Alcohol beverage with high fruit aroma volatile compound content and low volatile acidity and preparation method thereof

Abstract

The present invention relates to alcoholic beverages having a good content of fruity volatile compounds and having a lower volatile acidity, in particular benefited from a fermentation process using the Selberdnner's yeast, preferably a SPACE strain, and the use of such a yeast as a food inoculum.

Description

[0001] illustrate Technical Field

[0002] This invention belongs to the field of food and beverages, specifically relating to alcoholic beverages, wherein the beverage has a high content of fruity volatile compounds and low volatile acidity, especially benefiting from the use of Saturn-shaped Saccharomyces cerevisiae (Saccharomyces cerevisiae). Cyberlindnera saturnus Fermentation methods using SPACE strains are preferred, as are the uses of such yeasts as food inoculants. Background Technology

[0003] In the production of alcoholic beverages (such as wine or beer), the use of microbial starters is a fundamental practice that controls and guides the fermentation process.

[0004] Microbial starter cultures refer to yeast strains possessing physiological, biochemical, and brewing characteristics optimized according to the technical requirements of pure fermentation methods (Pretorius, 2000), or if non-yeast species are involved. Saccharomyces If yeast is used, it should be inoculated sequentially.

[0005] Using selected yeasts ensures a rapid start to fermentation because the quality and quantity of yeast added to the must are carefully chosen; this allows operators better control over the fermentation process, choosing how fermentation should proceed, rather than relying on naturally occurring yeasts in the grapes that are not always of good quality; it reduces the problems of fermentation cessation or slowing down that are characteristic of spontaneous fermentation; it achieves a good yield of sugar to alcohol conversion; it reduces and prevents any damage caused by microbial contaminants (such as acetic acid bacteria); it reduces or eliminates abnormal sensory characteristics; and, equally importantly, it helps to standardize the production of a given wine, making it recognizable to consumers year after year (Fleet and Heard, 1993).

[0006] Specifically, microbial fermentation agents, especially appropriately selected yeasts, are added to the inoculum and used during fermentation to improve the sensory quality of the resulting wine or beer.

[0007] The selection of yeasts to be used as fermentation agents in winemaking typically involves isolating yeasts from grape must or grapes, identifying the yeast species (preferably the yeast genus), and, most importantly, characterizing them based on a range of process- and winemaking-related properties. Process properties refer to those related to the yeast's fermentation activity (e.g., fermentation vigor, absolute alcohol content, fermentation start-up rate), while winemaking properties include those that contribute to the aroma and overall sensory quality of the wine. The latter includes low acetic acid yield and high aroma potential in the finished wine.

[0008] The difference is that the choice of yeast in beer production depends on the fermentation capacity of maltose, fermentation activity, and the ability to release the required volatile compounds.

[0009] Acetic acid produced during sugar metabolism is an undesirable characteristic of alcoholic fermenting yeasts; this characteristic varies depending on the yeast species and strain. The amount of acetic acid produced by the yeast used in alcoholic fermentation should not exceed 0.4 g / L.

[0010] Scientific research on the application of non-yeast yeasts in winemaking and beer production is increasing, primarily because non-brewing yeasts can influence the sensory characteristics (color, aroma, body, and structure) of wines and beers, and meet the demand for product diversification. Notably, the market trend is towards aromatic wines and beers.

[0011] The main limitation of non-yeast yeasts is that, in most cases, due to their low tolerance to alcohol, weak fermentation capacity, and the occasional production of undesirable secondary compounds (such as acetic acid, 4-ethylphenol, etc.), they must be co-fermented or sequentially inoculated with other brewing yeasts to complete sugar metabolism.

[0012] To date, only a very small number of non-Saccharomyces yeasts have been propagated and sold as microbial starters for alcoholic fermentation. Summary of the Invention

[0013] The problem this invention aims to solve is to provide a method for preparing alcoholic beverages with high content of fruity volatile compounds and low volatile acidity using non-yeast species. Specifically, it is a method for preparing alcoholic beverages with higher content of isoamyl acetate, β-phenylethyl, ethyl butyrate, isobutyl acetate, and butyric acid using non-yeast species.

[0014] Therefore, the present invention solves the above-mentioned problems by means of a fermentation process characterized by the presence of Saturn-shaped Saccharomyces cerevisiae, as described in the appended claims, the definition of which forms part of this specification.

[0015] Another aspect of the invention relates to food inoculum containing Saturn-shaped Saccharomyces cerevisiae and its use in the preparation of alcoholic beverages.

[0016] In addition, Saturn-shaped Saccharomyces cerevisiae can be used as a probiotic or food supplement in food.

[0017] Another aspect of the invention relates to alcoholic beverages or alcoholic fermented grape must containing Saturnian Cyberlindnerella vaginalis.

