver disease associated with metabolic dysfunction.

[0020] This invention reveals for the first time a stable causal association between CSNK1D, YWHAQ, and MSN genes and fatty liver disease associated with metabolic dysfunction. The combination of these three genes as diagnostic biomarkers overcomes the limitations of insufficient sensitivity of single biomarkers, and significantly improves the accuracy and reliability of diagnosis through multi-gene joint detection. The detection kit provided by this invention is easy to operate, has good repeatability, and can quickly detect the expression levels of the three target genes in the sample, effectively distinguishing patients from healthy individuals, and providing a non-invasive or minimally invasive auxiliary diagnostic tool for clinical practice.

[0021] The diagnostic method of this invention is based on real-time quantitative PCR technology, which uses specific primers to accurately amplify target genes, resulting in objective and stable detection results unaffected by subjective factors. This invention not only provides a new technical means for early screening and risk stratification of metabolic dysfunction-related fatty liver disease, but also lays a solid foundation for disease mechanism research, possessing significant clinical application value and broad industrialization prospects. The implementation of this invention does not require expensive large-scale instruments and complex operating procedures, making it easy to promote and apply in medical institutions at all levels. It helps improve the early diagnosis rate of metabolic dysfunction-related fatty liver disease, improve patient prognosis, and reduce the social medical burden. Attached Figure Description

[0022] Figure 1 A flowchart illustrating the overall research and design of this invention;

[0023] This study first integrated large-scale plasma quantitative trait locus (pQTL) data with genome-wide association study (GWAS) data for metabolic dysfunction-associated fatty liver disease (MASLD). Mendelian randomization analysis was used to screen 40 candidate proteins causally associated with MASLD from 5,086 proteins. Further validation of these candidate proteins was achieved through colocalization analysis (PPH4>0.7) and SMR / HEIDI test. Differential expression in liver tissue of MASLD patients was analyzed using a transcriptome dataset (GSE48452). Finally, the expression levels of key genes were validated using qRT-PCR in a MASLD cell model, ultimately identifying CSNK1D, YWHAQ, and MSN as diagnostic biomarkers for MASLD.

[0024] Figure 2 Forest plot of the association between protein and MASLD (Part 1); the forest plot shows the odds ratio (OR) and 95% confidence interval between the genetically predicted protein level and the risk of MASLD. The plot indicates the statistical method used for Mendelian randomization (MR) estimation (Wald ratio or Inverse Variance weighted) and the number of tool SNPs. PPH4 values ​​represent the posterior probability of co-localization between pQTL and MASLD data signals, while SMR and HEIDI tests assess pleiotropy and heterogeneity, respectively. Proteins with high co-localization probabilities (PPH4 > 0.9) and insignificant HEIDI results (HEIDI > 0.05) are considered robust causal candidates.

[0025] Figure 3 Forest plot showing the association between proteins and MASLD (part 2).

[0026] Figure 4 Transcriptomic validation of proteins in MASLD was performed; box plots show the differential expression of five MR-identified proteins between MASLD patients (blue) and controls (red). The expression changes of ARL2, IGFBP2, and CSNK1D followed the same trend as the MR analysis, while LRRN1 and MSN showed the opposite trend.

[0027] Figure 5 To validate the expression of CSNK1D, YWHAQ, and MSN genes in the MASLD cell model using qRT-PCR, qRT-PCR analysis showed that the expression levels of CSNK1D, YWHAQ, and MSN genes were significantly upregulated in the MASLD cell model compared with the control group (p<0.05). Results are expressed as mean ± standard deviation, with three biological replicates per group.

[0028] Figure 6The KEGG pathway enrichment analysis results show that signaling pathways with significant enrichment of genes such as CSNK1D, YWHAQ, and MSN are included, including the Hippo signaling pathway, circadian rhythm, and viral carcinogenesis.

[0029] Figure 7 The GO functional enrichment analysis results demonstrate the biological processes involved by the target genes, including cytoskeleton remodeling, immune inflammation regulation, and insulin signaling. Detailed Implementation

[0030] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0031] This invention, based on large-scale Mendelian randomization analysis of proteomics, systematically screened candidate proteins with causal associations with MASLD from 5,086 plasma proteins for the first time. By integrating colocalization analysis, SMR / HEIDI test and transcriptome validation, the candidate range was narrowed down step by step, and finally three genes, CSNK1D, YWHAQ and MSN, were identified. Further cell experiments verified the expression changes of these three genes in MASLD, confirming the reliability of the bioinformatics analysis results.

[0032] This invention not only provides a multi-gene screening method based on bioinformatics analysis, but also develops corresponding diagnostic kits based on the screening results, realizing the entire chain transformation from bioinformatics analysis to clinical diagnostic applications.

[0033] Example 1: Construction of the MASLD cell model

[0034] 1. Cell Culture

[0035] This embodiment uses the human hepatocellular carcinoma cell line HepG2 (derived from liver tissue of a 15-year-old Caucasian male). Cells were cultured in DMEM / F-12 (1:1) medium (Gibco, 11330-032) containing 10% fetal bovine serum (FBS, Gibco) and incubated at 37°C in a humidified incubator with 5% CO2. Cells were passaged or treated when confluence reached 60-70%.

