Compositions and methods for control and treatment of phenylketonuria

By directly correcting the pathogenic mutations of phenylketonuria through base editing therapy, the problems of compliance and limited response of existing treatments have been solved, and a lasting curative effect on phenylketonuria has been achieved.

CN122055448APending Publication Date: 2026-05-15THE TRUSTEES OF THE UNIV OF PENNSYLVANIA +1
View PDF 22 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-08-19
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing treatments for phenylketonuria (PKU), such as diet therapy and drug therapy, suffer from adherence problems, and many patients have limited response to medications, leading to intellectual disability and neuropsychiatric problems. There is a lack of long-lasting and effective curative treatments.

Method used

By using base editing therapy, pathogenic mutations in phenylketonuria (PKU), particularly the c.1222C>T (p.Arg408Trp) mutation, can be directly corrected. This is achieved by using a base editor and a guide polynucleotide to form a complex, resulting in an A•T to G•C base change, thus correcting mutations in PAH polynucleotides.

Benefits of technology

It achieves a lasting cure for patients with phenylketonuria, reduces or eliminates symptoms, and effectively corrects common mutations, avoiding the limitations of existing treatments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122055448A_ABST
    Figure CN122055448A_ABST
Patent Text Reader

Abstract

Compositions and methods for effecting base editing to correct mutations in the phenylalanine hydroxylase gene to cure phenylketonuria are disclosed.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Kiran Musunuru Xiao Wang Dominique Brooks Aidan Quigley Rebecca Ahrens-Nicklas Cross-reference to related applications This application claims priority to U.S. Provisional Patent Application No. 63 / 520,273, filed August 17, 2023, the entire contents of which are incorporated herein by reference as if fully expressed.

[0002] Fund Support Statement This invention was completed with government support granted by the National Institutes of Health under license numbers U19-NS132301, R01-HL148769, and R35-HL145203. The government owns certain rights to this invention. Technical Field

[0003] This invention relates to the fields of genetic engineering and the use of base editing therapy to correct genetic errors. More specifically, this invention provides compositions and methods for correcting gene mutations that cause phenylketonuria.

[0004] Materials submitted electronically and incorporated by reference The contents of the electronic serial number (UPNK-117-PCT.xml; size: 98,844 bytes; and creation date: August 19, 2024) are incorporated herein by reference in their entirety. Background Technology

[0005] Throughout this specification, numerous publications and patent documents have been cited to describe the current state of the art to which this invention pertains. Each of these citations is incorporated herein by reference as if fully expressed.

[0006] Phenylketonuria (PKU) is an autosomal recessive inherited metabolic disorder caused by a deficiency of the liver enzyme phenylalanine hydroxylase (PAH). Without treatment, the primary clinical feature is intellectual disability. Treatment involves a low-phenylalanine diet supplemented with an amino acid formula, initiated immediately after diagnosis within the first few weeks of life. Although dietary therapy has been successful in preventing intellectual disability in PKU patients treated early, adherence remains a significant challenge due to the palatability of the food. Other potential problems associated with dietary therapy include nutritional deficiencies, particularly vitamin D and B12. Patients with poor adherence to dietary therapy have reportedly poor cognitive and executive function outcomes.

[0007] Other approaches include oral medications, such as sapropterin, a cofactor for PAH, and injectable enzyme replacement therapy (pegvaliase). Many PKU patients respond poorly to or have limited access to drug therapy, resulting in impaired cognitive development and a range of neuropsychiatric problems. A durable and ideally curative treatment is needed to address the unmet medical needs of PKU patients. Although not hepatotoxic, the PAH gene is highly expressed in hepatocytes, and correcting the primary genetic defect solely in the liver would be curative for PKU patients.

[0008] One object of the present invention is to provide an effective and lasting PKU treatment that reduces or eliminates PKU symptoms. Summary of the Invention

[0009] This invention provides compositions and methods for achieving a durable cure for a subgroup of patients with phenylketonuria (PKU) by directly correcting pathogenic mutations in PKU, particularly the c.1222C>T mutation, also known as the p.Arg408Trp mutation and the R408W mutation, which are the most common PKU-related mutations worldwide.

[0010] According to one aspect of the invention, a method is provided for editing a polynucleotide encoding phenylalanine hydroxylase (PAH), said polynucleotide comprising a c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln) mutation. An exemplary method includes contacting the PAH polynucleotide with a base editor and one or more guide polynucleotides to form a base editor complex comprising a polynucleotide programmable DNA-binding domain and an adenosine deaminase domain, wherein said one or more guide polynucleotides target the base editor complex with the mutation and achieve an A•T to G•C base change, thereby correcting the mutation.

[0011] In some embodiments, the mutation is c.1222C>T (p.Arg408Trp), and the guide polynucleotide has a sequence having at least 90% identity with SEQ ID NO: 7, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 1, SEQ ID NO: 9, or SEQ ID NO: 11, or is a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence. In some embodiments, the mutation is c.1222C>T (p.Arg408Trp), and the guide polynucleotide comprises a nucleic acid sequence complementary to the following: a nucleic acid sequence encoding a PAH having at least 90% identity with SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 12. In some implementations, the patient has a second mutation in a different allele of a second polynucleotide encoding PAH, the mutation being selected from c.842C>T (p.Pro281Leu), c.1066–11G>A, c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln).

[0012] In some embodiments, the mutation is c.1066–11G>A, and the guide polynucleotide has a sequence having at least 90% identity with SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, or SEQ ID NO: 25, or is a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence. In some embodiments, the mutation is c.1066–11G>A, and the guide polynucleotide comprises a nucleic acid sequence complementary to the following: a nucleic acid sequence encoding a PAH having at least 90% identity with SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, or SEQ ID NO: 26. In some implementations, the patient has a second mutation in a different allele of a second polynucleotide encoding PAH, the mutation being selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln).

[0013] In some embodiments, the mutation is c.782G>A (p.Arg261Gln), and the guide polynucleotide has a sequence having at least 90% identity with SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or is a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence. In some embodiments, the mutation is c.782G>A (p.Arg261Gln), and the guide polynucleotide comprises a nucleic acid sequence complementary to the following: a nucleic acid sequence encoding a PAH having at least 90% identity with SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO: 40. In some implementations, the patient has a second mutation in a different allele of a second polynucleotide encoding PAH, the mutation being selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln).

[0014] In some embodiments, the mutation is c.728G>A (p.Arg243Gln), and the guide polynucleotide has a sequence having at least 90% identity with SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, or SEQ ID NO: 53, or is a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence. In some embodiments, the mutation is c.728G>A (p.Arg243Gln), and the guide polynucleotide comprises a nucleic acid sequence complementary to the following: a nucleic acid sequence encoding a PAH having at least 90% identity with SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, or SEQ ID NO: 54. In some implementations, the patient has a second mutation in a different allele of a second polynucleotide encoding PAH, the mutation being selected from c.842C>T (p.Pro281Leu), 122C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln).

[0015] In some embodiments, contact occurs in cells, eukaryotic cells, mammalian cells, or human cells. Contact can occur in vitro or in vivo. The polynucleotide programmable DNA-binding domain may be *Streptococcus pyogenes* (…). Streptococcus pyogenes Cas9 (SpCas9) or Staphylococcus aureus ( Staphylococcus aureusCas9 (SaCas9) or variants thereof. In some aspects, the polynucleotide programmable DNA binding domain comprises SpCas9 with modifications specific to the altered protospacer adjacent motif (PAM), including but not limited to SpCas9 with modifications specific to nucleic acid sequences 5'-NGC-3', 5'-NCA-3', 5'-NAA-3', 5'-NAG-3', 5'-NGT-3', or 5'-NGN-3'. The polynucleotide programmable DNA binding domain may be nuclease-free or a nickase variant. In the disclosed base editing method, the adenosine deaminase domain is capable of deaminating adenosine in deoxyribonucleic acid (DNA). The adenosine deaminase may be TadA deaminase or a variant thereof. In another embodiment, the base editor is complexed with a single guide RNA (sgRNA) containing a nucleic acid sequence complementary to a nucleic acid sequence containing a PKU-related mutation.

[0016] Also provided are cells produced by introducing the following into cells or their progenitor cells: a) a base editor or a polynucleotide encoding said base editor, wherein said base editor comprises a polynucleotide programmable DNA-binding domain and an adenosine deaminase domain; and b) one or more guide polynucleotides that target the base editor to a mutation site and achieve an A•T to G•C alteration of c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln) mutations, thereby treating PKU. In some embodiments, the cells are hepatocytes. In some embodiments, the hepatocytes express a PAH polypeptide. In some embodiments, the cells are derived from a subject suffering from PKU. In some embodiments, the polynucleotide programmable DNA-binding domain is Streptococcus pyogenes Cas9 (SpCas9) or a variant thereof. In some aspects, the polynucleotide programmable DNA-binding domain comprises SpCas9 with modifications specific to the altered protospacer neighbor motif (PAM), including but not limited to SpCas9 with modifications specific to nucleic acid sequences 5'-NGC-3', 5'-NCA-3', 5'-NAA-3', 5'-NAG-3', 5'-NGT-3', or 5'-NGN-3'. The polynucleotide programmable DNA-binding domain may be nuclease-free or a nickase variant. In the disclosed base editing methods, the adenosine deaminase domain is capable of deaminating adenosine in deoxyribonucleic acid (DNA). The adenosine deaminase may be TadA deaminase or a variant thereof. In another embodiment, the base editor is complexed with a single guide RNA (sgRNA) containing a nucleic acid sequence complementary to a nucleic acid sequence containing a PKU-related mutation.

[0017] Another embodiment of the invention comprises a variety of adenosine base editor / guided polynucleotide editing complexes for correcting mutations causing PKU. Exemplary editing complexes include (i) a modified SpCas9 or SaCas9; (ii) an adenosine deaminase or a functional fragment thereof; and (iii) a guide polynucleotide that targets the base editor to achieve an A•T to G•C change in PKU-related c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln) mutations.

[0018] In some embodiments, the mutation is c.1222C>T (p.Arg408Trp), and the guide polynucleotide has a sequence having at least 90% identity with SEQ ID NO: 7, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 1, SEQ ID NO: 9, or SEQ ID NO: 11, or is a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence. In some embodiments, the mutation is c.1222C>T (p.Arg408Trp), and the guide polynucleotide comprises a nucleic acid sequence complementary to the following: a nucleic acid sequence encoding a PAH having at least 90% identity with SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 12. In some embodiments, the patient has a second mutation in a different allele of a second polynucleotide encoding PAH, said mutation being selected from c.842C>T (p.Pro281Leu), c.1066–11G>A, c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln). In a particularly preferred embodiment, the guide polynucleotide has the sequence of SEQ ID NO: 7. In another preferred embodiment, the base editor has the sequence of SEQ ID NO: 78.

[0019] In some embodiments, the mutation is c.1066–11G>A, and the guide polynucleotide has a sequence having at least 90% identity with SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, or SEQ ID NO: 25, or is a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence. In some embodiments, the mutation is c.1066–11G>A, and the guide polynucleotide comprises a nucleic acid sequence complementary to the following: a nucleic acid sequence encoding a PAH having at least 90% identity with SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, or SEQ ID NO: 26. In some implementations, the patient has a second mutation in a different allele of a second polynucleotide encoding PAH, the mutation being selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln).

[0020] In some embodiments, the mutation is c.782G>A (p.Arg261Gln), and the guide polynucleotide has a sequence having at least 90% identity with SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or is a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence. In some embodiments, the mutation is c.782G>A (p.Arg261Gln), and the guide polynucleotide comprises a nucleic acid sequence complementary to the following: a nucleic acid sequence encoding a PAH having at least 90% identity with SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO: 40. In some implementations, the patient has a second mutation in a different allele of a second polynucleotide encoding PAH, the mutation being selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln).

[0021] In some embodiments, the mutation is c.728G>A (p.Arg243Gln), and the guide polynucleotide has a sequence having at least 90% identity with SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, or SEQ ID NO: 53, or is a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence. In some embodiments, the mutation is c.728G>A (p.Arg243Gln), and the guide polynucleotide comprises a nucleic acid sequence complementary to the following: a nucleic acid sequence encoding a PAH having at least 90% identity with SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, or SEQ ID NO: 54. In some implementations, the patient has a second mutation in a different allele of a second polynucleotide encoding PAH, the mutation being selected from c.842C>T (p.Pro281Leu), 122C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln).

[0022] Another aspect of the invention includes a method for treating PKU in a subject, the method comprising administering an effective amount of the aforementioned adenosine base editor / guide polynucleotide set to the subject. Subjects to be treated include mammals and humans. The base editor or polynucleotide encoding the base editor, and one or more guide polynucleotides, may be delivered to the subject's cells, particularly hepatocytes.

[0023] In one delivery method, the base editor / guide polynucleotide assembly may be encapsulated in a lipid nanoparticle formulation and delivered to the liver of the subject. In some aspects, the formulation comprises ionizable cationic lipids, 1,2-distearate-sn-glycerol-3-phosphate choline, cholesterol, and PEG-lipids. In another delivery method, as described herein, the base editor / guide polynucleotide assembly is delivered to hepatocytes in a single or dual AAV vector system. In yet another method, the base editor / guide polynucleotide assembly may be delivered to hepatocytes in vivo or in vitro in virus-like particles.

[0024] In another aspect of the invention, the transgenic mouse containing the humanized PAH gene contains at least one mutation selected from c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln). In some embodiments, the mouse further contains at least one additional mutation selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln), wherein the first mutation is different from the at least one additional mutation.

[0025] In another aspect of the invention, a method is provided for identifying an effective adenosine base editor (ABE) / guided polynucleotide editing complex for correcting target mutations. An exemplary method includes a) contacting cells containing a control mutation with a control ABE / guided polynucleotide editing complex that edits the control mutation; b) contacting cells containing a target mutation with a test ABE / guided polynucleotide editing complex that edits the target mutation; c) comparing the correcting activity of the control ABE / guided polynucleotide editing complex with the correcting activity of at least one test ABE / guided polynucleotide editing complex; and e) identifying the test ABE / guided polynucleotide editing complex having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% of the correcting activity of the control ABE / guided polynucleotide editing complex. In some embodiments, the test ABE / guided polynucleotide editing complex has higher correcting activity than the control ABE / guided polynucleotide editing complex.

[0026] In some embodiments, the screening method further includes comparing the bystander editing levels of the test ABE / guided polynucleotide editing complex with the bystander editing levels of the control ABE / guided polynucleotide editing complex. In some embodiments, the test ABE / guided polynucleotide editing complex has approximately the same or fewer bystander edits as the control ABE / guided polynucleotide editing complex. In some embodiments, the method further includes selecting test ABE / guided polynucleotide editing complexes without intolerance and without nonsynonymous bystander edits. In some embodiments, the control mutation is c.842C>T (p.Pro281Leu) or c.1222C>T (p.Arg408Trp). In some embodiments, the control ABE / guided polynucleotide editing complex has the guide polynucleotide of SEQ ID NO: 7, and the base editor has the sequence of SEQ ID NO: 78. In some embodiments, the target mutation and / or control mutation is a PKU-related mutation. In some embodiments, the target mutation is selected from c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), and c.728G>A (p.Arg243Gln). In some embodiments, the ABE / guided polynucleotide editing complex being tested comprises at least one guide polynucleotide selected from Table 1 and / or at least one base editor selected from Table 2.