[0018] Other features and advantages of the invention will become apparent from the description of embodiments intended to illustrate the invention itself. Attached Figure Description

[0019] Figure 1 Colonies of *Saturnella sabrina* SPACE strain grown on WL agar plates after 3 days (a) and 7 days (b) of aerobic culture at 30°C are shown.

[0020] Figure 2 The image shows the Saturn-shaped Saccharomyces cerevisiae SPACE strain under an electron microscope.

[0021] Figure 3 The gene sequence SEQ_ID_1 of the Saturn-shaped Saccharomyces cerevisiae SPACE strain is shown, which has 99.82% similarity to the Saturn-shaped Saccharomyces cerevisiae CBS 254ITS strain.

[0022] Figure 4 The analysis of the RAPD R3 profile of the SPACE strain using Bionumerics software and its comparison with a reference strain belonging to *Saccharomyces cerevisiae* (previously sequenced) in the applicant's BEP2P database showed a similarity of 96%, thus confirming its species classification.

[0023] Figure 5 The analysis of the RAPD M13 profile of the SPACE strain using Bionumerics software and its comparison with the Saturn-shaped Saccharomyces cerevisiae strain in the BEP2P database showed a similarity of 95%, thus confirming its species classification.

[0024] Figure 6 Capillary electrophoresis results of the amplified ITS fragments and RFLP analysis using restriction endonucleases HhaI and HinfI are shown. Additionally, a comparison is shown between the SPACE strain and a reference strain (previously sequenced) belonging to *Saccharomyces cerevisiae* from the applicant's BEP2P database. The sizes of each fragment are indicated at the bottom of the table. The consistent size of the fragments confirms their belonging to the same species.

[0025] Figure 7 The comparison of colonies of *Saccharomyces cerevisiae* SPACE strain (a) with non-H2S-producing yeast (b) on lead acetate agar medium after incubation at 30°C for 5 days is shown.

[0026] Figure 8 The fermentation process of *Saccharomyces cerevisiae* SPACE strain and commercial strain 1H is shown in Prosecco grape must test 1.

[0027] Figure 9The fermentation process of *Saccharomyces cerevisiae* SPACE strain and commercial strain 1H is shown in Prosecco grape must test 2.

[0028] Figure 10 The fermentation process of Saturnian Cyberlindnerella vaginalis SPACE strain (square) 40 g / HL, (triangular) 20 g / HL and commercial strain 1H are shown in Prosecco grape must test 3 (20 g / HL yeast is sufficient as inoculum).

[0029] Figure 11 The fermentation process of *Saccharomyces cerevisiae* SPACE strain and commercial strain 1H was shown in Prosecco grape must test 4, with the commercial strain being inoculated at approximately day 3. Arrows indicate the time of inoculation with the commercial strain.

[0030] Figure 12 The diagram illustrates the fermentation process of sequential fermentation of *Saccharomyces cerevisiae* SPACE strain and commercial strain 1H in Prosecco must test 5, with the commercial strain inoculated at approximately day 9. Curves extending to approximately 250 hours represent tests using only non-yeast yeasts; curves extending to approximately 500 hours represent parallel tests with sequential inoculation. Arrows indicate the time of inoculation with the commercial strain.

[0031] Figure 13 Table 4 shows the volatile compounds that were detected or not detected in the analyzed samples and compares non-yeast yeasts with yeast of commercial strain 1H (blank sample).

[0032] Figure 14 Table 5 shows the fermentation parameters obtained from the sequential inoculation of beer samples with Saturnian Cyberlindnerella vaginalis SPACE strain, ALE 05, Green Mountain strain, and ALE LN3 strain, and compared with beer obtained by using ALE 05 strain, ALE LN3 strain, Green Mountain strain, and SPACE strain of yeast individually. Detailed Implementation

[0033] For the purposes of this document, the term “and / or” when used in a list of two or more items means that any one of the listed items may be used alone or in any combination of two or more listed items.

[0034] For example, if the composition is described as containing components A, B and / or C, or A and / or B and / or C, then the composition may contain only A; only B; only C; a combination of A and B; a combination of A and C; a combination of B and C; or a combination of A, B and C.

[0035] The terms “comprising,” “including,” or any other variations are intended to cover non-exclusive inclusion, so that a system, method, use, etc., that comprises a series of elements may include not only those elements but also other elements not expressly listed or inherent to such system, method, use, etc.

[0036] The phrase “comprising…a…” following an element does not preclude the presence of other identical elements in the system, method, or purpose without further restrictions.

[0037] Therefore, the object of the present invention is to provide a method for preparing an alcoholic beverage, the method comprising a fermentation step, characterized in that the step is carried out in the presence of *Saturnella sacchariformis*.