[0036] 2. Establishment of MASLD cell model

[0037] HepG2 cells were divided into two groups (3 biological replicates in each group):

[0038] Control group: treated with solvent only for 24 hours;

[0039] MASLD model group: treated with 1 mM free fatty acids (FFA, oleic acid:palmitic acid = 2:1, Sigma, USA) for 24 hours.

[0040] After treatment, the lipid accumulation in the cells was assessed by Oil Red O staining to confirm the successful construction of the MASLD cell model.

[0041] Example 2: qRT-PCR detection of target gene expression

[0042] 1. Total RNA extraction

[0043] Total RNA was extracted from HepG2 cells in the control group and MASLD model group in Example 1 using TRIzol reagent (Vazyme, China), and purified by RNA binding centrifugation. The specific steps are as follows:

[0044] Discard the culture medium, add 1 mL of TRIzol reagent to each well, and lyse at room temperature for 5 minutes;

[0045] Transfer to a 1.5 mL centrifuge tube, add 200 μL of chloroform, shake vigorously for 15 seconds, and let stand at room temperature for 3 minutes;

[0046] Centrifuge at 4℃ and 12000 rpm for 15 minutes, and transfer the upper aqueous phase to a new centrifuge tube;

[0047] Add an equal volume of isopropanol, mix well, and let stand at room temperature for 10 minutes.

[0048] Centrifuge at 4℃ and 12000 rpm for 10 minutes, then discard the supernatant;

[0049] Add 1 mL of 75% ethanol to wash the precipitate, centrifuge at 7500 rpm for 5 minutes at 4°C, and discard the supernatant;

[0050] After drying at room temperature for 5 minutes, the RNA was dissolved in 30 μL of DEPC water, and its concentration and purity were determined.

[0051] 2. Reverse transcription to synthesize cDNA

[0052] Reverse transcription was performed using the PrimeScript™ RT kit (Vazyme, China). The reaction volume (20 μL) is as follows:

[0053] 5×PrimeScript Buffer: 4 μL;

[0054] PrimeScript RT Enzyme Mix I: 1 μL;

[0055] Oligo dT Primer (50 μM): 1 μL;

[0056] Random 6 mers (100 μM): 1 μL;

[0057] Total RNA: 1 μg;

[0058] RNase-Free dH2O: Add to a final volume of 20 μL;

[0059] Reaction procedure: Incubate at 37°C for 15 minutes, heat at 85°C for 5 seconds to terminate the reaction, and store at 4°C.

[0060] 3. Primer design and synthesis

[0061] Based on the publicly available sequences of the CSNK1D, YWHAQ, and MSN genes, specific primers were designed and synthesized by a biotechnology company. The primer sequences are as follows:

[0062] Gene Primer direction Sequence (5'→3') SEQ ID NO CSNK1D positive AACCGTCCTGGTGTTGCT 1 CSNK1D Reverse CCCGTTGAGTTCTTTGTTCTC 2 YWHAQ positive CCTGCACGTGGTAAACA 3 YWHAQ Reverse CCTTCTGCCGATCATCATT 4 MSN positive ATTGGCTTGAGGGAAGTTTCG 5 MSN Reverse AGGGTAGAACTTGCACCAGA 6 GAPDH positive ACAACTTTGGTATCGCTGGAGG — GAPDH Reverse GCCATCACGCACCAGTTTC —

[0063] 4. Real-time quantitative PCR

[0064] The assay was performed using SYBR Green Pro Taq HS Mix (AG, China) on a real-time quantitative PCR instrument. The reaction volume (20 μL) is as follows:

[0065] 2×SYBR Green Pro Taq HS Mix: 10 μL;

[0066] Forward primer (10 μM): 0.4 μL;

[0067] Reverse primer (10 μM): 0.4 μL;

[0068] cDNA template: 2 μL;

[0069] RNase-Free dH2O: 7.2 μL;

[0070] Reaction procedure:

[0071] Pre-denaturation: 95℃ for 30 seconds;

[0072] Cycle (40 cycles): denaturation at 95℃ for 5 seconds, annealing at 60℃ for 30 seconds, extension at 72℃ for 30 seconds (fluorescence collection);

[0073] Melting curve analysis: 95℃ for 15 seconds, 60℃ for 1 minute, 95℃ for 15 seconds;

[0074] Each sample was prepared in triplicate, with GAPDH used as an internal control gene.

[0075] 5. Data Analysis

[0076] The relative expression level of the target gene was calculated using the 2^-ΔΔCT method. ΔCT = CT (target gene) - CT (internal reference gene), ΔΔCT = ΔCT (treatment group) - ΔCT (control group). Relative expression level = 2^-ΔΔCT.

[0077] 6. Experimental Results

[0078] qRT-PCR results showed that, compared with the control group, the expression levels of CSNK1D, YWHAQ and MSN genes in the MASLD cell model were significantly upregulated (p < 0.05). The specific Ct values ​​and 2^-ΔΔCT values ​​are shown in Table 1.