[0027] Other aspects and advantages of these compositions and methods are readily apparent and are further described in the following detailed description of the invention. Attached Figure Description

[0028] Figure 1A –1B. ( Figure 1A The adenine base editor (ABE) consists of an inactivating (d) or nickase (n) Cas9 (d / nCas9) fused to one or two TadA (evolved to edit adenine in DNA TadA (TadA*) or both TadA* and wild-type TadA). The ABE converts A:T to G:C base pairs within the editing window (e.g., nucleotides 4 to 7 in the protospacer, purple). Cas9 is guided by sgRNA to the protospacer [followed by PAM (protospacer adjacent motif)] and unwinds the DNA, while the deaminase converts the target base. Figure 1BThe cytosine base editor (CBE), consisting of a nickase Cas9 (nCas9) fused with a deaminase and one (in BE3) or two (in BE4) UGIs (uracil glycosylase inhibitors), converts C•G to T•A base pairs (nucleotides 4 to 8 in the original spacer region, green) in the editing window. Unexpected events in CBE and ABE (bystander editing, blue, and unwanted base transitions, yellow) are displayed respectively in ( Figure 1A , 1B The addition of the second UGI in CBE (in BE4) and the absence of TadA in ABE (ABE8) are highlighted with gray dashed lines. Figure 1A , 1B In the image above, the gradient color of the editing window represents the magnified editing window as observed with the new BE.

[0029] Figure 2 Lifetime recorded measurements of serum phenylalanine levels in PKU patients with the PAH R408W variant.

[0030] Figure 3 Intervals in serum phenylalanine levels measured in PKU patients with the PAH R408W variant.

[0031] Figures 4A-4C . ( Figure 4A A schematic diagram of the genomic locus of the PAH c.1222C>T (R408W) variant, modified from the UCSC Genome Explorer (GRCh38 / hg38) (SEQ ID NO: 81). Vertical blue bars represent G, which is altered to A (red) by variants on the antisense strand. The target protospacer regions of the six gRNAs designated as PAH1 (SEQ ID NO: 2), PAH2 (SEQ ID NO: 4), PAH3 (SEQ ID NO: 6), PAH4 (SEQ ID NO: 8), PAH5 (SEQ ID NO: 10), and PAH6 (SEQ ID NO: 12) are indicated by thick green bars, with the thinner portions of the bars representing PAMs. Black arrows indicate potential bystander adenine editing sites. Figure 4B Sanger sequencing chromatogram of genomic loci of the PAH R408W variant in wild-type HuH-7 cells. Blue arrows indicate the location of the variant. Figure 4C Chromatogram of this site in the R408W homozygous HuH-7 cell line. The red arrow indicates the location of the variant.

[0032] Figure 5A –5B. Adenine base editing correction of the PAH c.1222C>T variant in HuH-7 human hepatocellular carcinoma cells. Figure 5ACorrected A-to-G editing was performed after transient transfection of R408W homozygous HuH-7 cells with plasmids encoding various ABE / gRNA groups. Figure 5B Sanger sequencing chromatograms of genomic loci of variants in R408W homozygous HuH-7 cells treated with SpRY-ABE8e / PAH4. Blue arrows indicate the locations of variants.

[0033] Figure 6 A-to-G editing observed in a dose-response study of R408W homozygous HuH-7 cells treated with LNPs formulated with SpRY-ABE8.8 mRNA and PAH4 gRNA. The percentage of editing includes all results in which R408W variant-corrected editing was achieved, excluding bystander editing (n = 3 biological replicates; mean ± standard deviation for each dose).

[0034] Figure 7 A protocol for generating humanized PKU mice with exons possessing the PAH c.1222C>T (R408W) variant.

[0035] Figure 8A –8B. Minimal humanized PKU mice with the PAH c.1222C>T (R408W) variant were generated. Figure 7 A) Sanger sequencing chromatogram showing the humanized mouse model generated in mouse zygotes via Cas9-mediated homology-directed repair. The top sequence is from wild-type C57BL / 6J mice. The bottom sequence is from humanized R408W allele homozygous mice. Red arrows indicate sites of the R408W variant, and black arrows indicate sites of synonymous alterations that humanize local regions of the mouse Pah gene. Figure 7 B) Age-matched littermates of homozygous or heterozygous humanized R408W alleles. The left side shows homozygous mice with PKU, exhibiting hypopigmentation of their fur, while the right side shows heterozygous control mice with normal fur color.

[0036] Figure 9A –9B. Adenine base editing for in vivo correction of the humanized PKU mouse PAH R408W variant. Figure 9A Short-term changes in serum phenylalanine levels in homozygous PKU mice treated with SpRY-ABE8.8 / PAH4 LNP were analyzed. Levels at different time points, up to 7 days post-treatment, were compared with levels in untreated control PKU and non-PKU populations (n ​​= 1 sample per animal at each time point). Figure 9B A-to-G editing of the PAH R408W variant in whole liver (n = 8 samples per animal).

[0037] Figure 10A-10D Adenine base editing to correct PAHc.1066–11G>A in lentivirally infected HuH-7 human hepatocellular carcinoma cells. Figure 10A ), c.782G>A ( Figure 10B ), c.728G>A ( Figure 10C ) and c.1315+1G>A ( Figure 10D (Variants). The top horizontal dashed line indicates the editing efficiency of the P281L standard, and the bottom horizontal line indicates the editing efficiency of the R408W standard. Detailed Implementation

[0038] In vivo gene editing is an emerging therapeutic approach that modifies DNA within a patient's body, such as the liver. Gene editing methods include CRISPR-Cas9 and Cas12 nucleases, CRISPR cytosine base editors, CRISPR adenine base editors, and CRISPR leader editors. CRISPR base editors are an attractive gene editing modality because, compared to CRISPR-Cas9 and other gene-editing nucleases (e.g., Cas12), they can efficiently deliver precise, targeted alterations without requiring double-strand breaks. The adenine base editor (ABE) induces targeted A→G editing (T→C on the opposite strand) in DNA. Each ABE uses its core Cas9 nickase protein and guide RNA (gRNA) to ligate the double-stranded protospacer DNA sequence, flanking it with a protospacer adjacent motif (PAM) sequence at its 3' end. Because ABEs do not produce double-strand breaks, they have the lowest risk of inducing large deletions, chromosomal abnormalities, and chromosomal breakage (fragmentation); instead, each ABE uses an evolved deoxyadenosine deaminase domain—usually fused to the N-terminus of the Cas9 nickase—to chemically modify an adenosine nucleoside on one strand of DNA, which (combines with the nick on the other strand) enables highly precise and efficient A→G conversion mutations at the target site.

[0039] The activity window of each ABE typically spans several positions within the protospacer DNA sequence (e.g., the ABE8.8 window ranges from position 3 to 9, with peak editing observed at position 6 in the protospacer), and different ABEs have different windows. An ABE may edit any adenine within the window, which can include the desired target adenine or unintended additional adenine (bystander editing). Published ABEs with a Cas9 nickase from Streptococcus pyogenes include so-called eighth-generation ABEs (containing an optimized deaminase domain resulting from eight rounds of molecular evolution) – most commonly ABE8.8, ABE8.20, and ABE8e to date – and circular substitution ABEs or in-cell ABEs, where the deaminase domain is embedded within the loop of the Cas9 nickase protein instead of being fused to the N-terminus, which has the effect of shifting the editing window further towards the 3' end of the protospacer sequence. Similar ABEs with a Cas9 nickase from other bacterial species (e.g., Staphylococcus aureus) have also been reported. Generally, ABEs exhibit highly variable activity levels at different genomic loci in different cell types, and empirical testing must be performed to determine whether a given ABE with a given gRNA will effectively edit at a given target site in a given cell type.

[0040] This invention provides compositions and methods for adenine base editing to permanently correct the most common pathogenic variant in human hepatocytes, the PAH c.1222C>T (R408W) variant. Cytosine base editing can also permanently correct other pathological variants. The PAH c.1222C>T variant has the highest prevalence in Eastern European populations but is widespread globally and affects a large proportion of PKU patients in the United States. Homozygous patients with this variant typically do not respond to sapropterin, limiting their treatment options and making curative in vivo base editing therapy particularly appealing.

[0041] definition: As used above and throughout this disclosure, unless otherwise stated, the following terms and abbreviations shall be understood to have the following meanings.

[0042] In this disclosure, the singular forms “a,” “an,” and “the” include plural meanings, and references to a particular numerical value include at least that particular value unless the context clearly indicates otherwise. Thus, for example, reference to “compound” means one or more such compounds and their equivalents known to those skilled in the art, etc. The term “multiple” as used herein means more than one. When indicating a range of values, another embodiment includes from one particular value and / or to another particular value. Similarly, when a value is expressed as an approximation using the antecedent “about,” it should be understood that the particular value forms another embodiment. All ranges are both end-valued and composable.

[0043] A "monogenous disease" or "monogenous syndrome" is a disease determined by the interaction of a single pair of genes. This is the opposite of polygenic diseases, which involve several genes. In humans, monogenic diseases are less common than polygenic diseases. They are also less complex and follow a Mendelian inheritance pattern. Monogenic syndromes can have adverse effects on many biological systems.

[0044] Phenylketonuria (PKU) is a classic “single-gene” autosomal recessive disorder in which mutations at the human phenylalanine hydroxylase (PAH) site impair the function of phenylalanine hydroxylase (enzyme phenotype), leading to associated hyperphenylalanineemia (metabolic phenotype) and consequent intellectual disability (cognitive phenotype). Other symptoms include seizures, tremors, hyperactivity, developmental delay, or shaking and shivering; skin conditions including eczema; and a musty odor in urine, breath, or skin. 450,000 people have PKU, with a global prevalence of 1 in 23,930 live births (range 1 in 4,500 [Italy] – 1 in 125,000 [Japan]). More than 1,280 variants in the phenylalanine hydroxylase PAH gene are responsible for the broad spectrum of phenylketonuria (PKU) phenotypes. While the genotype-phenotype correlation is approximately 88%, other factors are also at play. This includes tetrahydrobiopterin (BH4), the PAH helper DNA JC12, phosphorylation of PAH residues, and epigenetic factors. Currently, there is no cure for PKU except for liver transplantation. This article describes the direct correction of the pathogenic mutation PAH c.1222C>T, also known as p.Arg408Trp and R408W, in hepatocytes via base editing. This is the most common PKU-related gene mutation worldwide. Subjects carrying this mutation typically respond poorly to BH4 replacement therapy.

[0045] The term "deaminase" or "deaminase domain" refers to a protein or enzyme that catalyzes a deamination reaction. In some embodiments, the deaminase is an adenosine deaminase that catalyzes the hydrolytic deamination of adenine or adenosine. In some embodiments, the deaminase or deaminase domain is an adenosine deaminase that catalyzes the hydrolytic deamination of adenosine or deoxyadenosine to inosine or deoxyinosine, respectively. In some embodiments, the adenosine deaminase catalyzes the hydrolytic deamination of adenine or adenosine in deoxyribonucleic acid (DNA). The adenosine deaminases provided herein (e.g., engineered adenosine deaminases, evolved adenosine deaminases) can be derived from any organism, such as bacteria.

[0046] In some embodiments, the deaminase or deaminase domain is a variant of a naturally occurring deaminase from an organism. In some embodiments, the deaminase or deaminase domain is not naturally occurring. For example, in some embodiments, the deaminase or deaminase domain is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to a naturally occurring deaminase. In some embodiments, the adenosine deaminase is derived from bacteria, such as *Escherichia coli* (E. coli). E. coli Staphylococcus aureus, Salmonella typhi ( S. typhi Shewanella putrefactive bacteria ( S. putrefaciens Haemophilus influenzae () H. influenzae ) or Crescentella ( C. crescentus In some embodiments, the adenosine deaminase is a TadA deaminase. In some embodiments, the TadA deaminase is *E. coli* TadA deaminase (ecTadA). In some embodiments, the TadA deaminase is a truncated *E. coli* TadA deaminase. For example, compared to full-length ecTadA, truncated ecTadA may lack one or more N-terminal amino acids. In some embodiments, compared to full-length ecTadA, truncated ecTadA may lack 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 6, 17, 18, 19, or 20 N-terminal amino acid residues. In some embodiments, the truncated ecTadA may be missing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 6, 17, 18, 19, or 20 C-terminal amino acid residues compared to the full-length ecTadA. In some embodiments, the ecTadA deaminase does not contain an N-terminal methionine.

[0047] However, it should be understood that the additional adenosine deaminases useful in this application are obvious to those skilled in the art and are within the scope of this disclosure.

[0048] The term "base editor (BE)" or "nucleobase editor (NBE)" refers to an agent comprising a polypeptide capable of modifying bases (e.g., A, T, C, G, or U) within a nucleic acid sequence (e.g., DNA or RNA). In some embodiments, the base editor is capable of deaminating bases in nucleic acids. In some embodiments, the base editor is capable of deaminating bases in DNA molecules. In some embodiments, the base editor is capable of deaminating adenine (A) in DNA. In some embodiments, the base editor is a fusion protein comprising a nucleic acid programmable DNA-binding protein (napDNAbp) fused to adenosine deaminase. In some embodiments, the base editor is a Cas9 protein fused to adenosine deaminase. In some embodiments, the base editor is a Cas9 nickase (nCas9) fused to adenosine deaminase. In some embodiments, the base editor is a nuclease-free Cas9 (dCas9) fused to adenosine deaminase. In some embodiments, the base editor is fused to an inhibitor of base excision repair, such as a UGI domain or a dISN domain. In some embodiments, the fusion protein comprises a Cas9 nickase fused to a deaminase and a base excision repair inhibitor such as a UGI or dISN domain.

[0049] "Lead editing" directly introduces new genetic information into the target DNA site. Typically, the editing is influenced by a fusion protein, which consists of a catalytically impaired Cas9 endonuclease fused with an engineered reverse transcriptase and a lead editing guide RNA (pegRNA). This guide RNA recognizes the target site and provides new genetic information to replace the target DNA nucleotides. Using this technology, targeted insertions, deletions, and base-to-base transitions can be introduced into the targeted nucleic acid molecule without double-strand breaks (DSBs) or donor DNA templates.

[0050] As used herein, the term "connector" refers to a bond (e.g., a covalent bond), a chemical group, or a molecule that connects two molecules or parts, such as the two domains of a fusion protein, for example, a Cas9 domain without nuclease activity and a nucleic acid editing domain (e.g., adenosine deaminase). In some embodiments, the connector links the gRNA-binding domain of an RNA-programmable nuclease (including the Cas9 nuclease domain) and the catalytic domain of a nucleic acid editing protein. In some embodiments, the connector links dCas9 and a nucleic acid editing protein. Typically, the connector is located between, or on either side of, two groups, molecules, or other parts, and is covalently linked to each other. In some embodiments, the connector is one or more amino acids (e.g., a peptide or protein). In some embodiments, the connector is an organic molecule, group, polymer, or chemical part. In some implementations, the linker length is 5-200 amino acids, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30-35, 35-40, 40-45, 45-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, or 150-200 amino acids. Longer or shorter linkers have also been considered.