[0038] In fact, surprisingly, the use of Saturn-shaped Cyberlindnerella vaginalis during the alcoholic fermentation stage produces good levels of fruity volatile compounds and low volatile acidity, such as increased levels of certain varietal compounds, specifically isoamyl acetate, β-phenylethyl and ethyl butyrate, thereby improving and / or enhancing the aroma and flavor of some alcoholic beverages.

[0039] The study also showed that the fermentation kinetics of the yeast described in this invention differ from those of the standard yeast strain, and the fermentation rate is slower. This different fermentation kinetics also allows the yeast of this invention to produce a higher content of fruity volatile compounds, while exhibiting lower volatile acidity compared to the standard yeast used for alcoholic fermentation.

[0040] Fermentation is a process that aims to convert substances into ethanol and carbon dioxide. Yeast-initiated fermentation is widely used in various fields such as pharmaceuticals and food (e.g., wine production).

[0041] Saturn-shaped Saccharindnae is a non-Saccharomyces cerevisiae species belonging to the Saturn-shaped Saccharindnae spp. It can produce methyl salicylate, isobutyl acetate, isoamyl acetate, β-phenylethyl acetate, ethyl butyrate, butyric acid, and low concentrations of acetic acid.

[0042] According to a preferred embodiment of the present invention, the *Saturnella sacchariformis* strain is the SPACE strain.

[0043] A strain refers to a pure population of laboratory cells (molds, fungi, etc.) of the same species. These cells originate from a single progenitor cell and carry one or more specific genetic characteristics.

[0044] The Saturn-shaped Saccharomyces cerevisiae SPACE strain was isolated and identified, as detailed in Example 1.

[0045] The Saturn-shaped Saccharomyces cerevisiae SPACE strain has the gene sequence shown at the end of Example 5.

[0046] According to a preferred embodiment of the present invention, the alcoholic beverage is wine, beer, cider, or mead.

[0047] According to a more preferred embodiment of the present invention, the alcoholic beverage is wine, cider, or mead.

[0048] According to an even more preferred embodiment of the present invention, the alcoholic beverage is wine.

[0049] According to a preferred embodiment of the present invention, the method includes a pre-preparation step of a food inoculum, which will be described in more detail in the following paragraphs.

[0050] Inoculum preparation involves inoculating 10% of grape must with yeast cream of *Saccharomyces cerevisiae* SPACE strain, stirring for 3–4 hours, and then subsequently inoculating the remaining grape must. An amino acid source (such as Lysopol and / or Probios produced by the applicant) must be added to the grape must.

[0051] According to a preferred embodiment of the present invention, the method includes a subsequent step in which yeast of the genus *Saccharomyces* is added.

[0052] The next step of adding yeast can optimize the entire fermentation process.

[0053] Another object of the present invention is a food inoculum containing Saturn-shaped Saccharomyces cerevisiae.

[0054] According to a preferred embodiment of the present invention, the *Saturnella sacchariformis* strain is the SPACE strain.

[0055] Another object of the present invention is an alcoholic beverage or alcoholic fermented grape must containing *Saccharomyces cerevisiae*, preferably wherein the *Saccharomyces cerevisiae* strain is SPACE.

[0056] Preferably, the alcoholic beverage or alcoholic fermented grape must contains *Saccharomyces cerevisiae*, more preferably, wherein the *Saccharomyces cerevisiae* strain is SPACE strain, and the alcoholic beverage or alcoholic fermented grape must is wine, cider, or mead.

[0057] Another object of the present invention is an alcoholic beverage or alcoholic fermented grape must comprising: 1 to 7 mg / L isoamyl acetate and / or 0.5 to 4 mg / L β-phenylethyl and / or 0.05 to 0.3 mg / L ethyl butyrate.

[0058] According to a preferred embodiment of the present invention, the alcoholic beverage is an alcoholic beverage or alcoholic fermented grape must, comprising: 1 to 7 mg / L isoamyl acetate and 0.5 to 4 mg / L β-phenylethyl and / or 0.05 to 0.3 mg / L ethyl butyrate.

[0059] According to a preferred embodiment of the present invention, the alcoholic beverage is an alcoholic beverage or alcoholic fermented grape must, comprising: 1 to 7 mg / L isoamyl acetate and 0.5 to 4 mg / L β-phenylethyl and / or 0.05 to 0.3 mg / L ethyl butyrate; wherein the alcoholic beverage is wine, cider, or mead.

[0060] According to a preferred embodiment of the present invention, the alcoholic beverage is wine, which contains: 1 to 7 mg / L isoamyl acetate and / or 0.5 to 4 mg / L β-phenylethyl and / or 0.05 to 0.3 mg / L ethyl butyrate.

[0061] According to a more preferred embodiment of the invention, the alcoholic beverage is wine, which contains: 1 to 7 mg / L isoamyl acetate and 0.5 to 4 mg / L β-phenylethyl and / or 0.05 to 0.3 mg / L ethyl butyrate.