[0079] Table 1 Results of MSN gene qRT-PCR detection

[0080] Sample grouping MSN_CP GAPDH_CP 2^-ΔΔCT MASLD Group 31.74 20.91 1.580 MASLD Group 32.29 21.16 1.283 MASLD Group 32.05 21.54 1.972 control group 31.59 19.48 0.651 control group 32.28 19.92 0.547 control group 32.49 20.03 0.511

[0081] Table 2 Results of qRT-PCR detection of CSNK1D gene

[0082] Sample grouping CSNK1D_CP GAPDH_CP 2^-ΔΔCT MASLD Group 20.63 22.03 0.851 MASLD Group 20.55 21.97 0.863 MASLD Group 20.26 21.74 0.899 control group 19.93 20.54 0.492 control group 19.66 19.73 0.338 control group 18.65 19.17 0.462

[0083] Table 3 Results of qRT-PCR detection of YWHAQ gene

[0084] Sample grouping YWHAQ_CP GAPDH_CP 2^-ΔΔCT MASLD Group 17.48 22.6 1.382 MASLD Group 17.13 21.97 1.138 MASLD Group 17.02 22.03 1.280 control group 17.46 20.54 0.336 control group 16.91 19.73 0.281 control group 16.15 19.17 0.322

[0085] The above results indicate that the expression of CSNK1D, YWHAQ, and MSN genes is upregulated in the MASLD cell model, consistent with the results of MR analysis and transcriptomics verification, confirming that these three genes can serve as biomarkers for the diagnosis of MASLD.

[0086] Example 3: Preparation of Diagnostic Kit

[0087] Based on the CSNK1D, YWHAQ, and MSN genes screened according to this invention, a qRT-PCR detection kit for the diagnosis of MASLD was prepared. The kit contains the following components:

[0088] 1. Primer mixture

[0089] Primer pairs for specific amplification of the CSNK1D gene (SEQ ID NO:1-2);

[0090] Primer pairs for specific amplification of the YWHAQ gene (SEQ ID NO:3-4);

[0091] Primer pairs for specific amplification of the MSN gene (SEQ ID NO:5-6);

[0092] Primer pair for the internal reference gene GAPDH;

[0093] 2. qRT-PCR reaction premix

[0094] 2×SYBR Green Pro Taq HS Mix;

[0095] ROX reference dye (optional);

[0096] 3. Positive control

[0097] Plasmids or cDNA containing CSNK1D, YWHAQ, and MSN gene fragments;

[0098] 4. Negative control

[0099] Nuclease-free water;

[0100] Using this kit, the expression levels of CSNK1D, YWHAQ, and MSN genes in the test samples were detected according to the qRT-PCR method described in Example 2. The risk of MASLD in the test samples was determined based on the expression levels.

[0101] Those skilled in the art will understand that, in addition to qRT-PCR, the reagents described in this invention for detecting the expression levels of CSNK1D, YWHAQ, and MSN genes can also be applied to other nucleic acid detection platforms, such as digital PCR, Northern blot, and gene chips, and these are all equivalent embodiments of this invention.

[0102] The CSNK1D, YWHAQ, and MSN provided by this invention serve as diagnostic biomarkers for MASLD and can be used to prepare diagnostic kits. They have advantages such as high sensitivity, strong specificity, and simple operation, making them suitable for rapid detection of clinical samples. They are helpful for the early diagnosis and risk stratification of MASLD and have significant clinical application value and industrialization prospects.

[0103] The embodiments of the present invention are given for the purposes of illustration and description. Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Any changes, modifications, substitutions and variations made by those skilled in the art to the above embodiments within the scope of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of reagents for detecting the expression levels of CSNK1D, YWHAQ and MSN genes in the preparation of products for diagnosing metabolic dysfunction-related fatty liver disease.

2. The application as described in claim 1, characterized in that, The reagents used to detect the expression levels of CSNK1D, YWHAQ, and MSN genes include: a) Primer pairs for specific amplification of the CSNK1D gene; b) Primer pairs for specific amplification of the YWHAQ gene; and c) Primer pairs for specific amplification of the MSN gene.

3. The application as described in claim 2, characterized in that, The primer pair for specifically amplifying the CSNK1D gene contains the nucleotide sequence shown in SEQ ID NO:1 for the forward primer and the nucleotide sequence shown in SEQ ID NO:2 for the reverse primer. The primer pair for specifically amplifying the YWHAQ gene contains the nucleotide sequence shown in the forward primer SEQ ID NO:3 and the nucleotide sequence shown in the reverse primer SEQ ID NO:4; The primer pair for specifically amplifying the MSN gene contains the nucleotide sequence shown in the forward primer SEQ ID NO:5 and the nucleotide sequence shown in the reverse primer SEQ ID NO:

6.

4. The application as described in any one of claims 1-3, characterized in that, The product is a reagent kit or a biochip.

5. The application as described in any one of claims 1-3, characterized in that, The detection was performed using qRT-PCR.