Application of RNF187 as target in diagnosis and treatment of prostatic cancer

Abstract

The invention relates to the technical field of biological medicine, in particular to application of RNF187 serving as a target spot in diagnosis and treatment of prostatic cancer, solves the technical problems that in the prior art, prostatic cancer pathogenesis factors are not clear, and prostatic cancer is difficult to prevent in advance, and provides a gene target spot highly related to prostatic cancer occurrence and development. The RNF187 is taken as a marker and can be used for effectively predicting the occurrence and development processes of prostatic cancer diseases, so that high-incidence people of prostatic cancer are screened out, reasonable prevention in advance is carried out, the occurrence probability and severity of diseases are remarkably reduced, and damage to human health is reduced; and practical theoretical basis and basis can be provided for clinical prostate cancer prevention, diagnosis, treatment and prognosis evaluation.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of RNF187 as a target in the diagnosis and treatment of prostate cancer. Background Technology

[0002] Prostate cancer (PCa) is a common malignant tumor worldwide, and the second most common malignant tumor in men. It accounts for 7.3% of new cases and 3.8% of deaths from all cancer types annually. PCa not only poses a significant threat to men's health but also imposes a substantial economic burden on society. Although there are various treatment options available for prostate cancer, such as radical prostatectomy (RP), androgen deprivation therapy, radiation therapy, endocrine therapy, and immunotherapy, the high heterogeneity of prostate cancer means that current clinical indicators such as serum prostate-specific antigen (PSA), Gleason score, and tumor staging are insufficient to meet the needs of individualized treatment in modern medicine. This often leads to undertreatment or overtreatment. Therefore, a deeper investigation into the heterogeneity of prostate cancer is urgently needed.

[0003] Because early symptoms of prostate cancer are often subtle and there is a lack of reliable biomarkers for early diagnosis, most prostate cancer patients are already in advanced stages when they seek medical attention. Despite aggressive and systematic treatment for these patients, the 5-year overall survival rate remains unsatisfactory. Therefore, there is an urgent need to further explore the precise mechanisms of prostate cancer development and progression in order to identify new biomarkers for diagnosis and prognosis, as well as potential therapeutic targets.

[0004] Protein ubiquitination is a ubiquitous form of post-translational modification (PTM) formed through a three-enzyme cascade reaction: ubiquitin activator 1 (E1), ubiquitin activator 2 (E2), and ubiquitin ligase 3 (E3). E3 ligases participate in the final step of the ubiquitination cascade by specifically binding to substrate proteins, guiding ubiquitin to lysine residues of target proteins, thereby regulating many cellular processes such as protein degradation, DNA repair, and signal transduction. Currently, E3 ligases are receiving increasing attention due to their ability to regulate protein stability and function, and based on this, some targets and methods for anti-tumor therapy have been explored, such as the PROTAC (Proteolytic Target Chip) technology. Numerous studies have shown that dysfunction of the ubiquitin-proteasome system (UPS) is closely related to the progression and metastasis of prostate cancer. RNF187, also known as RING domain AP-1 co-activator-1 (RACO-1), is a ubiquitin E3 ligase containing a RING domain. RNF187, another member of the E3 family containing the RING finger domain, is a c-Jun coactivator of growth factor signaling and is crucial for the function of AP-1 in cell proliferation. The interaction between RNF187 and c-Jun is necessary and sufficient for the activation of c-Jun / AP-1, thereby promoting cell proliferation and tumorigenesis.

[0005] Therefore, there is an urgent clinical need to develop an LncRNA molecular tag kit for assessing the prognosis of prostate cancer patients. Summary of the Invention

[0006] To address the technical challenges of unclear molecular mechanisms of cancer proliferation and metastasis, particularly prostate cancer, and the lack of effective treatments in existing technologies, this study investigated the progression mechanism of prostate cancer and provided a novel approach for prevention, treatment, and prognostic assessment.

[0007] To solve the above-mentioned technical problems, the present invention is achieved through the following technical solution.

[0008] In a first aspect, the present invention provides the use of an RNF187 inhibitor in the preparation of a medicament for the prevention and / or treatment of prostate cancer.

[0009] Preferably, the RNF187 inhibitor is selected from nucleic acid molecules that downregulate the expression level of RNF187.

[0010] Preferably, the nucleic acid molecule is selected from one or more of siRNA, shRNA, antisense oligonucleotides, shRNA, sgRNA, antagomiRs, miRNA sponges, and miRNA Erasers.