[0051] As used herein, the term "wildtype" is a term understood by those skilled in the art and refers to the typical form of an organism, strain, gene, or trait that exists in nature, distinct from mutant or variant forms. As used herein, the term "variant" should be understood as exhibiting a pattern that deviates from the wildtype or containing non-natural components.

[0052] As used herein, the term “mutation” refers to the substitution of one residue in a sequence, such as a nucleic acid or amino acid sequence, with another residue, or the deletion or insertion of one or more residues in a sequence. Mutations are generally described herein by identifying the original residue, followed by its position in the sequence and its identity with the newly substituted residue. Various methods for generating the amino acid substitutions (mutations) presented herein are well known in the art and are provided, for example, by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th edition, ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2012).

[0053] As used herein, the term "uracil glycosylase inhibitor" or "UGI" refers to a protein capable of inhibiting the uracil-DNA glycosylase base excision repair enzyme. In some embodiments, the UGI protein provided herein comprises fragments of UGI and proteins homologous to UGI or UGI fragments. In some embodiments, the UGI fragment comprises at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% of the amino acid sequence encoding UGI.

[0054] The term "nuclear localization sequence" or "NLS" refers to an amino acid sequence that facilitates protein entry into the cell nucleus, such as through nuclear transport. Nuclear localization sequences are known in the art and will be obvious to those skilled in the art. For example, NLS sequences are described in Plank et al., International PCT application PCT / EP2000 / 011690, filed November 23, 2000, and published on May 31, 2001, under WO / 2001 / 038547. The contents of that document are incorporated herein by reference for the exemplary nuclear localization sequences they disclosed.

[0055] The term "programmable DNA-binding protein" or "napDNAbp" refers to a protein associated with a nucleic acid (e.g., DNA or RNA) that guides the napDNAbp to a specific nucleic acid sequence, such as a guide RNA. For example, the Cas9 protein can bind to a guide RNA that guides the Cas9 protein to a specific DNA sequence complementary to a spacer region sequence in the guide RNA. In some embodiments, napDNAbp is a class 2 microbial CRISPR-Cas effector. In some embodiments, napDNAbp is a Cas9 domain, such as an active nuclease Cas9, a Cas9 nickase (nCas9), or a nuclease-free Cas9 (dCas9). Examples of programmable DNA-binding proteins include, but are not limited to, Cas9 (e.g., dCas9 and nCas9), CasX, CasY, Cpf1, C2c1, C2c2, C2C3, and Argonaute. However, it should be understood that programmable DNA-binding proteins also include programmable proteins that bind RNA. For example, napDNAbp can bind to a nucleic acid that guides the napDNAbp to RNA. Other nucleic acid-programmable DNA-binding proteins are also within the scope of this disclosure, although they may not be specifically listed herein.

[0056] The term "Cas9" or "Cas9 domain" refers to an RNA-guided nuclease containing the Cas9 protein or fragments thereof (e.g., a protein containing the active, inactive, or partially active DNA-cutting domain of Cas9 and / or the gRNA-binding domain of Cas9). CRISPR (clustered regularly spaced short palindromic repeats) is an adaptive immune system that provides protection against mobile genetic elements (viruses, transposable elements, and conjugating plasmids). A CRISPR cluster contains a spacer region, a sequence complementary to the previously mobile element, and a target invading nucleic acid. The CRISPR cluster is transcribed and processed into CRISPR RNA (crRNA). In type II CRISPR systems, proper processing of the precrRNA requires a trans-encoded small RNA (tracrRNA), endogenous ribonuclease 3 (mc), and the Cas9 protein. tracrRNA acts as a guide for ribonuclease 3-assisted processing of the precrRNA. Subsequently, Cas9 / crRNA / tracrRNA endonuclease cleaves the linear or circular dsDNA target complementary to the spacer region. The target strand, not complementary to the crRNA, is first cleaved by endonuclease and then exonucleated from 3'–5'. In nature, DNA binding and cleavage typically require both proteins and two RNAs. However, a single guide RNA (“sgRNA”, or simply “gRNA”) can be engineered to integrate aspects of both crRNA and tracrRNA into a single RNA species. See, for example, Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna JA, Charpentier E. Science 337:816–821 (2012), the entire contents of which are incorporated herein by reference. Cas9 recognizes short motifs (PAMs or protospacer adjacent motifs) present in the target DNA sequence but not in short motifs in CRISPR repeat sequences to help distinguish between non-self and self, as the presence of PAMs is required for Cas9’s binding and catalytic activities.The Cas9 nuclease sequence and structure are well known to those skilled in the art (see, for example, Ferretti JJ, McShan WM, Ajdic DJ, Savic DJ, Savic G., Lyon K., Primeaux C., Sezate S., Suvorov AN, Kenton S., Lai HS, Lin SP, Qian Y., Jia HG, Najar FZ, Ren Q., Zhu H., Song L., White J., Yuan X., Clifton SW, Roe BA, McLaughlin RE "Complete genome sequence of an M1 strain of Streptococcus pyogenes." Proc. Natl. Acad. Sci. USA 98:4658-4663 (2001); Deltcheva E., Chylinski K., Sharma CM, Gonzales K., Chao Y., Pirzada ZA, Eckert MR, Vogel J., Charpentier E. "CRISPR RNAmaturation by "trans-encoded small RNA and host factor RNase III." Nature 471:602-607 (2011); and Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna JA, Charpentier E. "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity." Science 337:816-821 (2012); the entire contents of each reference are incorporated herein by reference. Orthologs of Cas9 have been described in various species, including but not limited to Streptococcus pyogenes (Streptococcus pyogenes Cas9 or SpCas9) and Staphylococcus aureus (Staphylococcus aureus Cas9 or SaCas9).Based on this disclosure, additional suitable Cas9 nucleases and sequences will be apparent to those skilled in the art, and such Cas9 nucleases and sequences include Cas9 sequences from organisms and loci disclosed in Chylinski K., Rhun AL, and Charpentier E., "ThetracrRNA and Cas9 families of type II CRISPR-Cas immunity systems." RNA Biol. 10:726-737 (2013); the entire contents of that document are incorporated herein by reference. In some embodiments, the Cas9 nuclease has an inactive (e.g., inactivated) DNA cleavage domain.

[0057] In some embodiments, Cas9 is engineered from *Streptococcus pyogenes* (GenBank reference number: AP014596.1). In some embodiments, Cas9 requires a PAM containing the NGG sequence in the target DNA sequence to enable its binding and catalytic activities. In some embodiments, Cas9 is further engineered to require a PAM different from the NGG sequence. In some embodiments, Cas9 is further engineered to not require a specific PAM (see, e.g., Walton RT, Christie KA, Whittaker MN, Kleinstiver BP "Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants." Science 368:290-296 (2020); the entire contents of this literature are incorporated herein by reference). In some embodiments, Cas9 is engineered from *Streptococcus pyogenes* and requires a PAM containing the NGG sequence in the target DNA sequence, is further engineered to require a PAM different from the NGG sequence, or is further engineered to not require a specific PAM.

[0058] Nuclease-inactive Cas9 proteins are interchangeably referred to as “dCas9” proteins (for nucleases—“dead” Cas9). Methods for generating Cas9 proteins (or fragments thereof) with inactive DNA-cutting domains are known (see, for example, Jinek et al., Science. 337:816-821 (2012); Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, Lim WA "Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression." Cell 152:1173-1183 (2013); the full text of each reference is incorporated herein by reference).

[0059] In some implementations, Cas9 refers to Cas9 derived from: Corynebacterium ulcerans ( Corynebacterium ulcerans (NCBI reference numbers: NC_015683.1, NC_017317.1); Corynebacterium diphtheriae ( Corynebacterium diphtheria (NCBI Reference Numbers: NC_016782.1, NC_016786.1); Protozoan esophagealis ( Spiroplasma syrphidicola (NCBI Reference Number: NC_021284.1); Prevotella intermedia ( Prevotella intermedia (NCBI Reference Number: NC_017861.1); Taiwan Spiroplasma ( Spiroplasma taiwanense (NCBI Reference Number: NC_021846.1); Dolphin Streptococcus ( Streptococcus iniae (NCBI Reference Number: NC_021314.1); Baltic Bellerella ( Belliella baltica (NCBI Reference Number: NC_018010.1); *Cyclophorus truncatula* I ( Psychroflexus torquisI (NCBI Reference Number: NC_018721.1); Streptococcus thermophilus ( Streptococcus thermophilus (NCBI Reference Number: YP_820832.1), harmless Listeria ( Listeria innocua (NCBI Reference No.: NP_472073.1), Campylobacter jejuni ( Campylobacter jejuni (NCBI Reference Number: YP_002344900.1) or Neisseria meningitidis ( Neisseria meningitidis(NCBI reference number: YP_002342100.1) or Cas9 from any other organism.

[0060] In some implementations, dCas9 corresponds to or contains, partially or entirely, a Cas9 amino acid sequence with one or more mutations that inactivate Cas9 nuclease activity. This Cas9 variant is able to generate single-strand DNA breaks (nicks) at specific locations based on target sequences defined by gRNA, leading to the repair of the unedited strand and ultimately resulting in a T-to-C transition on the unedited strand. A schematic diagram of this process is shown below. Figure 1A As shown. In short, and without wanting to be bound by any particular theory, the A in the AT base pair can be deaminated to inosine (I) by an adenosine deaminase (e.g., an engineered adenosine deaminase that deaminates adenosine in DNA). Cleavage of the non-edited strand containing T facilitates the removal of T via mismatch repair mechanisms. Inhibitory inosine-specific nucleases (dISNs) can inhibit inosine-specific nucleases (e.g., stereotactically), thereby preventing the removal of inosine (I).

[0061] In some embodiments, the nucleic acid programmable DNA-binding protein (napDNAbp) of any fusion protein provided herein may be a CasX or CasY protein. In some embodiments, napDNAbp is a CasX protein. In some embodiments, napDNAbp is a CasY protein.

[0062] As used herein, the term "effective amount" refers to an amount of bioactive agent sufficient to elicit the desired biological response. For example, in some embodiments, an effective amount of a nucleobase editor may refer to an amount sufficient to induce mutations in the target site through specific binding and mutation by the nucleobase editor. In some embodiments, an effective amount of a fusion protein (e.g., a fusion protein comprising a nucleic acid programmable DNA-binding protein and a deaminase domain (e.g., an adenosine deaminase domain) provided herein may refer to an amount sufficient to induce editing of the target site through specific binding and editing by the fusion protein. As those skilled in the art will understand, the effective amount of an agent (e.g., a fusion protein, nucleobase editor, deaminase, hybrid protein, protein dimer, protein (or protein dimer) and polynucleotide complex or polynucleotide) can vary depending on various factors, such as the desired biological response, the specific allele, genome, or target site to be edited, the targeted cell or tissue, and the agent used.

[0063] As used herein, the terms “nucleic acid” and “nucleic acid molecule” refer to compounds comprising nucleobases and an acidic moiety (e.g., nucleosides, nucleotides, or polymers of nucleotides). Typically, polymeric nucleic acids, such as nucleic acid molecules comprising three or more nucleotides, are linear molecules in which adjacent nucleotides are linked together by phosphodiester bonds. In some embodiments, “nucleic acid” refers to a single nucleic acid residue (e.g., a nucleotide and / or a nucleoside). In some embodiments, “nucleic acid” refers to a chain of oligonucleotides comprising three or more single nucleotide residues. As used herein, the terms “oligonucleotide” and “polynucleotide” are used interchangeably to refer to polymers of nucleotides (e.g., a string of at least three nucleotides). In some embodiments, “nucleic acid” includes RNA as well as single-stranded and / or double-stranded DNA. Nucleic acids can be naturally occurring, for example, in the context of genomes, transcripts, mRNA, tRNA, rRNA, siRNA, snRNA, plasmids, viscera, chromosomes, chromatids, or other naturally occurring nucleic acid molecules. On the other hand, nucleic acid molecules can be non-naturally occurring molecules, such as recombinant DNA or RNA, artificial chromosomes, engineered genomes or fragments thereof, or synthetic DNA, RNA, DNA / RNA hybrids, or include non-naturally occurring nucleotides or nucleosides.

[0064] Furthermore, the terms "nucleic acid," "DNA," "RNA," and / or similar terms include nucleic acid analogs, such as analogs having a non-phosphodiester backbone. Nucleic acids can be purified from natural sources, produced using recombinant expression systems, and optionally purified, chemically synthesized, etc. Where appropriate, such as in the case of chemically synthesized molecules, nucleic acids may contain nucleoside analogs, such as analogs with chemically modified bases or sugars, and backbone-modified analogs. Unless otherwise stated, nucleic acid sequences appear in a 5' to 3' orientation. In some embodiments, the nucleic acid is or comprises a natural nucleoside (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); or a nucleoside analogue (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, C5-propynylcytidine, C5-methylcytidine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynylur ...propynylcytidine, C5-methylcytidine, 2-aminoadenosine, C5-bromouridine, C5-propynylcytidine, C5-methylcytidine, C5-bromouridine, C5-propynylcytidine, C5-methylcytidine, C5-bromouridine, C5-propynylcytidine, C5-bromouridine, C5-propynylcytidine, C5-methylcytidine, C5-bromouridine, C5-propynylcytidine, C5-bromouridine, C5-propynylcytidine, C5-bromouridine, C5-propynylcytidine, C5-bromouridine, C5-propynylcytidine, C5-bromouridine, C α-Adenosine, 7-deadenosine, 7-deadenosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose and hexose); and / or modified phosphate groups (e.g., thiophosphates and 5'-N-phosphoramide bonds).

[0065] The terms “protein,” “peptide,” and “polypeptide” are used interchangeably herein and refer to polymers of amino acid residues linked together by peptide (amide) bonds. These terms refer to proteins, peptides, or polypeptides of any size, structure, or function. Typically, proteins, peptides, or polypeptides are at least three amino acids long. A protein, peptide, or polypeptide can refer to a single protein or a collection of proteins. One or more amino acids in a protein, peptide, or polypeptide can be modified, for example, by adding chemical entities such as carbohydrate groups, hydroxyl groups, phosphate groups, farnesyl groups, isofarnesyl groups, fatty acid groups, linkers for conjugation, functionalization, or other modifications. Proteins, peptides, or polypeptides can also be single-molecule or multi-molecule complexes. Proteins, peptides, or polypeptides can simply be fragments of naturally occurring proteins or peptides. Proteins, peptides, or polypeptides can be naturally occurring, recombinant, or synthetic, or any combination thereof. The term “fusion protein” as used herein refers to a hybrid polypeptide containing protein domains from at least two different proteins. A protein may be located at the amino-terminal (N-terminal) or carboxyl-terminal (C-terminal) portion of a fusion protein, thereby forming an "amino-terminal fusion protein" or a "carboxyl-terminal fusion protein," respectively. The protein may contain various domains, such as nucleic acid-binding domains (e.g., the gRNA-binding domain of Cas9 that guides protein binding to a target site) and nucleic acid-cutting domains or catalytic domains of nucleic acid-editing proteins. In some embodiments, the protein comprises a portion of the protein (e.g., the amino acid sequence constituting the nucleic acid-binding domain) and an organic compound (e.g., a compound that can act as a nucleic acid cleavage agent). In some embodiments, the protein forms a complex with or is conjugated with a nucleic acid (e.g., RNA). Any protein provided herein can be produced by any method known in the art. For example, the proteins provided herein can be produced by recombinant protein expression and purification, which is particularly suitable for fusion proteins containing peptide linkers. Methods for recombinant protein expression and purification are well known and include those described in Green and Sambrook, Molecular Cloning: A Laboratory Manual (4.sup.th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2012), the entire contents of which are incorporated herein by reference.