[0062] According to a more preferred embodiment of the invention, the alcoholic beverage is wine, which contains: 3 to 5 mg / L isoamyl acetate and / or 1 to 3 mg / L β-phenylethyl and / or 0.09 to 0.2 mg / L ethyl butyrate.

[0063] According to an even more preferred embodiment of the invention, the alcoholic beverage is wine, which contains: 3 to 5 mg / L isoamyl acetate and 1 to 3 mg / L β-phenylethyl and / or 0.09 to 0.2 mg / L ethyl butyrate.

[0064] According to other preferred embodiments of the invention, the alcoholic beverage is wine, which contains: 4.96 mg / L isoamyl acetate and / or 2.41 mg / L β-phenylethyl and / or 0.18 mg / L ethyl butyrate.

[0065] Finally, according to other preferred embodiments of the invention, the alcoholic beverage is wine, which contains: 4.96 mg / L isoamyl acetate and 2.41 mg / L β-phenylethyl and / or 0.18 mg / L ethyl butyrate.

[0066] As can be seen from Table 7, the yeast of the present invention can be used to prepare beer containing 3 to 10 µg / L nerol, preferably beer containing 5 to 7 µg / L nerol.

[0067] Furthermore, the yeast of the present invention can be used to prepare beer containing 0.5 to 2 mg / L β-phenylethyl acetate, preferably beer containing 1 to 1.5 mg / L β-phenylethyl acetate.

[0068] Furthermore, the yeast of the present invention can be used to prepare beer containing 1 to 3 mg / L isoamyl acetate, preferably beer containing 1.5 to 2.5 mg / L isoamyl acetate.

[0069] Furthermore, the yeast of the present invention can be used to prepare beer containing 0.5 to 0.6 mg / L decanoic acid, preferably beer containing 0.50 to 0.55 mg / L decanoic acid.

[0070] Therefore, the yeast of the present invention can be used to prepare beer containing 3 to 10 µg / L nerol and / or 0.5 to 2 mg / L β-phenylethyl acetate and / or 1 to 3 mg / L isoamyl acetate and / or 0.5 to 0.6 mg / L decanoic acid.

[0071] Preferably, the yeast of the present invention is used to prepare beer containing 5 to 7 µg / L nerol and / or 1.5 to 2.5 mg / L β-phenylethyl acetate and / or 1 to 3 mg / L isoamyl acetate and / or 0.50 to 0.55 mg / L decanoic acid.

[0072] Another object of the present invention is to prepare alcoholic beverages using *Saccharomyces cerevisiae*, which has been described in detail above, as a food inoculum; more preferably, *Saccharomyces cerevisiae* SPACE strain is used. Preferably, the alcoholic beverage is wine, beer, cider, or mead.

[0073] Another objective is to use *Saccharomyces cerevisiae* as a food or food supplement, preferably as a probiotic in a food supplement. Preferably, *Saccharomyces cerevisiae* SPACE strain is used as a probiotic in a food or food supplement.

[0074] According to another preferred embodiment, the alcoholic beverage is wine and / or beer.

[0075] Another objective was to obtain Saturn-shaped Sacchariformis cerberlindneri, whose strain was identified as SPACE strain and deposited at the DBVPG Industrial Yeast Collection Center of the University of Perugia with accession number DBVPG 50P.

[0076] According to another preferred embodiment, the Saturn-shaped Cyberlindnerella vaginalis has the gene sequence SEQ_ID_1.

[0077] Experimental Section

[0078] The present invention will be further described below with reference to embodiments and tests. These embodiments and tests should be regarded as illustrative of the present invention and therefore do not constitute a limitation thereof.

[0079] Example 1: Isolation of Saturn-shaped Saccharomyces cerevisiae SPACE strain The Saturn-shaped *Saccharomyces cerevisiae* SPACE strain was isolated from soil samples collected in January 2020 in Montello (TV), Treviso province, a highly viticultural region in the Veneto region of Italy. Samples were collected in sterile bags, and aliquots were resuspended in sterile flasks containing 200 mL of enrichment medium (YPD) containing antibiotics to inhibit bacterial growth and alcohol to inhibit fungal growth. The components of this medium after preparation in distilled water and autoclaving at 121°C for 20 minutes are listed below.

[0080]

[0081] Maintain the flasks at a constant temperature of 22–24°C. After several days, especially after the selective medium becomes turbid, isolate the yeast by inoculating it onto WL agar differential medium (yeast extract 4.0 g / L, tryptone 5.0 g / L, glucose 50 g / L, potassium dihydrogen phosphate 550 mg / L, potassium chloride 425 mg / L, calcium chloride 125 mg / L, magnesium sulfate 125 mg / L, ferric chloride 2.5 mg / L, manganese sulfate 2.5 mg / L, bromocresol green 22 mg / L, agar 20 g / L, finally autoclaved, pH 5.5±2) plates and culturing them at 28°C under aerobic conditions for 3 days. This is a differential medium that allows operators to more easily identify several yeast strains by observing the macroscopic morphology of the colonies. Different colonies are then picked from the WL agar plates and purified by subculturing twice consecutively in the same medium, finally stored at -80°C in a solution containing 40% (w / w) glycerol.