[0011] Preferably, the RNF187 inhibitor is selected from siRNA designed based on the RNF187 gene.

[0012] Preferably, the shRNA designed based on the RNF187 gene is selected from one or more of sh-A, sh-B, and sh-C, wherein the sequence of sh-A is GGTCTGTGGAAATCATGAGAA, the sequence of sh-B is GCACTGACCGACTACAAGAAG, and the sequence of sh-C is GGAGAAGAAGCATCGCAACCT.

[0013] It should be understood that, unless otherwise specified, in the context of this invention, the RNF187 inhibitor refers to a substance capable of specifically downregulating the expression level of RNF187 and / or the transcriptional level of its mature mRNA and / or the expression level or activity of the RNF187 protein. For example, methods such as antisense oligonucleotides, siRNA, shRNA, sgRNA, antagomiRs, miRNA sponges, miRNA erasers, target masking, and / or multiple targets can be used to downregulate the expression level and / or activity of RNF187. Any method that can reduce the level and / or activity of RNF187 is acceptable.

[0014] In a second aspect, the present invention provides a pharmaceutical composition for the prevention and / or treatment of prostate cancer, comprising an RNF187 inhibitor.

[0015] Preferably, the RNF187 inhibitor is selected from nucleic acid molecules that downregulate the expression level of RNF187.

[0016] Preferably, the nucleic acid molecule is selected from one or more of siRNA, shRNA, antisense oligonucleotides, shRNA, sgRNA, antagomiRs, miRNA sponges, and miRNA Erasers.

[0017] Preferably, the shRNA designed based on the RNF187 gene is selected from one or more of sh-A, sh-B, and sh-C, wherein the sequence of sh-A is GGTCTGTGGAAATCATGAGAA, the sequence of sh-B is GCACTGACCGACTACAAGAAG, and the sequence of sh-C is GGAGAAGAAGCATCGCAACCT.

[0018] In a third aspect, the present invention provides the use of a reagent for detecting RNF187 expression levels in the preparation of products for the auxiliary diagnosis and / or prognostic assessment of prostate cancer.

[0019] Preferably, the reagents for detecting RNF187 expression levels include primer pairs or probes for detecting RNF187 gene expression levels.

[0020] Preferably, the shRNA designed based on the RNF187 gene is selected from one or more of sh-A, sh-B, and sh-C, wherein the sequence of sh-A is GGTCTGTGGAAATCATGAGAA, the sequence of sh-B is GCACTGACCGACTACAAGAAG, and the sequence of sh-C is GGAGAAGAAGCATCGCAACCT.

[0021] The beneficial effects of this invention are as follows: Because current technologies do not fully clarify the pathogenic factors of prostate cancer, and research on the role and impact of E3 ligase in the prevention, treatment, and prognosis of prostate cancer is scarce, effective clinical treatments are lacking. Analyzing lncRNAs in prostate cancer patients and healthy individuals to identify key mRNA targets related to the occurrence and development of prostate cancer is of paramount importance. This will provide a solid theoretical basis for the clinical prevention, diagnosis, treatment, and prognostic assessment of prostate cancer.

[0022] Studies have shown that RNF187 expression is significantly upregulated in prostate cancer and is a predictor of poor prognosis in prostate cancer patients. Furthermore, inhibiting RNF187 significantly suppresses the proliferation and migration of prostate cancer cells both in vitro and in vivo. Clinical sample analysis indicates a positive correlation between RNF187 expression levels and Gleason scores.

[0023] This invention addresses the technical challenges of unclear pathogenic factors and difficulty in early prevention of prostate cancer in existing technologies, providing a gene target, RNF187, that is highly correlated with the occurrence and development of prostate cancer. By using RNF187 as a biomarker, the development and progression of prostate cancer can be effectively predicted, thereby identifying high-risk groups for early prevention, significantly reducing the probability and severity of the disease, and minimizing harm to human health. Attached Figure Description