[0066] The terms “RNA-programmable nuclease” and “RNA-guided nuclease” are used interchangeably herein and refer to a nuclease that forms a complex (e.g., binds or conjugates) with one or more RNAs that are not cleavage targets. In some embodiments, when forming a complex with RNA, the RNA-programmable nuclease may be referred to as a nuclease:RNA complex. Typically, the bound RNA is referred to as guide RNA (gRNA). gRNA may exist as a complex of two or more RNAs or as a single RNA molecule. gRNA existing as a single RNA molecule may be referred to as a single guide RNA (sgRNA), although “gRNA” is used interchangeably to refer to guide RNA existing as a single molecule or as a complex of two or more molecules. Typically, gRNA existing as a single RNA species contains two domains: (1) a domain homologous to the target nucleic acid (e.g., guiding the binding of the Cas9 complex to the target), which may be referred to as a spacer region or spacer region sequence; and (2) a domain that binds the Cas9 protein. In some embodiments, domain (2) corresponds to a sequence called tracrRNA and contains a stem-loop structure. For example, in some implementations, domain (2) is identical or homologous to the tracrRNA provided by Jinek et al., Science 337:816-821 (2012), the entire contents of which are incorporated herein by reference. Other examples of gRNAs (e.g., those including domain 2) can be found in U.S. Provisional Patent Application USSN 61 / 874,682, filed September 6, 2013, entitled “Switchable Cas9 Nucleases And Uses Thereof,” and U.S. Provisional Patent Application USSN 61 / 874,746, filed September 6, 2013, entitled “Delivery System For Functional Nucleases,” the entire contents of which are incorporated herein by reference. Exemplary gRNAs and target sites for achieving sequence variations associated with the PKU phenotype are identified in Table 1. In some implementations, the gRNA comprises two or more domains and may be referred to as an "extended gRNA." For example, as described herein, an extended gRNA will, for instance, bind two or more Cas9 proteins and bind target nucleic acids in two or more distinct regions. The gRNA contains a nucleotide sequence complementary to the target site, which mediates the binding of the nuclease / RNA complex to the target site, providing sequence specificity for the nuclease:RNA complex.In some implementations, the RNA-programmable nuclease is a Cas9 endonuclease (of the CRISPR-related system), for example, Cas9 (Csn1) from Streptococcus pyogenes (see, for example, Ferretti JJ, McShan WM, Ajdic DJ, Savic DJ, SavicG., Lyon K., Primeaux C., Sezate S., Suvorov AN, Kenton S., Lai HS, LinS. P., Qian Y., Jia HG, Najar FZ, Ren Q., Zhu H., Song L., White J., Yuan X., Clifton SW, Roe BA, McLaughlin RE "Complete genome sequenceof an M1 strain of Streptococcus pyogenes." Proc. Natl. Acad. Sci. USA 98:4658-4663 (2001); Deltcheva E., Chylinski K., Sharma CM, Gonzales K., ChaoY., Pirzada ZA, Eckert MR, Vogel J., Charpentier E. "CRISPR RNAmaturation by trans-encoded small RNA and host factor RNase III." Nature 471:602-607 (2011); and Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna JA, Charpentier E. "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity." Science 337:816-821 (2012); the full text of each reference is incorporated herein by reference.

[0067] Because RNA-programmable nucleases (e.g., Cas9) use RNA:DNA hybridization to target DNA cleavage sites, in principle these proteins can target any sequence specified by the guide RNA. Methods for site-specific cleavage (e.g., genome modification) using RNA-programmable nucleases such as Cas9 are known in the art (see, for example, Cong, L. et al., "Multiplex genome engineering using CRISPR / Cas systems." Science 339:819-823 (2013); Mali, P. et al., "RNA-guided human genome engineering via Cas9." Science 339:823-826 (2013); Hwang, WY et al., "Efficient genome editing in zebrafish using a CRISPR-Cas system." Nature Biotechnology 31:227-229 (2013); Jinek, M. et al., "RNA-programmed genome editing in human cells." eLife 2:e00471 (2013); Dicarlo, JE et al., "Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems." Nucleic Acids Research 41:4336-4343). (2013); Jiang, W. et al. "RNA-guided editing of bacterial genomes using CRISPR-Cas systems." Nature Biotechnology 31:233-239 (2013); The full text of each reference is incorporated herein by reference.

[0068] As used herein, the term "subject" refers to an individual organism, such as an individual mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a rodent. In some embodiments, the subject is a sheep, goat, cow, cat, or dog. In some embodiments, the subject is a vertebrate, amphibian, reptile, fish, insect, fly, or nematode. In some embodiments, the subject is a laboratory animal. In some embodiments, the subject is genetically engineered, for example, a genetically engineered non-human subject. The subject can be male or female and can be at any stage of development.

[0069] The term "target site" refers to the sequence within a nucleic acid molecule that is deaminated by a deaminase or a fusion protein containing a deaminase (e.g., the dCas9-adenosine deaminase fusion protein provided herein).

[0070] As used herein, the term "treatment" refers to a clinical intervention designed to reverse, alleviate, delay the onset of a disease or condition or one or more symptoms thereof, or to inhibit its development. In some embodiments, treatment may be administered after one or more symptoms have developed and / or the disease has been diagnosed. In other embodiments, treatment may be administered in the absence of symptoms, for example, to prevent or delay the onset of symptoms or to inhibit the onset or development of the disease. For example, treatment may be administered to susceptible individuals before the onset of symptoms (e.g., based on a history of symptoms and / or based on genetic or other susceptibility factors). Treatment may also continue after symptoms have subsided, for example, to prevent or delay their recurrence.

[0071] As used in this document in the context of proteins or nucleic acids, the term "recombinant" refers to a protein or nucleic acid that is not naturally occurring but is a product of human engineering. For example, in some embodiments, recombinant protein or nucleic acid molecules contain at least one, at least two, at least three, at least four, at least five, at least six, or at least seven mutated amino acid or nucleotide sequences compared to any naturally occurring sequence.

[0072] In some embodiments, the present invention provides a method comprising delivering one or more polynucleotides, one or more vectors as described herein, one or more transcripts thereof, and / or one or more proteins transcribed therefrom into a host cell. In some aspects, the invention further provides cells produced by this method, and organisms comprising or produced from such cells (e.g., animals, plants, or fungi). In some embodiments, a CRISPR enzyme is delivered to a cell in combination with (and optionally in complex with) gRNA. Conventional virus- and non-virus-based gene transfer methods can be used to introduce nucleic acids into mammalian cells or target tissues. These methods can be used to apply nucleic acids encoding components of the CRISPR system to cultured cells or host organisms.

[0073] Non-viral vector delivery systems include DNA plasmids, RNA (e.g., transcripts of the vectors described herein), naked nucleic acids, and nucleic acids complexed with delivery media such as liposomes. Viral vector delivery systems include DNA and RNA viruses that have a free or integrated genome upon delivery to cells. For reviews of gene therapy procedures, see Anderson, Science 256:808-813 (1992); Nabel & Feigner, TIBTECH 11:211-217 (1993); Mitani & Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6:1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddadada et al., in Current Topics in Microbiology and Immunology Doerfler and Bihm (eds) (1995); and Yu et al., GeneTherapy 1:13-26 (1994).

[0074] Non-viral methods for nucleic acid delivery include lipid transfection, nuclear transfection, microinjection, biological projectiles, virions, liposomes, immunoliposomes, polycationic or lipid-nucleic acid conjugates, lipid nanoparticles, artificial virions, virus-like particles, naked DNA, and drug-enhanced DNA uptake. Lipid transfection is described in U.S. Patent Nos. 5,049,386, 4,946,787, and 4,897,355, and lipid transfection reagents are commercially available (e.g., Transfectam). TM and Lipofectin TM Efficient receptor recognition for polynucleotides is suitable for both cationic and neutral lipids transfected with lipids, including those from Feigner, WO 91 / 17424; WO 91 / 16024. Delivery can be to cells (e.g., in vitro or ex vivo) or to target tissues (e.g., in vivo).

[0075] Delivering gene-editing agents as ribonucleoproteins in vivo offers another approach and provides safety advantages over nucleic acid delivery methods. Engineered DNA-free virus-like particles (eVLPs) have been developed that efficiently package and deliver base editors or Cas9 ribonucleoproteins. By engineering VLPs to overcome bottlenecks in payload packaging, release, and localization, fourth-generation eVLPs have been developed to mediate efficient base editing in several major mouse and human cell types. The use of different glycoproteins in eVLPs alters their cytotropy. A single injection of eVLPs into mice supported therapeutic levels of base editing in multiple tissues, reducing serum Pcsk9 levels by 78% after 63% liver editing and partially restoring visual function in a mouse model of hereditary blindness. Off-target editing by eVLPs was virtually undetectable in vitro and in vivo, representing an improvement over AAV or plasmid delivery. Therefore, eVLPs offer a promising medium for therapeutic macromolecule delivery, combining the key advantages of both viral and non-viral delivery. See Banskota et al., Cell 185:250-265 (2021).

[0076] The preparation of lipid-nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to those skilled in the art (see, for example, Crystal, Science 270:404-410 (1995); Blaese et al., Cancer GeneTher. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820). (1992); U.S. Patent Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787. Other lipid nanoparticle formulations are disclosed in U.S. Patent Publications 2021 / 0106538 and 2021 / 0113466.

[0077] The use of RNA or DNA virus-based systems for nucleic acid delivery leverages highly evolved processes for targeting viruses to specific cells in vivo and transporting viral payloads to the cell nucleus. Viral vectors can be administered directly to patients (in vivo), or they can be used to treat cells in vitro, and the modified cells can optionally be administered to patients (ex vivo). Traditional virus-based systems can include retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, and herpes simplex virus vectors for gene transfer. Retroviral, lentiviral, and adeno-associated virus gene transfer methods can integrate into the host genome, typically resulting in long-term expression of the inserted transgene. Furthermore, high transduction efficiency has been observed in many different cell types and target tissues.

[0078] Retroviral tropism can be altered by incorporating exogenous envelope proteins to expand the potential target population of target cells. Lentiviral vectors are retroviral vectors capable of transducing or infecting non-dividing cells and typically produce high viral titers. Therefore, the choice of retroviral gene transfer system will depend on the target tissue.

[0079] Retroviral vectors contain cis-acting long terminal repeats (LTRs) with a packaging capacity of up to 6–10 kb of exogenous sequence. Minimal cis-acting LTRs are sufficient to replicate and package the vector, which can then be used to integrate therapeutic genes into target cells to provide permanent transgene expression. Widely used retroviral vectors include those based on murine leukemia virus (MuLV), gibberish leukemia virus (GaLV), simmon immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, for example, Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992); Sommnerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT / US94 / 05700).

[0080] In applications where transient expression is preferred, adenovirus-based systems can be used. Adenovirus-based vectors exhibit very high transduction efficiency in many cell types and do not require cell division. High titers and high levels of expression have been obtained using such vectors. These vectors can be mass-produced in relatively simple systems.

[0081] Adeno-associated virus (“AAV”) vectors can also be used to transduce cells with target nucleic acids, for example, in the in vitro production of nucleic acids and peptides, and for in vivo and in vitro gene therapy procedures (see, for example, West et al., Virology 160:38-47 (1987); U.S. Patent No. 4,797,368; WO 93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994)). Several different AAV serotypes have been used for transduction in mammalian cells; these include, for example, AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9, which have different tropisms for target cell types.

[0082] The construction of recombinant AAV vectors has been described in numerous publications, including U.S. Patent No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989). In some preferred embodiments, the viral vector is a split AA8 vector or a split AAV9 vector.

[0083] Packaging cells are typically used to form viral particles capable of infecting host cells. These cells include HEK 293 cells for packaging adenoviruses and Y2 or PA317 cells for packaging retroviruses. Viral vectors used in gene therapy are typically generated by producing cell lines that package nucleic acid vectors into viral particles. These vectors usually contain the minimum viral sequence required for packaging and subsequent integration into the host, with other viral sequences replaced by expression cassettes of the polynucleotides to be expressed. The missing viral function is typically provided trans-by the packaging cell lines.

[0084] For example, AAV vectors used in gene therapy typically only have the ITR sequence from the AAV genome required for packaging and integration into the host genome. Viral DNA is packaged in a cell line containing helper plasmids encoding other AAV genes (i.e., rep and cap) but lacking the ITR sequence. Adenovirus can also be used as a helper to infect these cell lines. The helper virus promotes the replication of the AAV vector and the expression of AAV genes in the helper plasmid. Due to the lack of the ITR sequence, the helper plasmid is not packaged in large quantities. Adenovirus contamination can be reduced, for example, by heat treatment; adenovirus is more sensitive to heat treatment than AAV.

[0085] In some embodiments, host cells are transiently or non-transiently transfected with one or more vectors described herein. In some embodiments, cells are transfected as if they were naturally present in the subject. In some embodiments, the transfected cells are taken from the subject. In some embodiments, the cells are derived from cells taken from the subject, such as cell lines.

[0086] On one hand, the present invention provides a method for modifying target polynucleotides in eukaryotic cells, the method being in vivo, in vitro, or ex vivo. In some embodiments, the method includes sampling cells or cell populations from human or non-human animals and modifying one or more cell types. In vitro culture can be performed at any stage. One or more cell types can be reintroduced into human or non-human animals.

[0087] On one hand, the present invention provides a method for modifying target polynucleotides in eukaryotic cells. In some embodiments, the method includes allowing an adenine base editor (ABE) CRISPR complex to bind to the target polynucleotide to correct mutations in the target polynucleotide, thereby modifying the target polynucleotide, wherein the CRISPR complex comprises an ABE CRISPR enzyme complexed with gRNA that hybridizes to a target sequence in the target polynucleotide.

[0088] On one hand, the present invention provides kits containing any one or more components disclosed in the methods and compositions described above. In some embodiments, the kit includes a vector system or components for alternative delivery systems, such as those described above, and instructions for use of the kit. In some embodiments, the vector or delivery system comprises an ABE CRISPR enzyme complexed with gRNA for editing target nucleic acid bases.

[0089] The kit may contain a lipid nanoparticle formulation encapsulating a suitable base editor and at least one gRNA. Components may be provided individually or in combination and may be supplied in any suitable container, such as vials, bottles, or test tubes. In some embodiments, the kit includes instructions in one or more languages, for example, more than one language.

[0090] In some embodiments, the kit includes one or more reagents for use in the process of utilizing one or more components described herein. Reagents may be provided in any suitable container. For example, the kit may provide one or more reaction or stock buffers. Reagents may be provided in a form suitable for a specific assay or in a form requiring the addition of one or more other components prior to use (e.g., in concentrated or lyophilized form). Buffers may be any buffer, including but not limited to sodium carbonate buffer, sodium bicarbonate buffer, borate buffer, Tris buffer, MOPS buffer, HEPES buffer, and combinations thereof. In some embodiments, the buffer is alkaline. In some embodiments, the pH of the buffer is from about 7 to about 10. In some embodiments, the kit contains one or more oligonucleotides corresponding to a gRNA sequence for insertion into a vector to operatively link the gRNA sequence and regulatory elements. In some embodiments, the kit contains homologous recombinant template polynucleotides.