[0082] Taking the Saturn-shaped Saccharomyces cerevisiae SPACE strain as an example, the colonies were found to be powdery, sunken in appearance, with irregular edges, and grayish-white in color. Figure 1 ).

[0083] Under a microscope, the cells were observed to be oval-shaped and exhibited unipolar budding characteristics. Figure 2 Subsequently, through RAPD R3, RAPD M13, ITS-RFLP analysis and ITS region sequencing, the cell was identified as the Saturn-shaped Saccharomyces cerevisiae SPACE strain.

[0084] Identification of Saturn-shaped Saccharomyces cerevisiae SPACE strain

[0085] The SPACE strain of *Saccharomyces cerevisiae* was identified at the species level by sequencing the ITS region. Sequence analysis showed that it shared 99.82% sequence similarity with the type strain *Saccharomyces cerevisiae* CBS 254ITS (species number 165971). Figure 3 The sequence is shown, along with its alignment in the NCBI database and its alignment with the reference strain sequence.

[0086] To analyze this strain and compare it with another strain of the same species in the applicant's strain library (which had previously been identified by sequencing as a BEP2P strain), the DNA of this strain was subjected to RAPD analysis (using R3 and M13 primers) and ITS-RFLP analysis.

[0087] Example 2: Characterization of Saturn-shaped Saccharomyces cerevisiae SPACE strain The generation of hydrogen sulfide Hydrogen sulfide production was assessed in lead acetate agar medium (yeast extract 5 g / L, glucose 40 g / L, peptone 3 g / L, ammonium sulfate 2 g / L, lead acetate 1 g / L, agar 18 g / L, incubated at 30°C for 5 days). At the end of the incubation, colonies exhibited different colors based on the amount of hydrogen sulfide produced. Dark brown colonies (…) Figure 7 a) indicates high hydrogen sulfide production; light brown to beige colonies indicate low production; white colonies indicate no ability to produce hydrogen sulfide. The Saturn-shaped *Saccharomyces cerevisiae* SPACE strain, after cultivation in lead acetate agar, exhibited light brown colonies; under the test conditions, this strain produced a moderate amount of H2S (…). Figure 7 ).

[0088] Fermentation vitality

[0089] The fermentation activity of *Saccharomyces cerevisiae* SPACE strain was evaluated in various natural grape must. Inoculum was prepared from streaked pure cultures on the same medium agar plates in YPD enrichment medium. The inoculum was incubated at 25°C for 24 hours and then inoculated into grape must at a 10% inoculum size (final volume 300 mL, 400 mL, or 700 mL). Fermentation was carried out in pre-sterilized, sealed flasks fitted with centrally perforated silicone stoppers into which bent Pasteur pipettes were inserted to allow carbon dioxide escape while preventing water vapor loss. Fermentation progress was tracked by monitoring weight loss due to CO2 production, an indicator of the degree of sugar fermentation. Cultures were maintained at a constant 25°C, and weight loss was measured daily until a constant weight was achieved, at which point fermentation was considered complete. The strain was compared with *Yeast 1H* (a commercial *Yeast* strain). Growth curves were constructed based on the collected data, and the fermentation activity of *Saccharomyces cerevisiae* SPACE strain was compared with that of the commercial *Yeast 1H* strain. In multiple fermentation tests, the Saturn-shaped Saccharomyces cerevisiae SPACE strain exhibited typical fermentation characteristics of non-yeast yeasts: the average weight loss on days 2 and 7 did not reach the levels observed in commercial strains of Saccharomyces cerevisiae; its alcohol tolerance was at most about 6% (v / v), and the time required to reach this level varied depending on the type of grape must used (7 to 10 days).

[0090] Figure 8 The fermentation process of Saturn-shaped Saccharomyces cerevisiae and commercial strain 1H is shown in Prosecco grape must test 1.

[0091] Figure 9 The fermentation process of Saturnella saccharindina is shown in Prosecco grape must test 2, comparing it with that of commercial strain 1H.

[0092] Figure 10 The fermentation progress of *Saccharomyces cerevisiae* SPACE strain at inoculum levels of 40 g / HL (dots with longitudinal intervals) and 20 g / HL (square dots) is shown in Prosecco grape must test 3, compared with that of commercial strain 1 H.