[0024] Figure 1 This is a comparison of BCR-free survival rates between patients with Gleason scores >= 7 and those with high and low RNF187 expression. Figure 2 This is a comparison of BCR-free survival rates between the high-expression and low-expression RNF187 groups with a Gleason score <7. Figure 3This is a schematic diagram of RNF187 staining on a clinicopathological sample of the prostate gland. Figure 4 The pathological sections of prostate cancer were stained with RNF187 and then scored using immunohistochemistry. Figure 1 ; Figure 5 The pathological sections of prostate cancer were stained with RNF187 and then scored using immunohistochemistry. Figure 2 ; Figure 6 This is a schematic diagram illustrating the expression level of RNF187 in six prostate cell lines as detected by qPCR. Figure 7 This is a schematic diagram illustrating the overexpression of RNF187 in C4-2 and PC-3 cells using a lentiviral vector. Figure 8 This is a schematic diagram showing the expression level of RNF187 in DU145 cells after lentiviral transfection. Figure 9 This is a schematic diagram illustrating the effect of shRNA targeting RNF187 on the proliferation of prostate cancer cells. Figure 10 This is a schematic diagram illustrating the effect of shRNA targeting RNF187 on prostate cancer cell colony formation. Figure 11 This is a schematic diagram illustrating the effect of shRNA targeting RNF187 on the migration of prostate cancer cells. Figure 12 This is a statistical diagram illustrating the inhibition of intracellular RNF187 expression levels using shRNA; Figure 13 This is a schematic diagram showing the spheroidization rate of cells overexpressing RNF187; Figure 14 This is a schematic diagram illustrating the effect of RNF187 expression inhibition on tumor progression. Figure 15 This is a live imaging image of subcutaneous tumors in mice from the sh-NC group treated with substrate D-fluorescein. Figure 16 This is a schematic diagram of the fluorescence intensity of subcutaneous tumors in mice in the sh-NC group treated with substrate D-fluorescein; Figure 17 These are before-and-after images of mice after being euthanized by cervical dislocation. Figure 18 yes Figure 17 Comparison of the size of subcutaneous tumor masses removed from mice; Figure 19 yes Figure 18 Comparison of tumor mass weights. Detailed Implementation

[0025] This section will describe in detail the specific embodiments of this application. Preferred embodiments of this application are shown in the accompanying drawings. The purpose of the drawings is to supplement the textual description with graphics, so as to intuitively and vividly understand each technical feature and overall technical solution of this application, but they should not be construed as limiting the scope of protection of this application.

[0026] Furthermore, unless otherwise defined, the technical and scientific terms used in this application have the same meanings as commonly understood by one of ordinary skill in the art. The terminology used in this application is for the purpose of describing particular embodiments only and not for limiting the application. It should be understood that, when used in this specification and the appended claims, the terms "comprising" and "including" indicate the presence of the described features, integrals, steps, operations, elements, and / or components, but do not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or collections thereof.

[0027] Unless otherwise specified, all reagents used in this invention were commercially available. Prostate cancer cell lines DU145, PC-3, 22Rv1, C4-2, and LnCap were purchased from the China Cell Bank. 22Rv1 and C4-2 were cultured in RPMI-1640 medium; DU145 and PC-3 were cultured in DMEM medium. Both media were supplemented with 10% fetal bovine serum and 1% dual antibiotics (penicillin and streptomycin). All cell lines were cultured at 37°C in a 5% CO2 incubator. Clinical samples were obtained from Guangzhou First People's Hospital. Informed consent was obtained from patients for all clinical sample use, and the relevant procedures and methods complied with medical ethics requirements and Good Clinical Practice (GCP) guidelines. The experimental methods used in this invention, such as molecular biology experiments, cell experiments, model construction, bioinformatics analysis, and immunohistochemistry, are all conventional methods and techniques in the field.

[0028] Representative results from biological experiments were selected from replicates and presented in contextual figures, with data displayed as mean ± SD and mean ± SEM as specified in the figures. All experiments were repeated at least three times. Statistical analysis and visualization of the data were performed using R software (version 4.1.0) and GraphPad Prism 8.0. Pearson and Spearman correlation analyses were used to calculate correlation coefficients. Wilcoxon rank-sum tests or Student's t-tests were used to compare differences between two continuous variables, while chi-square tests or Fisher's exact tests were used for comparisons between categorical variables. p < 0.05 was considered a significant difference.

[0029] Example 1: Evaluating the prognostic value of RNF187 To assess the prognostic value of RNF187, samples from three databases—CancerMap, DKFC, and GSE54460—were used as the study subjects. The Log-rank test (Mantel-Cox) was used to analyze the survival prognosis of RNF187 expression. Based on the median value of RNF187 expression, PCa patients were divided into two subgroups: a high RNF187 expression group and a low RNF187 expression group. Figure 1 As shown, among the 354 patients with a Gleason score >= 7, the BCR-free survival rate was significantly worse in the RNF187 high expression group than in the RNF187 low expression group (p < 0.0001). See the results below. Figure 1 ;like Figure 2 As shown, among the 84 patients with a Gleason score < 7, there was no statistically significant difference in BCR-free survival between the RNF187 high expression group and the RNF187 low expression group.