[0091] On one hand, the present invention provides a method for using one or more elements of a CRISPR system. The CRISPR complex of the present invention provides an efficient means of modifying target polynucleotides. The CRISPR complex of the present invention has a wide variety of uses, including in gene therapy methods for modifying (e.g., deletion, insertion, translocation, inactivation, activation) target polynucleotides in various cell types.

[0092] As used herein, the term "metabolic gene" is defined as a hereditary single-gene abnormality, i.e., a defect in a single gene encoding an enzyme, resulting in an enzyme deficiency. Enzyme deficiencies lead to hereditary metabolic diseases or conditions, one subtype of which is congenital metabolic disorder. Most single-gene abnormalities are autosomal recessive, meaning that the development of the disease or trait requires the presence of two defective copies of the gene. Non-restrictive examples of metabolic disorders include glucose metabolism disorders, lipid metabolism disorders, malabsorption syndromes, metabolic brain disorders, calcium metabolism disorders, DNA repair defects, hyperlactatemia, iron metabolism disorders, metabolic syndrome X, congenital metabolic disorder, phosphorus metabolism disorders, and acid-base imbalances. Hereditary metabolic diseases were previously classified as carbohydrate metabolism disorders, amino acid metabolism disorders, organic acid metabolism disorders, or lysosomal storage disorders; however, new hereditary metabolic diseases have been discovered, and the number of types has multiplied.Certain major categories of congenital metabolic disorders include carbohydrate metabolism disorders, such as glycogen storage disease, glucose-6-phosphate dehydrogenase (G6PD) deficiency (caused by mutations in the G6PD gene); amino acid metabolism disorders, such as phenylketonuria, maple syrup diabetes, and glutaric acidemia type 1; urea cycle disorders (urea cycle defects), such as carbamoyl phosphate synthase I deficiency; organic acid metabolism disorders (organic aciduria), such as alcaptonuria and 2-hydroxyglutaric aciduria; fatty acid oxidation and mitochondrial metabolism disorders, such as medium-chain acyl-CoA dehydrogenase deficiency (often called "MCADD") (caused by mutations in the ACADM gene, leading to abnormal medium-chain fatty acid metabolism and causing somnolence and hypoglycemia); porphyrin metabolism disorders, such as acute intermittent porphyria; and purine or pyrimidine metabolism disorders, such as Lesch-Nyhan syndrome (caused by mutations in hypoxanthine phosphoribosyltransferase I). [HPRT1] gene mutations, inherited in an X-linked recessive manner; steroid metabolic disorders, such as congenital adrenal hyperplasia of the lipids, congenital adrenal hyperplasia; mitochondrial dysfunction disorders, such as Keams-Sayre syndrome; peroxisome dysfunction disorders, such as Zellweger syndrome (caused by mutations in genes encoding peroxisome proteins, such as PEX1, PEX2, PEX3, PEX5, PEX6, PEX10, PEX12, PEX13, PEX14, PEX16, PEX19, or PEX26 genes); and lysosomal storage disorders, such as Gaucher disease (with three subtypes, all autosomal recessive) and Niemann-Pick disease (with an autosomal recessive inheritance pattern; Niemann-Pick A and B are caused by mutations in the sphingomyelin phosphodiesterase 1 [SMPD1] gene; mutations in the NPC1 or NPC2 gene lead to Niemann-Pick disease, and type C [NPC] affects a protein used to transport lipids; Niemann-Pick Type D shares a specific mutation in the NPC1 gene, and patients with type D share a common Nova Scotia ancestor.

[0093] In some aspects, an adenine base editor (ABE) complex is provided for the programmed conversion of adenine to guanine in patients in need, wherein the patients have target DNA molecules containing mutations associated with phenylketonuria. An exemplary ABE complex includes a modified TadA enzyme, a catalytically inactivated Cas9 protein, and at least one single-guide RNA (sgRNA) that directs the ABE complex to the mutated target DNA molecule, which, upon contact, converts the mutated adenosine to inosine, thereby catalyzing DNA repair or the AT-GC conversion after DNA replication.

[0094] The activity window of each ABE typically spans several positions within the protospacer DNA sequence (e.g., the ABE8.8 window ranges from position 3 to 9, with peak editing observed at position 6 in the protospacer), and different ABEs have different windows (Anzalone et al., 2020). An ABE has the potential to edit any adenine within its window, which can include the desired target adenine or unintended additional adenine (bystander editing). Published ABEs containing the Cas9 nickase from *Streptococcus pyogenes* include so-called eighth-generation ABEs (containing an optimized deaminase domain derived from eight rounds of molecular evolution)—most commonly ABE8.8, ABE8.20, and ABE8e to date—and cyclic substitution or in-line ABEs, in which the deaminase domain is embedded within the loop of the Cas9 nickase protein rather than fused to the N-terminus, which has the effect of shifting the editing window further toward the 3' end of the original spacer sequence (Gaudelli et al., 2020; Richter et al., 2020; Chu et al., 2021). Similar ABEs containing the Cas9 nickase from other bacterial species (e.g., *Staphylococcus aureus*) have also been reported (Gaudelli et al., 2020; Richter et al., 2020).

[0095] Filtering methods Using the compositions and methods described herein, methods can be used to identify effective adenosine base editor (ABE) / guided polynucleotide editing complexes for correcting mutations. In some embodiments, the screening technique includes using host cells with the target mutation. In some embodiments, the method includes a) contacting cells containing a control mutation with a control ABE / guided polynucleotide editing complex that edits the control mutation; b) contacting cells containing the target mutation with a test ABE / guided polynucleotide editing complex that edits the target mutation; c) comparing the correcting activity of the control ABE / guided polynucleotide editing complex with the correcting activity of at least one test ABE / guided polynucleotide editing complex; and e) identifying the test ABE / guided polynucleotide editing complex having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100% or more of the correcting activity of the control ABE / guided polynucleotide editing complex. In some embodiments, the method further includes comparing the bystander editing levels of the test ABE / guided polynucleotide editing complex with the bystander editing levels of the control ABE / guided polynucleotide editing complex.

[0096] "Screening" of candidate editing complexes refers to performing assays that can evaluate the efficacy and / or specificity of the candidates. In this context, "efficacy" refers to the ability of a candidate to affect the cells or organism to which it is applied in a beneficial manner: for example, correcting target mutations.

[0097] A “target mutation” refers to a change in the DNA sequence associated with a specific disease or biological process. In some embodiments, the target mutation is a disease-associated mutation. A “disease-associated mutation” is a change in the DNA sequence of a gene that results in a person having or being at risk of developing a genetic disease or condition. In some embodiments, the disease-associated mutation is a mutation associated with PKU. In some embodiments, the target mutation is selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), and c.728G>A (p.Arg243Gln). In some embodiments, the method includes identifying the effect of one or more test ABE / guided polynucleotide editing complexes on a single target mutation. In some embodiments, the method includes identifying the effect of one or more test ABE / guided polynucleotide editing complexes on multiple target mutations.

[0098] The terms "pharmaceutical" and "test adenosine base editor / guided polynucleotide editing complex" are used interchangeably herein to refer to a combination of a base editor and a guide polynucleotide that exhibits the ability to correct target mutations. The potential corrective activity of the pharmaceutical is evaluated by inclusion in the screening assays described herein. In some embodiments, the test adenosine base editor / guided polynucleotide editing complex comprises the guide polynucleotides described in Table 1 and / or the base editors described in Table 2.

[0099] The term "control mutation" refers to a known mutation that, when exposed to a specific ABE / guided polynucleotide editing complex, possesses previously validated corrective activity. In some embodiments, the control mutation is treated with an ABE / gRNA editing complex that has previously been shown to have therapeutically effective activity against the control mutation. In some embodiments, the control mutation is c.842C>T (p.Pro281Leu) or c.1222C>T (p.Arg408Trp). In some embodiments, the control mutation can be corrected with at least about 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, or 10% corrective activity.

[0100] The term "control ABE / guided polynucleotide editing complex" refers to a combination of a base editor and a guide polynucleotide that exhibits pre-validated corrective activity against control mutations. In some embodiments, the control ABE / guided polynucleotide editing complex can correct control mutations with at least about 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, or 10% corrective activity.

[0101] The term "correction activity" refers to the editing efficiency of the ABE / guided polynucleotide editing complex. In some embodiments, correction activity can be calculated using the following formula: (# of corrected cells / total # of cells in contact with the ABE / guided polynucleotide editing complex) * 100. In some embodiments, if the tested ABE / gRNA editing complex exhibits at least 50%-100% of the correction activity of the control ABE / gRNA editing complex, the complex is identified as a corrector for the target mutation. In some embodiments, if the tested ABE / gRNA editing complex exhibits at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the correction activity of the control ABE / gRNA editing complex, then the complex is identified as a corrector for the target mutation. In some embodiments, if the tested ABE / gRNA editing complex exhibits higher correction activity than the control ABE / gRNA editing complex, then the complex is identified as a corrector for the target mutation.

[0102] Materials and methods The following materials and methods are provided to facilitate the implementation of this invention.

[0103] For prime editing, the prime editor (PEmax) was expressed using the pCMV-PEmax-P2A-hMLH1dn plasmid (Addgene #174828), and the prime editing guide RNA (pegRNA)—used for insertion into the PAH c.1222C>T variant—was expressed using the pU6-tevopreq1-GG-receptor plasmid (Addgene #174038). Following the pegRNA sequence synthesized from Gibson cloning oligonucleotides, and following the ngRNA sequence synthesized from subcloning oligonucleotides, the nick guide RNA (ngRNA) was expressed using the pGuide plasmid (Addgene #64711). For base editing, several plasmids expressing adenine base editors (ABEs) were used, including: SpG-ABE8e (Addgene #185911), SpG-ABE8.20 (Addgene #185916), SpRY-ABE8e (Addgene #185912), SpRY-ABE8.20 (Addgene #185917), and SpRY-ABE8.8 (composed of components from Addgene #185912 and Addgene #136294). Following the subcloned oligonucleotide synthesis of the gRNA sequence, each accompanying guide RNA (specific to the PAH c.1222C>T variant) was expressed using the pGuide plasmid (Addgene #64711). Lentiviral particles were produced using the lentiGuide-Puro plasmid (Addgene #52963).

[0104] The following table provides the sequences encoding exemplary adenine base editors (ABEs) used in these embodiments: A commercial supplier (Agilent) chemically synthesized 100-mer PAH4 gRNA under solid-phase synthesis conditions, followed by end-modification and multiple 2'-O-methylribose modifications. PAH4, 5'-mG*mG*mC*CAAGGUAUUGUGGCAGCGUUUUAGAmGmCmUmAmGmAmA mAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmCmUmUmGmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU-3'; (SEQ ID NO: 77) Where "m" and * represent 2'-O-methylation and phosphate thioester bonds, respectively. SpRY-ABE8.8 mRNA was generated via in vitro transcription (IVT) and purification. Briefly, a plasmid DNA template containing a codon-optimized SpRY-ABE8.8 coding sequence (SEQ ID NO: 78) expressing the SpRY-ABE8.8 protein and a 3' polyadenylated sequence was linearized. An IVT reaction containing the linearized DNA template, T7 RNA polymerase, NTP, and cap analogue was performed to generate mRNA containing N1-methylpseuuridine. After digestion of the DNA template with DNase I, the mRNA product was purified and buffer-exchanged, and the purity of the final mRNA product was assessed by spectrophotometry and capillary gel electrophoresis. Elimination of double-stranded RNA contaminants was assessed using dot blot and transfection into human dendritic cells. Endotoxin content was measured using chromogenic horseshoe crab lysate (LAL) assay; all assays were negative.

[0105] Lipid nanoparticles (LNPs) were formulated as described previously. The lipid components (SM-102, 1,2-distearate-sn-glycerol-3-phosphocholine, cholesterol, and PEG-lipids) were rapidly mixed with an aqueous buffer solution containing ABE8.8 mRNA and PAH4 gRNA in a 1:1 weight ratio in 25 mM sodium acetate (pH 4.0). The resulting LNP formulation was then dialyzed against a sucrose-containing buffer, concentrated using an Amicon Ultra-15 mL centrifuge-filtration unit (Millipore Sigma), aseptically filtered using a 0.2 µm filter, and frozen until use.

[0106] HuH-7 human hepatocellular carcinoma cells were obtained from the Japan Research Biobank (JCRB) cell bank and maintained in DMEM containing 1 g / L glucose and supplemented with 10% FBS (Thermo Fisher). HuH-7 cells were maintained in Dulbecco's modified Eagle medium (containing 4 mM L-glutamine and 1 g / L glucose) containing 10% fetal bovine serum and 1% penicillin / streptomycin at 37°C and 5% CO2. To prepare homozygous R408W HuH-7 clones, HuH-7 cells were cultured at 3.5 × 10⁶ cells per well.5 Cells were seeded in 6-well Corning plates. 16–24 hours post-seeding, cells were inoculated with 9 μL of TransIT. ® Cells at approximately 80-90% confluency were transfected with LT1 transfection reagent, 1.5 μg PEmax plasmid, 0.75 µg epegRNA expression plasmid, and 0.75 μg nick gRNA plasmid. Forty-eight hours post-transfection, cells were lysis with trypsin and re-coated onto 10-cm plates (5,000 cells / plate) in conditioned medium to facilitate recovery. Genomic DNA was isolated from the remaining cells to prepare a library for PCR and Sanger sequencing at the PAH locus of the c.1222C>T variant. Single-cell amplification was allowed for 7-14 days to establish a clonal population. Colonies were manually selected and re-coated into individual wells of 96-well plates. Genomic DNA was isolated from individual clones for PCR and Sanger sequencing to identify homozygous R408W HuH-7 clones. A representative clone was amplified for subsequent studies.

[0107] To prepare HuH-7 cells carrying six PAH variants (c.1222C>T, c.842C>T, c.1066-11G>A, c.782G>A, c.728G>A, and c.1315+1G>A), single DNA cassettes containing genomic fragments flanking each of these variants were subcloned into the lentiGuide-Puro plasmid using standard techniques. This plasmid was then used to generate lentiviral particles using standard techniques. Wild-type HuH-7 cells were treated with the lentiviral particles and selected with puromycin at a concentration of 2 µg / mL in culture medium for 5 to 7 days. The cells were then expanded for subsequent studies.

[0108] To evaluate base editing of the PAH c.1222C>T variant, homozygous R408W HuH-7 cells were cultured at 3.5 × 10⁻⁶ cells per well. 5 Cells were seeded in 6-well plates (Corning). Following the manufacturer's instructions, 16–24 hours after seeding, 9 μL of TransIT was added. ®Cells at approximately 80-90% confluency were transfected with LT1 transfection reagent (MIR2300, Mirus), 2 μg PEmax plasmid, 2 μg base editor plasmid, and 1 μg RNA plasmid. Similar conditions were used to evaluate base editing of the PAH variant in lentivirally infected HuH-7 cells. In other experiments, different doses of LNP (quantified by the total amount of RNA in the LNP) were added directly to the culture medium. Cells were cultured for 72 hours after transfection, then the culture medium was removed, cells were washed with 1× DPBS (Corning), and genomic DNA was isolated using the DNeasy Blood and Tissue Kit (QIAGEN) according to the manufacturer's instructions.