[0093] Test 3 aimed to verify the inoculum dosage of the experimentally prepared yeast milk in the applicant's production facility. The cell count of this milky yeast was 1.49 × 10⁻⁶. 10 Cells / gram, viability 94%. Inoculum sizes tested were 20 and 40 g / HL; from... Figure 10It can be seen that the fermentation process of each sample changed compared with the commercial strain 1H under different inoculum dosage conditions. When using an inoculum dosage of 40 g / HL, the fermentation rate of this non-yeast yeast was slightly faster; at about 200 hours of fermentation, all curves reached the same CO2 loss value, and then entered the plateau phase.

[0094] Sequential fermentation

[0095] The fermentation activity of the Saturn-shaped Saccharomyces cerevisiae SPACE strain was evaluated while it was being fermented sequentially with the previously used commercial Saccharomyces cerevisiae strain 1H as a control for evaluating its application in brewing.

[0096] The results of the sequential fermentation experiment showed that yeast strain 1H was able to complete fermentation whether it was inoculated 3 days after fermentation of *Saccharomyces cerevisiae* or 9 days after fermentation. Figure 11 and Figure 12 ).

[0097] Example 3: HPLC analysis of samples The ability to produce secondary metabolites was evaluated using HPLC analysis. A comparative test was also conducted using commercial yeast strains. The results are shown in Tables 1 and 2, indicating that this strain has the ability to consume approximately 60% of the sugar content in Prosecco must alone and achieve an alcohol content of approximately 6%. It should also be noted that this yeast produces succinic acid and has low volatile acidity.

[0098] Table 1. Comparison of the contents (g / L) of various metabolites before and after fermentation of Saturnella sacchariformis SPACE strain and commercial strain 1H in Prosecco grape must test 1.

[0099] Table 1

[0100] Table 2. Comparison of the contents (g / L) of various metabolites of Saccharomyces cerevisiae SPACE strain and commercial strain 1H before (left) and after (right) fermentation in Prosecco grape must test 2.

[0101]

[0102] Table 3. Comparison of the contents (g / L) of various metabolites before and after fermentation of Prosecco grape must test 4, between the SPACE strain of Saturn-shaped Saccharomyces cerevisiae and the commercial strain 1H (both yeasts coexisting) after 3 days of fermentation.

[0103]

[0104] Example 4: Aroma characteristics The aroma characteristics of *Saccharomyces cerevisiae* SPACE strain were evaluated in Prosecco must cultured at 25°C until fermentation was complete. For comparison, a similar fermentation experiment was also conducted on Prosecco must inoculated with a commercial yeast strain (1H).

[0105] 700 mL wine samples obtained from the non-yeast strain *Saccharomyces cerevisiae* SPACE on day 3 and day 9 of fermentation, and 700 mL wine samples obtained from the control strain (1H) at the end of fermentation, were sent to the Fondazione Edmund Mach laboratory in San Michele all'Adige for gas chromatography analysis (Table 4).

[0106] The results show that this strain can release fruity ester compounds in just 3 days of fermentation.

[0107] Samples obtained at the end of fermentation for each strain (SPACE and 1H) were compared to assess their potential. After approximately 9 days of fermentation, a subset of fermented samples were compared with samples obtained from the commercial strain 1H. Table 4 shows that samples obtained using the non-yeast *Saccharomyces cerevisiae* SPACE strain had higher levels of certain volatile compounds: methyl salicylate, isobutyl acetate, isoamyl acetate, β-phenylethyl acetate, ethyl butyrate, and butyric acid.

[0108] Specifically, the sensing threshold of isoamyl acetate reported in the literature is 0.03 mg / L (Garcia et al., 2019), and its content is very high, reaching 4.96 mg / L, which is 20 times the content (0.2 mg / L) in the fermentation sample of reference strain 1H.

[0109] The reported sensing threshold for β-phenylethyl acetate is 0.25 mg / L (Garcia et al., 2019), and it also has a high content in samples fermented with Saturn-type Cyberlindnerella vaginalis: β-phenylethyl acetate is 2.41 mg / L, while it is only 0.1 mg / L in blank samples. β-Phenylacetic acid ester has a floral, fruity, and sweet aroma.

[0110] Ethyl butyrate has a detection threshold of 0.02 mg / L (Garcia et al., 2019). It is a compound with an apple, fruit and sweet aroma. In samples fermented with Saturn-type Cyberlindnerella vaginalis, its concentration was 0.18 mg / L, which is 6 times the concentration in the blank sample (0.03 mg / L).

[0111] Table 4 ( Figure 13 ): Volatile compounds detected or not detected in the analyzed samples, a comparison between non-yeast yeast and commercial strain 1H (control sample).

[0112] Example 5: Uses of Saturn-shaped Saccharomyces cerevisiae SPACE strain in beer Based on the known information about this microbial species, *Saturnella sabrina* does not possess the ability to ferment maltose (Kurtzman et al., 2011). However, micro-brewing trials were conducted to verify whether this yeast could release fruity volatile compounds when fermenting glucose in wort, as was observed in grape must tests.