[0030] RNF187 staining was performed on clinicopathological samples of the prostate gland, and the results are as follows: Figure 3 As shown in Table 1, RNF187 expression was low in normal prostate tissue pathological sections, but significantly increased in prostate cancer pathological sections with a Gleason score >= 4+3. To further clarify the expression of RNF187 in prostate cancer with Gleason scores >= 4+3 and <= 3+4, 118 cases were selected. RNF187 staining was performed on prostate cancer pathological sections, and immunohistochemical scoring (IHC) was conducted. The results are shown in Table 1. Figure 4 , Figure 5 As shown in the figure. The results showed that in prostate cancer pathological sections, the expression level of RNF187 in the cancerous area was significantly higher than that in the normal glandular area; in addition, the expression level of RNF187 in the Gleason score>=3+4 was significantly higher than that in the Gleason score<=3+4.

[0031] Table 1 The above studies clearly demonstrate that RNF187 can serve as a key indicator for assessing the prognosis of BCR in intermediate and advanced prostate cancer, and that the expression level of RNF187 is positively correlated with the Gleason score to some extent.

[0032] Example 2: Expression in prostate cancer cells To determine the potential role of RNF187 in in vitro and in vivo prostate cell lines (PCa), the expression level of RNF187 in six prostate cell lines was first detected by qPCR. The results are shown below. Figure 6 As shown in the figure. The results showed that RNF187 was expressed at low levels in normal prostate tissue cells, but significantly at high levels in other prostate cancer cells (**p<0.01, ***p<0.001). Among the six prostate cancer cell lines, 22Rv1 and DU145 cells showed very significant high levels of RNF187 expression, while C4-2 and PC-3 cells showed relatively low levels. Therefore, shRNAs were designed based on the RNF187 sequence: sh-1 (GGTCTGTGGAAATCATGAGAA), sh-2 (GCACTGACCGACTACAAGAAG), and sh-3 (GGAGAAGAAGCATCGCAACCT). These shRNAs were transfected into 22Rv1 and DU145 cells to silence RNF187 expression, with sh-NC (empty vector) used as a negative control. Simultaneously, lentiviral vectors were used to overexpress RNF187 in C4-2 and PC-3 cells, with oe-NC (empty vector) used as a negative control. Figure 7 As shown, the results indicate that sh-C1, sh-C3, and sh-C3 can all significantly and successfully inhibit the expression of RNF187 and reduce the intracellular level of RNF187, with sh-C1 showing the most significant inhibitory effect; Figure 8 As shown, the expression level of RNF187 in DU145 cells transfected with lentivirus was significantly increased.

[0033] Example 3: Effects of RNF187 on the behavior and function of prostate cancer in vitro As can be anticipated from the foregoing embodiments, RNF187 may have a certain promoting effect on the progression of prostate cancer, that is, RNF187 plays the role of a tumor-promoting factor in the progression of prostate cancer. To verify this conclusion, a series of in vitro experiments were conducted to support this finding.

[0034] The effects of shRNA targeting RNF187 on the proliferation of prostate cancer cells were investigated by designing the following steps: (1) Transfect shRNA (sh-C1) targeting RNF187 into DU145 cells; (2) When the cells grow to the logarithmic phase, trypsin digests and counts them. Select the appropriate cell density according to the doubling time of various cells and seed them into 96-well plates (3 replicates). (3) Incubate at 37℃, and culture at 12h, 24h, 48h, 60h, and 72h respectively using CCK-8: culture medium. The culture medium containing CCK-8 was added in a certain proportion, and the culture plate was incubated in an incubator for 2 hours. The absorbance at 450 nm was measured to assess the cell proliferation status.

[0035] The results are as follows Figure 9 As shown in the figure. The results showed that silencing RNF187 with shRNA significantly reduced the proliferation ability of prostate cancer cells, significantly inhibited the growth of prostate cancer cells, and significantly reduced the proliferative activity of prostate cancer cells, with statistically significant differences (*p<0.05).