[0109] Using NEBnext High Fidelity 2X PCR premix (New England Biolabs), PCR amplification was performed on target sequences (PAH locus at the c.1222C>T variant site, or the cassette introduced by lentiviral infection) from genomic DNA samples of transfected HuH-7 cells using locus-specific primers containing the 5' Nextera adapter sequence (Illumina). The PCR amplicon was then purified using an NGS-normalized 96-well kit (Norgen Biotek). A second round of PCR was performed using the Nextera XT Index Kit V2 Kit A and / or the Nextera XT Index Kit V2 Kit D (Illumina), followed by purification using an NGS-normalized 96-well kit to generate barcode libraries, which were then pooled and quantified using a Qubit 3.0 fluorometer. After denaturation, dilution to 10 pM, and supplementation with 15% PhiX, the pooled libraries were subjected to single-end or paired-end next-generation sequencing on an Illumina MiSeq system. Amplicon sequencing data were analyzed using CRISPResso2 v2 (available at crispresso.pinellolab.partners.org / ) and a custom script. For target editing, A- to G editing was quantified at the sites of the R408W variant (position 5 of the PAH4 protospacer region sequence) and potential bystander adenine editing sites (positions 6 and 10 of the PAH4 protospacer region sequence). In some cases, PCR amplicon sequencing was performed using confirmatory Sanger sequencing by GENEWIZ, and editing frequencies were estimated from chromatograms.

[0110] Using in vitro transcribed Cas9 mRNA, synthetic gRNA (spacer sequence 5'-AGCGAACGGAGAAGGGCCGG-3' (SEQ ID NO: 79)) (Integrated DNA Technologies), and synthetic single-stranded DNA oligonucleotides (Integrated DNA Technologies), a PKU mouse model with one or more humanized PAHR408W alleles was generated, wherein the single-stranded DNA oligonucleotides have homologous arms matching the target site and contain R408W variants and synonymous variants (bold and underlined): 5'-AAAAGCCACTTGGAACTCCTCCAGGATAACCTGTCTTAAATGGGTGTCCTTCACTGGGGTCCTTGGTTTTGGTTTCAGGA AC TTTGCTGCCACAAT A CC TT GGCCCTTCTC A GTTCGCTA C GACCCCTACACTCAAAGGGTTGAGGTCCTGGACAATACTCAGCAGTTGAAGATTTTAGCTGACTCCATTAATAGTAAGT-3' (SEQ ID NO:80). A mixture of the three components was injected into the cytoplasm of fertilized oocytes from C57BL / 6J mice in the Penn Vet transgenic mouse core (available at: vet.upenn.edu / research / core-resources-facilities / transgenic-mouse-core). The desired sequence knock-in at the Pah locus was screened in genomic DNA samples from the first founders using homologous directed repair. Homozygous mice were obtained by breeding the first founders with the humanized R408W allele for two generations.

[0111] Different PKU mouse models possessing one or more humanized PAH R408W alleles were generated through homologous recombination in mouse embryonic stem cells, followed by blastocyst injection, chimera generation, and subsequent proliferation, such as... Figure 7 As shown.

[0112] Through timed breeding, in some cases using wild-type C57BL / 6J mice (reservation number 000664) obtained from the Jackson laboratory, homozygous and compound heterozygous humanized PKU mice, as well as heterozygous humanized non-PKU mice, were generated as littermates / group pups. Genotyping was performed using PCR amplification of genomic DNA samples (prepared from clipped tails / ears), followed by next-generation sequencing. LNPs were administered to mice via retro-orbital injection under 1%–2% inhaled isoflurane anesthesia. In short-term studies, mice were euthanized one week after treatment, and eight liver samples (two from each lobe) and samples from other organs were obtained at necropsy and processed using the DNeasy Blood and Tissue Kit (QIAGEN) according to the manufacturer's instructions to isolate genomic DNA. Next-generation sequencing results from liver samples were averaged to provide quantification of whole-liver editing. Blood samples were collected early in the afternoon via tail tips at different time points (pre-treatment, day 1, day 2, day 3, and day 7) to illustrate diurnal variations in blood phenylalanine levels.

[0113] According to the manufacturer's instructions, serum phenylalanine levels were measured enzymatically using the phenylalanine assay kit (MAK005, Millipore Sigma). Briefly, plasma samples were deproteinized using a 10 kDa MWCO rotary filter (CLS431478-25EA, Millipore Sigma) and pretreated with 5 µL of tyrosinase for 10 minutes at room temperature before starting the assay. The reaction mixture was prepared according to the manufacturer's instructions, and the fluorescence intensity of each sample was measured (λex = 535 / λem = 587 nm).

[0114] Mice were euthanized by inhaling CO2 during tissue collection. For next-generation sequencing (NGS), PCR was performed using NEBNext polymerase (NEB) and locus-specific primers (Illumina) containing the 5' Nextera adapter sequence. The following procedure was used for PCR of all genomic DNA: 98°C for 20 seconds, 35× (98°C for 20 seconds, 57°C for 30 seconds, 72°C for 10 seconds), 72°C for 2 minutes. PCR products were observed by capillary electrophoresis (QIAxcel, QIAGEN) and then purified and normalized using an NGS normalization 96-well kit (Norgen Biotek Corporation). Using approximately 15 ng of the first-round PCR product as a template, a second barcode PCR was performed to add Illumina barcodes (Nextera XT Index Kit V2 Kit A and / or Nextera XT Index Kit V2 Kit D), followed by purification and normalization. The final merged libraries were quantified using a Qubit 3.0 fluorometer (Thermo Fisher Scientific), and then denatured, diluted to 10 pM, and supplemented with 15% PhiX before single-end or paired-end sequencing on an Illumina MiSeq system. Amplicon sequencing data were analyzed using CRISPResso2 v2 and a custom script to quantify edits. For on-target edits, A- to G edits were quantified at sites on the R408W variant (position 5 of the PAH4 protospacer region) and at potential bystander adenine edit sites (positions 6 and 10 of the PAH4 protospacer region).

[0115] The following examples are provided to illustrate certain embodiments of the present invention. They are not intended to limit the invention in any way.

[0116] Example 1 Meta-analysis and corrected activity of screening ABE in PKU patients with PAH c.1222C>T variant Gene editing methods and compositions include CRISPR-Cas9 and Cas12 nucleases (Jinek et al., 2012; Zetsche et al., 2015; Strecker et al., 2019), CRISPR cytosine base editors (Komor et al., 2016), CRISPR adenine base editors (Gaudelli et al., 2017), and CRISPR leader editors (Anzalone et al., 2019).

[0117] CRISPR base editors are an attractive mode of gene editing because, compared to CRISPR-Cas9 and other gene-editing nucleases, they can efficiently deliver precise, targeted alterations without requiring double-strand breaks. Figure 1A , Figure 1B Adenine base editors (ABEs) can induce targeted A→G editing (relative to T→C on the strand) in DNA. Each ABE uses its core Cas9 nickase protein and guide RNA (gRNA) to ligate a double-stranded protospacer DNA sequence, flanking it with a protospacer adjacent motif (PAM) sequence at its 3' end. Some ABEs use a core Cas9 nickase protein that is engineered to adapt to a variety of PAM sequences, making it more flexible in target site selection. For example, standard Streptococcus pyogenes Cas9 has a PAM preference for NGG, but SpG-Cas9 has a loose PAM preference for NGN, while SpRY-Cas9 is “near-PAM-free” and can be used with almost any PAM while still using standard Streptococcus pyogenes gRNA (Walton et al., 2020). Other engineered core Cas9 nickase proteins have highly specific PAM preferences for sequences other than NGG (e.g., NGA, NGCG, NGCA, NAA, or NAAG).

[0118] Unlike Cas9 and Cas12, ABE does not produce double-strand breaks and carries minimal risk of inducing large deletions, chromosomal abnormalities, and chromosomal breakage (fragmentation). Instead, each ABE uses an evolved deoxyadenosine deaminase domain—typically fused to the N-terminus of the Cas9 nickase—to chemically modify an adenosine nucleoside on one strand of DNA. This (combining with the nick on the other strand) enables highly precise and efficient A→G conversion mutations at the target site.

[0119] Phenylketonuria (PKU) is an autosomal recessive disorder caused by a mutation in the gene encoding phenylalanine hydroxylase (PAH). Because phenylalanine (Phe) cannot be converted to tyrosine, Phe accumulates to neurotoxic levels. Untreated PKU can present with serum Phe levels >1200 μmol / L. However, current treatment guidelines recommend that serum phenylalanine levels should ideally be maintained in the range of 120–360 µmol / L (Vockley et al., 2014). Existing treatment options range from strict low-Phe diets to oral medications (saproterenol, a cofactor for PAH) to injectable enzyme replacement therapy (pegvorin). All of these are chronic, daily interventions that patients must adhere to for life to prevent cognitive impairment and a range of neuropsychiatric complications. The burden of intensive Phe control and monitoring faced by PKU patients and their families is immense, especially with the unpleasant and costly treatments. Many PKU patients' failure to adhere to guidelines is not only a serious risk but also common and therefore to be expected. Studies have shown that over 70% of adults with PKU do not adhere to treatment (Jurecki et al., 2017). Therefore, there is a need for durable and ideal curative therapies to maximize the medical needs of PKU patients.

[0120] Of the more than 1,000 PAH variants that have been classified in patients (Regier and Greene, 2017), the most common pathogenic factors associated with classic PKU are transition mutations, specifically G→A or C→T variants on the sense or antisense strand (Hillert et al., 2020). Therefore, each of these variants is potentially correctable through gene editing. For example, adenine base editing can engineer site-specific A→G changes on any DNA strand (Gaudelli et al., 2017), effectively correcting each of these variants. The PAH c.1222C>T (p.Arg408Trp, R408W) variant is by far the most common pathogenic factor for PKU worldwide. The PAH c.1222C>T variant is most prevalent in European populations (e.g., present in 98.9% of PKU patients in Estonia, 89.2% in Poland, 75.7% in Russia, 43.6% in Sweden and 35.7% in Germany), Australia (34.7%) and the United States (32.9%) (Hillert et al., 2020).

[0121] Patients homozygous for the PAH c.1222C>T variant have the most severe form of PKU and are generally unresponsive to sapropterin (Leuders et al., 2014), limiting their treatment options. Patients with the R408W variant do respond to pegovilase, a once-daily injected bacterial enzyme that directly metabolizes Phe, despite a significant risk of allergic reactions. However, in clinical trials, PKU patients receiving pegovilase experienced only a 51% reduction in Phe on average one year after starting treatment (from 1233 μmol / L to 565 μmol / L), meaning that most patients did not reach the guideline-guided Phe target of <360 µmol / L (Burton et al., 2020).

[0122] To determine adherence to Phe treatment and monitoring goals in PKU patients with the PAH R408W variant, real-world data from a PKU cohort managed by an academic medical center metabolic clinic were analyzed. Of 129 PKU patients followed up at the Children's Hospital of Philadelphia (CHOP) metabolic clinic, 32 (24.8%) were found to be compound heterozygous for the PAH R408W allele, while 4 (3.1%) were homozygous for the variant. This may underestimate the true prevalence of R408W, as genotypic information was unavailable for some older PKU patients.

[0123] The consensus management guidelines from the American College of Medical Genetics recommend maintaining Phe levels in PKU patients within the range of 120–360 µmol / L (Vockley et al., 2014). Levels above 600 µmol / L may be neurotoxic and are associated with poorer psychiatric and neurocognitive outcomes (Romani et al., 2019; Ashe et al., 2019; Thomas et al., 2023). In the study cohort, 33 out of 36 treated patients (91.6%) had at least one Phe level above 360 ​​µmol / L, and 25 out of 36 patients (69.4%) had at least one Phe level above 600 µmol / L. Figure 2 In addition, 10 of the 36 patients (27.7%) had lifetime mean Phe levels above 360 ​​µmol / L. Four patients homozygous for the R408W allele showed particularly poor metabolic control.

[0124] In addition to high Phe levels, patients with the R408W variant exhibit poor adherence to Phe monitoring protocols. While the exact recommended intervals may vary depending on clinical circumstances, general guidelines include weekly Phe monitoring before age 1, every 2 weeks for children aged 1–12, and every 2–4 weeks for adolescents and adults. Figure 3(gray box) (Vockley et al., 2014). Calculate the time interval in the queue since the last recording of each Phe measurement ( ). Figure 3 (Black dots). For 1,556 (61.3%) of the 2,535 measured Phe values, the intervals between monitoring laboratories were longer than recommended. These data collectively suggest that most patients with the R408W variant have poor metabolic control and are at risk of chronic neurological damage, providing a strong theoretical basis for a one-off, definitive gene-editing therapy to correct the PAH R408W variant in the liver.

[0125] Existing research has demonstrated the feasibility of adenine base editing as an in vivo therapeutic approach. Most notably, lipid nanoparticles (LNPs) have been shown to efficiently deliver adenine base editors encoded in mRNA to the livers of non-human primates (Musunuru et al., 2021; Rothgangl et al., 2021). The adenine base editors effectively introduced loss-of-function variants into the PCSK9 cholesterol-regulating gene, achieving saturation editing of hepatocytes in the liver and reducing PCSK9 protein by approximately 90% without any adverse health consequences (Musunuru et al., 2021). In a recent clinical trial, LNP-mediated delivery of a nuclease editor (CRISPR-Cas9) to the liver to introduce loss-of-function mutations into the target gene (TTR) was safe and well-tolerated, resulting in a reduction of protein product (transthyretin) by up to 96% (Gillmore et al., 2021). Therefore, a wide range of editing therapies can now be developed to improve symptoms of various diseases for which genetic alterations in the liver are curative.

[0126] For PCSK9, the goal was to edit the wild-type gene, which is endogenous in primary human hepatocytes or cultured hepatocyte lines of any origin. In contrast, for PAH, the goal was to correct the rare human mutation c.1222C>T (Figure 4). However, there are no readily available primary human hepatocytes or cultured hepatocyte lines carrying this variant. Furthermore, due to the limited proliferative capacity of primary human hepatocytes or their limited ability to persist in culture for more than a few days, it is not possible to edit this variant into hepatocytes to allow subsequent testing of the variant's correction. Therefore, a leader editor was used to introduce the PAH R408W variant into HuH-7 human hepatocellular carcinoma cells, which have the advantages of being hepatocyte-like cells that proliferate indefinitely in culture, are highly transfectable, and can be cloned into single-cell lines to produce genetically modified cell lines. Initially, an attempt was made to use a leader editor (PEmax) with engineered pegRNA and ngRNA, achieving a 34% insertion of the R408W variant into a large number of HuH-7 cells when delivered via plasmid transfection. Single-cell clones were used to amplify the edited HuH-7 cell line to generate a homozygous R408W variant cell line (Figure 4). A representative homozygous R408W HuH-7 cell line was used for further experiments.