[0113] In this embodiment, fermentation is carried out by yeast of the genus *Saccharomyces* until it is terminated.

[0114] Microbrewing trials were conducted in lager must (pre-made malt MR. MALT) with added glucose (according to the recipe) to obtain lager must with the following sugar composition: glucose 47.6 g / L; fructose 2 g / L; maltose 27.32 g / L.

[0115] As shown in Table 5, the SPACE strain of Saturnian Cyberlindnaes, when inoculated alone, can reach an alcohol content of approximately 2.9 degrees by fermenting glucose present in the wort (theoretically, 49 g / L glucose can form 2.94 degrees of alcohol).

[0116] Tests using commercial strains ALE 05, Aoyama, and ALE LN3 sequentially inoculated resulted in alcohol contents of 4.42, 4.87, and 4.77 degrees, respectively. These values ​​are almost identical to those obtained from beer fermented individually by each commercial strain, indicating that the Saturnian Saccharomyces cerevisiae SPACE strain does not inhibit the fermentation of these sequentially inoculated yeasts (approximately 6 days after fermentation of non-yeast yeasts).

[0117] Table 5: Fermentation parameters obtained by sequentially inoculating beer samples with Saturnian Cyberlindnerella vaginalis SPACE strain, ALE 05 strain, Aoyama strain, and ALE LN3 strain, and compared with beer obtained by using ALE 05 strain, ALE LN3 strain, Aoyama strain, and SPACE strain yeast individually.

[0118] To better simulate fermentation in beer wort, malt extract was used to replace glucose in the preparation of wort (pre-made malt MR. MALT), resulting in wort with the following sugar composition: maltose 48.84 g / L; glucose 10.42 g / L; fructose 1.89 g / L. Fermentation tests were conducted in lager wort with added malt extract, where Saturnian *Cyperus sabina* was added at the end of fermentation with the commercial strain ALE 05.

[0119] When inoculated with strain ALE 05, *Saccharomyces cerevisiae* had already produced 1.30% alcohol by fermenting available glucose. After adding strain ALE 05, fermentation parameters were analyzed at the end of fermentation: the alcohol produced was observed to be almost identical to that of the control (beer fermented with strain ALE 05). The results are shown in the table below, indicating that initial fermentation using *Saccharomyces cerevisiae* does not inhibit subsequent fermentation of the commercial strain ALE 05.

[0120] Table 6: Fermentation parameters obtained from the sequential inoculation of beer samples with Saturn-shaped Saccharomyces cerevisiae and ALE 05, and compared with beer obtained using only ALE 05.

[0121]

[0122] Sensory analysis of the various samples obtained showed that they had the same fruity aroma as wine samples, indicating that the strain is able to produce this type of ester even when fermenting only the glucose present in beer mash.

[0123] For this purpose, Table 7 is shown below.

[0124]

[0125] As can be seen from Table 7 above, the yeast of the present invention can produce beer containing 3 to 10 µg / L nerol, preferably beer containing 5 to 7 µg / L nerol.

[0126] Furthermore, the yeast of the present invention can be used to prepare beer containing 0.5 to 2 mg / L β-phenylethyl acetate, preferably beer containing 1 to 1.5 mg / L β-phenylethyl acetate.

[0127] Furthermore, the yeast of the present invention can be used to prepare beer containing 1 to 3 mg / L isoamyl acetate, preferably beer containing 1.5 to 2.5 mg / L isoamyl acetate.

[0128] Furthermore, the yeast of the present invention can be used to prepare beer containing 0.5 to 0.6 mg / L decanoic acid, preferably beer containing 0.50 to 0.55 mg / L decanoic acid.

[0129] Therefore, the yeast of the present invention can be used to prepare beer containing 3 to 10 µg / L nerol and / or 0.5 to 2 mg / L β-phenylethyl acetate and / or 1 to 3 mg / L isoamyl acetate and / or 0.5 to 0.6 mg / L decanoic acid.

[0130] Preferably, the yeast of the present invention is used to prepare beer containing 5 to 7 µg / L nerol and / or 1.5 to 2.5 mg / L β-phenylethyl acetate and / or 1 to 3 mg / L isoamyl acetate and / or 0.50 to 0.55 mg / L decanoic acid.

[0131] In Italy, the term "non-alcoholic beer" is used only for products with an original wort concentration of not less than 3 and not more than 8, and an alcohol volume fraction of not more than 1.2%.

[0132] The term "light beer" is used only for products with an original wort concentration of not less than 5% and not more than 10.5%, and an alcohol volume fraction of more than 1.2% but not more than 3.5%.

[0133] The term "beer" is used only for products with an original wort concentration higher than 10.5% and an alcohol volume fraction higher than 3.5%. When the original wort concentration is not lower than 12.5%, the product can be called "specialty beer," and when the original wort concentration is not lower than 14.5%, it can be called "double malt beer."