[0036] Subsequently, the effect of shRNA targeting RNF187 on prostate cancer cell clonogenesis was investigated, and the specific steps are as follows: (1) The shRNA (sh-C1) targeting RNF187 was transfected into 22Rv1 and DU145 cells, respectively; (2) When the cells grow to the logarithmic phase, digest them with trypsin and count them. Select the appropriate cell density according to the doubling time of various cells, seed them into a six-well plate containing 2 mL of 37℃ pre-warmed culture medium, and gently shake them back and forth and left and right to disperse the cells evenly. Place them in a cell culture incubator containing 5% CO2 at 37℃ for culture. (3) When visible clones appear in the culture dish, stop the culture, discard the supernatant, carefully wash twice with PBS, add 1 mL of methanol containing 0.5% crystal violet to each well, stain for 30 min; discard the methanol, wash off the residual methanol with water; cell clones can then be observed; observe under a microscope.

[0037] Test results as follows Figure 10 As shown in the figure. The results showed that, compared with the blank vector sh-NC group, silencing RNF187 with shRNA significantly reduced the clonogenic ability of prostate cancer cells and significantly inhibited the clonogenic formation of prostate cancer cells, with statistically significant differences (**p<0.01, ***p<0.001).

[0038] Furthermore, the effect of shRNA targeting RNF187 on the migration of prostate cancer cells was investigated, and the specific steps are as follows: (1) The cells are arranged at an appropriate density (e.g., 2 × 10⁻⁶). 5 (1 cell / well) is seeded into a 24-well plate or other culture plate and cultured until the cells completely merge to form a continuous monolayer of cells; (2) Use the tip of a sterile plastic micropipette to draw a straight line in the cell monolayer to create a “wound”, and then wash the monolayer cells with PBS to remove detached cells and debris. (3) Add 2% fetal bovine serum (FBS) to 1640 medium and take pictures of the same area of ​​the scratch at 0, 12, 24, 36 and 48 hours after scratching using an inverted microscope. (4) Use ImageJ to measure the distance between the two edges of the scratch or the wound area, compare the changes in wound area at different time points, and calculate the cell migration rate.

[0039] Test results as follows Figure 11 As shown in the figure. The results showed that, for DU145 cells, compared with the blank vector sh-NC group, inhibiting the expression level of intracellular RNF187 with shRNA significantly suppressed the migration ability of prostate cancer cells, and the difference was statistically significant (**p<0.01, ***p<0.001, ***p<0.001). Figure 12 ).

[0040] Subsequently, PC-3 and Lncap cells were transfected using the lentiviral transfection method described in Example 2 to construct a stable transfected cell line overexpressing RNF187. The results showed that the expression level of RNF187 in PC-3 and Lncap cells was significantly increased after lentiviral transfection. Single-cell pellet culture was then performed for 7 days using a microfluidic single-cell culture chip system, with the specific steps as follows: (1) Inject a single-cell suspension into the cell culture area of ​​the microfluidic chip. The flow rate of the cell suspension can be controlled using an injection pump to ensure uniform cell distribution; (2) Place the chip in a cell culture incubator for 20-30 minutes to allow the cells to attach to the chip; (3) Remove the chip, carefully remove the culture medium, and gently rinse the chip with fresh culture medium or PBS to remove excess cells; (4) Cover the patterned microarray of the chip with hydrogel, keep it in a cell culture incubator for 10-15 minutes, and after the hydrogel has slightly solidified, place it in a complete culture medium for culture. (5) Use a microfluidic system to perfuse fresh culture medium into the chip in real time, adjust the perfusing frequency and speed, and replace the culture medium every 4 hours; (6) Regularly use an inverted microscope to observe the growth status and spheroid formation of cells, and record information such as cell morphological changes, spheroid size and number.

[0041] The results are as follows Figure 13 As shown, cells overexpressing RNF187 showed a significantly increased spheroidization rate, faster tumor spheroid growth, and larger spheroid diameter.

[0042] The above results clearly demonstrate that RNF187 has a significant impact on the functional activity of prostate cancer cells. Inhibiting RNF187 expression effectively suppresses prostate cancer proliferation, clonal expansion, and metastasis, while overexpression of RNF187 significantly promotes prostate cancer proliferation and spheroidization. Therefore, RNF187 is a key target closely related to prostate cancer progression, and intervention in its expression can effectively inhibit these processes.