[0127] Through directed evolution of the seventh-generation ABE, ABE7.10, at least forty-one modified eighth-generation ABEs have been reported, all exhibiting higher editing efficiency in mammalian cells compared to ABE7.10 (Gaudelli et al., 2020; Richter et al., 2020). Furthermore, 30 intercalation base editors (IBEs) have been reported, several of which exhibit higher editing efficiency compared to ABEs fused with standard N-terminal deaminases, while also possessing 3'-shifted editing windows (Chu et al., 2021). Notably, the possibility of using ABEs containing SaCas9 was considered. However, no SaCas9NNGRRT PAM or SaCas9 KKH variant NNNRRT PAM (optimally positioned to place the target PAH c.1222C>T adenine within the editing window) was used, thus avoiding or minimizing counterproductive bystander editing, because the editing window of SaCas9-containing ABEs is much wider than that of SpCas9-containing ABEs. Therefore, ABEs containing SpCas9 were used.

[0128] Using homozygous cloned HuH-7 cell lines (homozygous R408W HuH-7 cells) of the PAH c.1222C>T variant generated via leader editing as described above, the ability of various eighth-generation ABEs to correct variants in some or all of the six gRNAs (SEQ ID NO: 1, 3, 5, 7, 9, and 11) (Figure 4) was tested (Figure 5). To expand the potential target sites beyond the standard SpCas9 with NGG PAM, nickases with core SpG-Cas9 (NGN PAM), SpRY-Cas9 (nearly PAM-free), and iSpyMacCas9 (NAA PAM) were tested. All ABE / gRNA groups corrected partial variant alleles to wild-type, but there were significant differences in the level of editing and bystander editing of the PAH c.1222C>T variant. It is noteworthy that bystander editing of adenine immediately adjacent to the c.1222C>T (c.1221) position will represent synonymous editing and is not expected to have any functional consequences. Among the tested ABE / gRNA groups, the combination of SpRY-ABE8.8 (SEQ ID NO: 78) and PAH4gRNA (SEQ ID NO: 7) showed the most favorable balance in terms of efficient variant correction and minimal bystander editing at positions outside c.1221.

[0129] Example 2 ABE activity in human hepatocytes is delivered via LNP.

[0130] For LNP delivery, Agilent synthesized PAH4 gRNA modified with 2'-O-methyl and phosphate thiophosphate at appropriate positions. The mRNA encoding SpRY-ABE8.8 was generated by the Center for Engineering mRNA and Targeted Nanomedicine at the University of Pennsylvania via in vitro transcription and purification. This center also formulated the mRNA and gRNA into LNPs containing standard lipid components (ionizable cationic lipids, 1,2-distearate-sn-glycerol-3-phosphate choline, cholesterol, and PEG-lipids). We conducted dose-response studies of LNPs using the homozygous R408WHuH-7 cell line. Figure 6 These studies indicate that approximately 30% of the correction editing occurs at higher doses.

[0131] Example 3 Two humanized mouse models with human PAH c.1222C>T variants were generated.

[0132] To assess the editing activity of the preferentially selected ABE / gRNA genome in hepatocytes in vivo, an animal model must be generated that includes not only the PAH c.1222C>T variant but also the original spacer DNA sequence and a neighboring sequence environment that allows for variant-corrected functional readout. Therefore, a humanized mouse model has been established in which a portion of the endogenous mouse PAH locus is replaced by an orthologous portion of the human PAH locus containing the variant. This degree of humanization facilitates the assessment of the therapeutic efficacy of base editing with the PAH c.1222C>T variant through disease-associated phenotypic readouts.

[0133] Several methods can be used to generate humanized mouse models. In one method, the mouse exon containing the PAH c.1222C>T variant (exon 12) and approximately 500 base pairs of flanking introns (introns 11 and 12) are replaced ( Figure 7 This was achieved in the context of the inbred strain C57BL / 6J by electrotransfecting the PAH-targeting vector into mouse embryonic stem cells to generate chimeras, followed by propagation. Homozygous mice, when maintained on a normal standard diet, exhibited signs of PKU, including elevated blood Phe levels and hypopigmentation (mouse gray replacing black fur). The humanized PAH c.1222C>T variant could be maintained in a heterozygous state, and the heterozygous mice were completely healthy.

[0134] In another approach, we used CRISPR-Cas9 targeting in mouse embryos to generate a minimally humanized PKU model in a C57BL / 6J background, where we replaced a small portion of the endogenous mouse Pah exon 12 with an orthologous human sequence spanning the protospacer region of the test gRNAs (SEQ IQ NO: 2, 4, 6, 8, 10, and 12) and containing the c.1222C>T variant. Figure 8A Homozygous mice exhibit a phenotype consistent with PKU. Figure 8B , Figure 9A ).

[0135] Example 4 ABE activity in mice was delivered via LNP.

[0136] For LNP delivery, Agilent synthesized PAH4 gRNA modified with 2'-O-methyl and phosphate thiophosphate at appropriate positions. The mRNA encoding SpRY-ABE8.8 ABE was generated by in vitro transcription and purification at the University of Pennsylvania's Center for Engineering mRNA and Targeted Nanomedicine. The center also formulated the mRNA and gRNA into an LNP containing standard lipid components (ionizable cationic lipids, 1,2-distearate-sn-glycerol-3-phosphate choline, cholesterol, and PEG-lipids).

[0137] In a short-term study, homozygous R408W (PKU) mice were treated with SpRY-ABE8.8 / PAH4 LNP at a dose of 5 mg / kg (n = 3 animals) or 2.5 mg / kg (n = 3 animals). Age-matched (approximately 8 weeks old) pups from the same group were used as controls, including homozygous PKU mice treated with the medium (n = 4 animals) and heterozygous non-PKU controls treated with the medium (n = 4 animals). Figure 9A At baseline, serum phenylalanine (Phe) levels in PKU mice ranged from 1000 to 1500 μmol / L (consistent with high levels in PKU), while serum Phe levels in non-PKU mice were typically < 125 μmol / L (similar to the human profile). Seven days post-treatment, serum Phe levels in all mice across both dose groups were below 125 mmol / L. Treated mice underwent necropsy one week post-treatment to assess liver editing. The required corrected editing of SpRY-ABE8.8 / PAH4 LNP throughout the liver was 29% on average in the high-dose group and 26% on average in the low-dose group. Figure 9B ).

[0138] Example 5 Screening ABEs to correct additional PKU variants.

[0139] The aforementioned lead editing was effective in introducing the PAH R408W variant into HuH-7 human hepatocellular carcinoma cells. However, different methods were used to introduce the PAH c.1066–11G>A, c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), and c.1315+1G>A variants into HuH-7 cells. Single DNA cassettes containing genomic fragments flanking these four variants, as well as genomic fragments flanking the PAH c.842C>T (p.Pro281Leu, also known as P281L) and R408W variants, were subcloned into lentiviral vectors to generate lentiviral particles, which were then used to infect HuH-7 cells. This simultaneously introduced all six variants into the genome of HuH-7 cells using plasmid transfection, allowing for side-by-side comparisons of the editing efficiency of the empirically validated SpRY-ABE8.8 / PAH4 group correcting the PAH R408W variant, the previously validated ABE8.8 / gRNA group correcting the PAH P281L variant (using a gRNA called PAH0, SEQ ID NO: 69), and various candidate ABE / gRNA groups correcting the other four variants.

[0140] For each of the four novel variants, experiments were conducted using core Cas9 (NGG PAM), SpG-Cas9 (NGN PAM), and SpRY-Cas9 (nearly PAM-free) nickases with any of the seven candidate gRNAs to screen for corrective editing of the novel variants. Each experiment also included an empirically validated ABE8.8 / PAH4 group for correcting the PAH R408W variant and an empirically validated ABE8.8 / PAH0 group for correcting the PAHP281L variant. Because the ABE / gRNA groups for R408W and P281L have previously been validated for therapeutically effective activity in an in vivo humanized PKU mouse model (i.e., normalization of serum Phe levels in LNP-treated mice), these validated ABE / gRNA groups serve as a “standard” for any candidate ABE / gRNA group. The groups demonstrating comparable corrective editing of the novel variants in these in vitro HuH-7 cells demonstrated therapeutically effective activity.

[0141] For the PAH c.1066–11G>A variant ( Figure 10A Many of the candidate ABE / gRNA groups tested (using gRNAs named PAH7 to PAH13, SEQ ID NO: 13, 15, 17, 19, 21, 23, and 25) showed corrected editing levels comparable to the R408W and P281L standards. Furthermore, several candidate ABE / gRNA groups showed corrected editing levels exceeding the P281L standard. Notably, bystander editing of adenine bases near the c.1066–11G>A variant may be neutral for PAH enzyme activity because the adenine bases are located within an intron sequence.

[0142] For PAH c.782G>A (p.Arg261Gln) Figure 10B Many of the candidate ABE / gRNA groups tested (using gRNAs named PAH14 to PAH20, SEQ ID NO: 27, 29, 31, 33, 35, 37, and 39) showed corrected editing levels comparable to the R408W and P281L standards. Furthermore, one candidate ABE / gRNA group showed corrected editing levels exceeding the P281L standard. Notably, bystander editing of adenine bases near c.782G>A resulted in either synonymous protein alterations (which were not expected to produce any functional consequences) or non-synonymous protein alterations (which could potentially adversely affect PAH enzyme activity). Therefore, editing outcomes involving non-synonymous protein changes were excluded from the calculation of observed corrected edits.

[0143] For the PAH c.728G>A (p.Arg243Gln) variant ( Figure 10COne of the candidate ABE / gRNA groups tested (using gRNAs named PAH21 to PAH27, SEQ ID NO: 41, 43, 45, 47, 49, 51, and 53) showed a level of corrected editing exceeding the R408W and P281L standards. Notably, there were no adenine bases near the c.728G>A variant (where nonsynonymous bystander editing occurred).

[0144] For the PAH c.1315+1G>A variant ( Figure 10D No corrected editing levels comparable to or exceeding the R408W and P281L standards were observed in the candidate ABE / gRNA groups (using gRNAs named PAH28 to PAH34, SEQ ID NO: 55, 57, 59, 61, 63, 65 and 67); furthermore, non-synonymous bystander editing dominated the editing outcome.

[0145] These findings suggest that experimental identification of therapeutically effective ABE / gRNA groups is needed to correct any given PAH variant. They also indicate that it cannot be assumed that any given PAH variant that, in principle, conforms to adenine base editing (G>A or C>T variants) will produce a viable corrective editing solution.