[0134] The table below summarizes the different definitions of beer.

[0135]

[0136] The Saturn-shaped *Seberlindnerella* yeast, initially inoculated for beer production, must be followed by a second yeast—typically used in brewing—to complete fermentation by metabolizing maltose. Therefore, the alcohol content can vary depending on the initial Platonicity and the final alcohol level the brewer desires (depending on the desired beer style).

[0137] Using Saturn-shaped Cyberlindna yeast can produce fruity aromas that traditional yeasts cannot.

[0138] The content described above applies to the aromas produced and their relative content.

[0139] Therefore, the alcoholic beverage preparation method described above is preferred, wherein the alcoholic beverage is beer, and the method includes a subsequent step of adding yeast.

[0140] More preferably, in the method, the beer has an alcohol content of more than 3.5% or a Plato degree of more than 10.5.

[0141] SEQ ID_1 gene sequence of Saturn-shaped Saccharomyces cerevisiae SPACE strain

[0142] Seq_ID_1:

[0143] GGTGCAGCCGCGCTTCCACAGCGCGGCAGCCCAAACCTTACACACTGTGATTAGTTTTTTACTATTTACTTTGGCTGCGCAAGTGGCCAAAGGTCTTAAACACAAAGATTTATATCTTTTTTTACAAAATTTAGTCAATGAAGTTTTAATACTATAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCAAC GATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGGTTTTCGTGAATCATCGAATCTTTGAACGCACATTGCACCCTCTGGTATTCCGGAGGGTATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTAGGGTTTGGTATTGAGTGATACTCTCTTCTGGGTTAACTTGAAATAGTGTACTGGCAAGAGT

[0144] GTGCTTTTGTGGCCTCTGACTGAGATAATGTATTAGGTTCTACCAACTCGTTATAGCAGCTCAATTGTCCCTTTGGCATATCAGCTCGGCCTGACAACTCCTTCTAAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA

Claims

1. A method for preparing an alcoholic beverage, the method comprising a fermentation step, characterized in that... The fermentation step was carried out in the presence of Saturn-shaped Saccharomyces cerevisiae.

2. The method according to claim 1, wherein the Saturn-shaped Saccharomyces cerevisiae strain is the SPACE strain.

3. The method according to claim 1, wherein the alcoholic beverage is wine, beer, cider, or mead.

4. The method according to claim 1, wherein the method includes a preliminary step of preparing a food inoculum, the food inoculum comprising Saturn Cyberlinde yeast.

5. The method according to claim 1, wherein the method includes a subsequent step of adding yeast.

6. Food inoculum containing Saturn Cyberlinde yeast.

7. The food inoculum according to claim 6, wherein the *Saccharomyces cerevisiae* strain is the SPACE strain.

8. Alcoholic beverages or alcoholic fermented mashes containing *Saturnia cyberlinde* or *Saturnia cyberlinde* SPACE strain.

9. An alcoholic beverage or alcoholic fermentation mash containing: 1 to 7 mg / L isoamyl acetate and / or 0.5 to 4 mg / L β-phenylethanol and / or 0.05 to 0.3 mg / L ethyl butyrate.

10. The alcoholic beverage or alcoholic fermented grape must according to claim 9, wherein the alcoholic beverage is wine, comprising: 1 to 7 mg / L isoamyl acetate and / or 0.5 to 4 mg / L β-phenylethanol and / or 0.05 to 0.3 mg / L ethyl butyrate.

11. An alcoholic beverage, wherein the alcoholic beverage is a beer containing 3 to 10 µg / L nerol, and / or 0.5 to 2 mg / L β-phenylethanol acetate, and / or 1 to 3 mg / L isoamyl acetate, and / or 0.5 to 0.6 mg / L decanoic acid.

12. The use of the *Saturnella sacchariformis* or the SPACE strain of *Saturnella sacchariformis* as a food inoculum for the preparation of alcoholic beverages, according to claim 6.

13. The use of *Saturnella sacchariformis* according to claim 12, characterized in that... The alcoholic beverage is wine, beer, cider, or mead.

14. Saturn-shaped Sacchariformis sabrindnerella, whose strain was identified as SPACE strain and deposited at the DBVPG Industrial Yeast Collection Center of the University of Perugia with accession number DBVPG 50P.

15. The Saturn-shaped Saccharindina yeast according to claim 14, having the gene sequence SEQ_ID_1.

16. Saturn-shaped Saccharomyces cerevisiae is used as a probiotic in food or food supplements.

17. The method according to any one of claims 1 to 5, wherein the alcoholic beverage is beer, and the method includes a subsequent step of adding yeast of the genus *Saccharomyces*.

18. The method of claim 17, wherein the beer has an alcohol content greater than 3.5% or a Plato degree greater than 10.5.

Images