[0043] Example 4: Effects of RNF187 on prostate cancer behavior and function in vivo To investigate the effect of RNF187 on prostate cancer in vivo, 4-week-old BALB / c-nu mice were selected for in vivo experiments. The specific steps are as follows: (1) The day before the experiment, the pre-packaged Matrigel was placed in a 4°C refrigerator overnight at 20°C to melt from a solid state to a liquid state. (2) Sixteen 4-week-old BALB / c-nu mice were randomly divided into two groups, referred to as group 1 and group 2. Prostate cancer cells with RNF187 upregulated or RNF187 silenced mixed with Matrigel were subcutaneously injected into the back of the mice. Group 1 mice were subcutaneously injected with DU145 cells with RNF187 expression inhibition, and group 2 mice were subcutaneously injected with DU-145 cells containing sh-NC as a negative control. (3) Observe the growth and mental condition of mice daily. After 7 days of injection, measure the tumor size of each group of mice every 3 days and calculate the tumor volume. The tumor volume is calculated using the following formula: ; (4) On day 45, the mice were fasted for 6 hours to reduce background interference caused by gastrointestinal food. They were anesthetized with isoflurane gas using the gas anesthesia system of the in vivo imaging instrument, and the substrate D-fluorescein was injected intraperitoneally at a dose of 150 mg / kg body weight. Imaging was performed about 10-15 minutes after injection. (5) The mice were euthanized by dissecting their necks. The tumors of each group of mice were removed, photographed and their volume was measured. The organs were made into pathological specimens for H&E staining and immunohistochemical analysis.

[0044] Experimental results are as follows Figures 14-19 As shown in the figure. The results indicate that inhibiting the expression of RNF187 effectively inhibited tumor progression ( Figure 14 The tumor volume difference between the sh-NC group and the shRNA-RNF187 group was statistically significant (p<0.0001). In vivo imaging ( Figure 15 The results showed that the fluorescence intensity of subcutaneous tumors in mice treated with the substrate D-luciferin was significantly higher than that in the shRNA-RNF187 group. Figure 16 The mice were euthanized by cervical dislocation. Figure 17 Subcutaneous tumors were removed one by one, and the size of the prostate cancer clusters in the shRNA-RNF187 group was observed ( Figure 18 ) and weight ( Figure 19 It is significantly smaller than sh-NC.

[0045] In summary, this invention provides an in-depth study of the functional role of RNF187 in the progression of prostate cancer, clarifying its influence on the proliferation and migration of prostate cancer cells. This invention offers a novel explanation of the progression mechanism of prostate cancer, providing new insights for subsequent drug development, clinical diagnosis, and treatment, and possesses significant social and market potential.

[0046] The above description is merely a specific embodiment of this application, but the scope of protection of this application is not limited thereto. Any person skilled in the art can easily conceive of various equivalent modifications or substitutions within the technical scope disclosed in this application, and these modifications or substitutions should all be covered within the scope of protection of this application. Therefore, the scope of protection of this application should be determined by the scope of the claims.

Claims

1. Application of RNF187 as a target in the diagnosis and treatment of prostate cancer.

2. The application of RNF187 as a target in the diagnosis and treatment of prostate cancer according to claim 1, characterized in that: The RNF187 inhibitor is selected from nucleic acid molecules that downregulate the expression level of RNF187.

3. The application of RNF187 as a target in the diagnosis and treatment of prostate cancer according to claim 2, characterized in that: The nucleic acid molecule is selected from one or more of siRNA, shRNA, antisense oligonucleotides, shRNA, sgRNA, antagomiRs, miRNA sponges, and miRNA Erasers.

4. The application of RNF187 as a target in the diagnosis and treatment of prostate cancer according to claim 3, characterized in that: The shRNA is selected from one or more of sh-A, sh-B, and sh-C.

5. A pharmaceutical composition for the prevention and / or treatment of prostate cancer, characterized in that, Including RNF187 inhibitors.

6. A pharmaceutical composition for the prevention and / or treatment of prostate cancer according to claim 5, characterized in that: The RNF187 inhibitor is selected from nucleic acid molecules that downregulate the expression level of RNF187.

7. A pharmaceutical composition for the prevention and / or treatment of prostate cancer according to claim 6, characterized in that: The nucleic acid molecule is selected from one or more of siRNA, shRNA, antisense oligonucleotides, shRNA, sgRNA, antagomiRs, miRNA sponges, and miRNA Erasers.

8. A pharmaceutical composition for the prevention and / or treatment of prostate cancer according to claim 7: characterized in that, The shRNA is selected from one or more of sh-A, sh-B, and sh-C.

9. Application of reagents for detecting RNF187 expression levels in the preparation of products for prostate auxiliary diagnosis and / or prognostic assessment.

10. The application according to claim 9, characterized in that the reagent for detecting the expression level of RNF187 includes primer pairs or probes for detecting the expression level of the RNF187 gene.

Images