[0146] References Anzalone AV, Koblan LW, Liu DR. Genome editing with CRISPR-Casnucleases, base editors, transposases and prime editors. Nat Biotechnol. 2020Jul;38(7):824-844. Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM,Chen PJ, Wilson C, Newby GA, Raguram A, Liu DR. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature. 2019 Dec;576(7785):149-157. Ashe K, Kelso W, Farrand S, Panetta J, Fazio T, De Jong G, WalterfangM. Psychiatric and Cognitive Aspects of Phenylketonuria:The Limitations ofDiet and Promise of New Treatments.Front Psychiatry.2019 Sep 10;10:561. Banskota S, Raguram A, Suh S, Du SW, Davis JR, Choi EH, Wang X,Nielsen SC, Newby GA, Randolph PB, Osborn MJ, Musunuru K, Palczewski K, LiuDR.Engineered virus-like particles for efficient in vivo delivery oftherapeutic proteins.Cell.2022 Jan 20;185(2):250-265.e16. Blau N, van Spronsen FJ, Levy HL.Phenylketonuria.Lancet.2010 Oct 23;376(9750):1417-27. Burton BK, Longo N, Vockley J, Grange DK, Harding CO, Decker C, Li M,Lau K, Rosen O, Larimore K, Thomas J; PAL-002 and PAL-004Investigators.Pegvaliase for the treatment of phenylketonuria:Results of thephase 2 dose-finding studies with long-term follow-up.Mol Genet Metab.2020Aug;130(4):239-246. Cancellieri S, Zeng J, Lin LY, Tognon M, Nguyen MA, Lin J, BombieriN, Maitland SA, Ciuculescu MF, Katta V, Tsai SQ, Armant M, Wolfe SA, GiugnoR, Bauer DE, Pinello L. Human genetic diversity alters off-target outcomes oftherapeutic gene editing.Nat Genet.2023 Jan;55(1):34-43. Chadwick AC, Evitt NH, Lv W, Musunuru K. Reduced Blood Lipid LevelsWith In Vivo CRISPR-Cas9 Base Editing of ANGPTL3.Circulation.2018 Feb 27;137(9):975-977. Chadwick AC, Wang X, Musunuru K. In Vivo Base Editing of PCSK9(Proprotein Convertase Subtilisin / Kexin Type 9) as a Therapeutic Alternativeto Genome Editing.Arterioscler Thromb Vasc Biol.2017 Sep;37(9):1741- 1747.doi:10.1161 / ATVBAHA.117.309881.Epub 2017 Jul 27. Chu SH, Packer M, Rees H, Lam D, Yu Y, Marshall J, Cheng LI, Lam D,Olins J, Ran FA, Liquori A, Gantzer B, Decker J, Born D, Barrera L, HartiganA, Gaudelli N, Ciaramella G, Slaymaker IM.Rationally Designed Base Editorsfor Precise Editing of the Sickle Cell Disease Mutation.CRISPR J. 2021 Apr;4(2):169-177. Davis JR, Wang X, Witte IP, Huang TP, Levy JM, Raguram A, Banskota S,Seidah NG, Musunuru K, Liu DR.Efficient in vivo base editing via singleadeno-associated viruses with size-optimized genomes encoding compact adeninebase editors.Nat Biomed Eng. 2022 Nov;6(11):1272-1283. Donohoue PD, Pacesa M, Lau E, Vidal B, Irby MJ, Nyer DB, Rotstein T,Banh L, Toh MS, Gibson J, Kohrs B, Baek K, Owen ALG, Slorach EM, van OverbeekM, Fuller CK, May AP, Jinek M, Cameron P. Conformational control of Cas9 byCRISPR hybrid RNA-DNA guides mitigates off-target activity in T cells.MolCell.2021 Sep 2;81(17):3637-3649.e5. Essalmani R, Weider E, Marcinkiewicz J, Chamberland A, Susan-ResigaD, Roubtsova A, Seidah NG, Prat A. A single domain antibody against the Cys-and His-rich domain of PCSK9 and evolocumab exhibit different inhibitionmechanisms in humanized PCSK9 mice.Biol Chem.2018 Nov 27;399(12):1363-1374. Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, LiuDR.Programmable base editing of A•T to G•C in genomic DNA without DNAcleavage.Nature.2017 Nov 23;551(7681):464-471. Gaudelli NM, Lam DK, Rees HA, Solá-Esteves NM, Barrera LA, Born DA,Edwards A, Gehrke JM, Lee SJ, Liquori AJ, Murray R, Packer MS, Rinaldi C,Slaymaker IM, Yen J, Young LE, Ciaramella G. Directed evolution of adeninebase editors with increased activity and therapeutic application.NatBiotechnol.2020 Jul;38(7):892- 900. Gillmore JD, Gane E, Taubel J, Kao J, Fontana M, Maitland ML, SeitzerJ, O'Connell D, Walsh KR, Wood K, Phillips J, Xu Y, Amaral A, Boyd AP,Cehelsky JE, McKee MD, Schiermeier A, Harari O, Murphy A, Kyratsous CA,Zambrowicz B, Soltys R, Gutstein DE, Leonard J, Sepp-Lorenzino L, Lebwohl D.CRISPR-Cas9 In Vivo Gene Editing for Transthyretin Amyloidosis.N Engl JMed.2021 Aug 5;385(6):493-502. Grisch-Chan HM, Schwank G, Harding CO, Thöny B. State-of-the-Art 2019on Gene Therapy for Phenylketonuria.Hum Gene Ther.2019 Oct;30(10):1274-1283. Hillert A, Anikster Y, Belanger-Quintana A, Burlina A, Burton BK,Carducci C, Chiesa AE, Christodoulou J, Đorđević M, Desviat LR, Eliyahu A,Evers RAF, Fajkusova L, Feillet F, Bonfim-Freitas PE, Giżewska MP, Kne Dva, Dvaller, Kne Kutsev SI, Leuzzi V, Levy HL, Lichter-Konecki U,Muntau AC, Namour F, Oltarzewski M, Paras A, Perez B, Polak E, Polyakov AV,Porta F, Rohrbach M, Scholl-Bürgi S, Spécola N, Stojiljković M, Shena-N,Santa, Van Skova, ALC Spronsen F, Stoppioni V, Thöny B, TrefzFK, Vockley J, Yu Y, Zschocke J, Hoffmann GF, Garbade SF, Blau N. The GeneticLandscape and Epidemiology of Phenylketonuria.Am J Hum Genet.2020 Aug 6;107(2):254-2034. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. Aprogrammable dual-RNA-guided DNA endonuclease in adaptive bacterialimmunity.Science.2012 Aug 17;337(6096):816-21. Jurecki ER, Cederbaum S, Kopesky J, Perry K, Rohr F, Sanchez-Valle A,Viau KS, Sheinin MY, Cohen-Pfeffer JL.Adherence to clinic recommendationsamong patients with phenylketonuria in the United States.Mol Genet Metab.2017Mar;120(3):190-197. Kasiewicz LN, Biswas S, Beach A, Ren H, Dutta C, Mazzola AM, Rohde E,Chadwick A, Cheng C, Garcia SP, Iyer S, Matsumoto Y, Khera AV, Musunuru K,Kathiresan S, Malyala P, Rajeev KG, Bellinger AM.GalNAc-Lipid nanoparticlesenable non-LDLR dependent hepatic delivery of a CRISPR base editingtherapy.Nat Commun.2023 May 15;14(1):2776. Kim D, Kim DE, Lee G, Cho SI, Kim JS.Genome-wide target specificityof CRISPR RNA-guided adenine base editors.Nat Biotechnol.2019 Apr;37(4):430-435. Kingwell K. Base editors hit the clinic.Nat. Rev. Drug Discov.21,545-547 (2022). Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR.Programmable editing ofa target base in genomic DNA without double-stranded DNA cleavage.Nature.2016May 19;533(7603):420-4. Leuders S, Wolfgart E, Ott T, du Moulin M, van Teeffelen-Heithoff A,Vogelpohl L, Och U, Marquardt T, Weglage J, Feldmann R, Rutsch F. Influenceof PAH Genotype on Sapropterin Response in PKU:Results of a Single-CenterCohort Study.JIMD Rep.2014;13:101-9. Levy HL, Sarkissian CN, Scriver CR.Phenylalanine ammonia lyase (PAL):From discovery to enzyme substitution therapy for phenylketonuria.Mol GenetMetab.2018 Aug;124(4):223-229. Levy JM, Yeh WH, Pendse N, Davis JR, Hennessey E, Butcher R, KoblanLW, Comander J, Liu Q, Liu DR.Cytosine and adenine base editing of the brain,liver, retina, heart and skeletal muscle of mice via adeno-associatedviruses.Nat Biomed Eng. 2020 Jan;4(1):97-110. Liang P, Xie X, Zhi S, Sun H, Zhang X, Chen Y, Chen Y, Xiong Y, Ma W,Liu D, Huang J, Songyang Z. Genome-wide profiling of adenine base editorspecificity by EndoV-seq. Nat Commun.2019 Jan 8;10(1):67. Musunuru K, Chadwick AC, Mizoguchi T, Garcia SP, DeNizio JE, ReissCW, Wang K, Iyer S, Dutta C, Clendaniel V, Amaonye M, Beach A, Berth K,Biswas S, Braun MC, Chen HM, Colace TV, Ganey JN R, Laewicz Gangopadhya J, Madsen JA, Matsumoto Y, Mazzola AM, Nasrullah YS, Nneji J, Ren H, Sanjeev A, Shay M, Stahley MR, Fan SHY, Tam YK, Gaudelli NM, Ciaramella G, Stolz LE, Malyala P, Cheng CJ, Rajeev SPRIS, In vivo KG, base editing of PCSK9 durably lowerscholesterol in primates.Nature.2021 May;593(7859):429-434. Petri K, Kim DY, Sasaki KE, Canver MC, Wang X, Shah H, Lee H, HorngJE, Clement K, Iyer S, Garcia SP, Guo JA, Newby GA, Pinello L, Liu DR, AryeeMJ, Musunuru K, Joung JK, Pattanayak V. Global-scale CRISPR gene editorspecificity profiling by ONE-seq identifies population-specific, variant off-target effects. bioRxiv.2021 Apr 5. Regier DS, Greene CL.Phenylalanine Hydroxylase Deficiency.2017 Jan5.In:Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Gripp KW, MirzaaGM, Amemiya A, editors.GeneReviews ® [Internet].Seattle (WA):University ofWashington, Seattle; 1993–2022. Richter MF, Zhao KT, Eton E, Lapinaite A, Newby GA, Thuronyi BW,Wilson C, Koblan LW, Zeng J, Bauer DE, Doudna JA, Liu DR.Phage-assistedevolution of an adenine base editor with improved Cas domain compatibilityand activity.Nat Biotechnol.2020 Jul;38(7):883-891. Romani C, Manti F, Nardecchia F, Valentini F, Fallarino N, CarducciC, De Leo S, MacDonald A, Palermo L, Leuzzi V. Adult cognitive outcomes inphenylketonuria: explaining causes of variability beyond average Phelevels.Orphanet J Rare Dis.2019 Nov 28;14(1):273. Rossidis AC, Stratigis JD, Chadwick AC, Hartman HA, Ahn NJ, Li H,Singh K, Coons BE, Li L, Lv W, Zoltick PW, Alapati D, Zacharias W, Jain R,Morrisey EE, Musunuru K, Peranteau WH.In utero CRISPR-mediated therapeuticediting of metabolic genes.Nat Med.2018 Oct;24(10):1513-1518. Rothgangl T, Dennis MK, Lin PJC, Oka R, Witzigmann D, Villiger L, QiW, Hruzova M, Kissling L, Lenggenhager D, Borrelli C, Egli S, Frey N, BakkerN, Walker JA 2nd, Kadina AP, Victorov DV, Pacesa M, Kreutzer S, Kontarakis Z,Moor A, Jinek M, Weissman D, Stoffel M, van Boxtel R, Holden K, Pardi N, Thöny B, Häberle J, Tam YK, Semple SC, Schwank G. In vivo adenine base editingof PCSK9 in macaques reduces LDL cholesterol levels.Nat Biotechnol.2021 Aug;39(8):949-957. Strecker J, Jones S, Koopal B, Schmid-Burgk J, Zetsche B, Gao L,Makarova KS, Koonin EV, Zhang F. Engineering of CRISPR-Cas12b for humangenome editing.Nat Commun.2019 Jan 22;10(1):212. doi:10.1038 / s41467-018-08224-4. Thomas L, Olson A, Romani C. The impact of metabolic control oncognition, neurophysiology, and well-being in PKU:A systematic review andmeta-analysis of the within-participant literature.Mol Genet Metab.2023 Jan;138(1):106969. van Spronsen FJ, Blau N, Harding C, Burlina A, Longo N, BoschAM.Phenylketonuria.Nat Rev Dis Primers.2021 May 20;7(1):36. Villiger L, Grisch-Chan HM, Lindsay H, Ringnalda F, Pogliano CB,Allegri G, Fingerhut R, Häberle J, Matos J, Robinson MD, Thöny B, Schwank G.Treatment of a metabolic liver disease by in vivo genome base editing inadult mice.Nat Med.2018 Oct;24(10):1519-1525. Vockley J, Andersson HC, Antshel KM, Braverman NE, Burton BK, FrazierDM, Mitchell J, Smith WE, Thompson BH, Berry SA; American College of MedicalGenetics and Genomics Therapeutics Committee.Phenylalanine hydroxylasedeficiency: diagnosis and management guideline.Genet Med.2014 Feb;16(2):188-200. Walton RT, Christie KA, Whittaker MN, Kleinstiver BP.Unconstrainedgenome targeting with near-PAMless engineered CRISPR-Cas9variants.Science.2020 Apr 17;368(6488):290-296. Wang L, Breton C, Warzecha CC, Bell P, Yan H, He Z, White J, Zhu Y,Li M, Buza EL, Jantz D, Wilson JM. Long-term stable reduction of low-densitylipoprotein in nonhuman primates following in vivo genome editing of PCSK9. Mol Ther. 2021 Jun 2;29(6):2019-2029. Zetsche B, Gootenberg JS, Abudayyeh OO, Slaymaker IM, Makarova KS,Essletzbichler P, Volz SE, Joung J, van der Oost J, Regev A, Koonin EV, ZhangF. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cassystem.Cell.2015 Oct 22;163(3):759-71. Zheng Z, Liebers M, Zhelyazkova B, Cao Y, Panditi D, Lynch KD, ChenJ, Robinson HE, Shim HS, Chmielecki J, Pao W, Engelman JA, Iafrate AJ, LeLP. Anchored multiplex PCR for targeted next-generation sequencing. NatMed. 2014 Dec;20(12):1479-84. While certain features of the invention have been described herein, many modifications, substitutions, alterations, and equivalents will now occur to those skilled in the art. Therefore, it should be understood that the appended claims are intended to cover all such modifications and variations that fall within the true spirit of the invention.

Claims

1. A method for editing a polynucleotide encoding phenylalanine hydroxylase (PAH), said polynucleotide comprising a c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln) mutation, said method comprising contacting the PAH polynucleotide with a base editor and one or more guide polynucleotides to form a base editor complex, said base editor complex comprising a polynucleotide programmable DNA-binding domain and an adenosine deaminase domain, wherein said one or more guide polynucleotides target the base editor complex to the mutation and achieve an A•T to G•C base change, thereby correcting the mutation.

2. The method for treating a patient according to claim 1, wherein the mutation is c.1222C>T (p.Arg408Trp), and the guide polynucleotide has a sequence having at least 90% identity with SEQ ID NO: 7, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 1, SEQ ID NO: 9 or SEQ ID NO: 11, or is a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence.

3. The method for treating a patient according to claim 1, wherein the mutation is c.1222C>T (p.Arg408Trp), and the guide polynucleotide comprises a nucleic acid sequence complementary to the following: a nucleic acid sequence encoding a PAH having at least 90% identity with SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 or SEQ ID NO:

12.

4. The method according to any one of claims 2-3, wherein the patient has a second mutation in a different allele of a second polynucleotide encoding PAH, the mutation being selected from c.842C>T (p.Pro281Leu), c.1066–11G>A, c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln).

5. The method for treating a patient according to claim 1, wherein the mutation is c.1066–11G>A, and the guide polynucleotide has a sequence having at least 90% identity with SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23 or SEQ ID NO: 25, or is a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence.

6. The method for treating a patient according to claim 1, wherein the mutation is c.1066–11G>A, and the guide polynucleotide comprises a nucleic acid sequence complementary to the following: a nucleic acid sequence encoding a PAH having at least 90% identity with SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, or SEQ ID NO:

26.

7. The method according to any one of claims 5-6, wherein the patient has a second mutation in a different allele of a second polynucleotide encoding PAH, said mutation being selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln).

8. The method of claim 1, wherein the mutation is c.782G>A (p.Arg261Gln), and the guide polynucleotide has a sequence having at least 90% identity with SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37 or SEQ ID NO: 39, or is a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence.

9. The method of claim 1, wherein the mutation is c.782G>A (p.Arg261Gln), and the guide polynucleotide comprises a nucleic acid sequence complementary to the following: a nucleic acid sequence encoding a PAH having at least 90% identity with SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO:

40.

10. The method for treating a patient according to any one of claims 8-9, wherein the patient has a second mutation in a different allele of a second polynucleotide encoding PAH, said mutation being selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln).

11. The method of claim 1, wherein the mutation is c.728G>A (p.Arg243Gln), and the guide polynucleotide has a sequence having at least 90% identity with SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53, or is a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence.

12. The method of claim 1, wherein the mutation is c.728G>A (p.Arg243Gln), and the guide polynucleotide comprises a nucleic acid sequence complementary to the following: a nucleic acid sequence encoding a PAH having at least 90% identity with SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52 or SEQ ID NO:

54.

13. The method according to any one of claims 11-12, wherein the patient has a second mutation in a different allele of a second polynucleotide encoding PAH, said mutation being selected from c.842C>T (p.Pro281Leu), c.122C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln).

14. The method according to any one of claims 1-13, wherein the contact is performed in a cell, eukaryotic cell, mammalian cell or human cell.

15. The method according to any one of claims 1-14, wherein the cells are in vivo.

16. The method according to any one of claims 1-14, wherein the cells are ex vivo.

17. The method according to any one of claims 1-16, wherein the polynucleotide programmable DNA binding domain is Streptococcus pyogenes Cas9 (SpCas9) or Staphylococcus aureus Cas9 (SaCas9) or a variant thereof.

18. The method according to any one of claims 1-17, wherein the polynucleotide programmable DNA binding domain comprises a modified SpCas9 having altered protospacer neighbor motif (PAM) specificity.

19. The method according to any one of claims 1-18, wherein the polynucleotide programmable DNA binding domain is non-nuclease-active or a nickase variant.

20. The method according to any one of claims 1-19, wherein the adenosine deaminase domain is capable of deaminating adenosine in deoxyribonucleic acid (DNA).

21. The method of claim 20, wherein the adenosine deaminase is TadA deaminase or a variant thereof.

22. The method according to any one of claims 1-21, wherein the base editor is compounded with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to a nucleic acid sequence containing a phenylketonuria (PKU)-associated mutation.

23. A cell produced by introducing the following into said cell or its progenitor cells: a) a base editor, or a polynucleotide encoding said base editor, wherein said base editor comprises a polynucleotide programmable DNA-binding domain and an adenosine deaminase domain; and b) One or more guide polynucleotides that target a base editor to a mutation site and achieve an A•T to G•C alteration in c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln) mutations, thereby treating PKU.

24. The cell of claim 23, wherein the cell is a hepatocyte.

25. The cell according to claim 23 or 24, wherein the hepatocyte expresses the PAH polypeptide.

26. The cell according to any one of claims 23-25, wherein the cell is derived from a subject suffering from PKU.

27. The cell according to any one of claims 23-26, wherein the polynucleotide programmable DNA binding domain is Streptococcus pyogenes Cas9 (SpCas9) or a variant thereof.

28. The cell according to any one of claims 23-27, wherein the polynucleotide programmable DNA binding domain comprises a modified SpCas9 having altered protospacer neighbor motif (PAM) specificity.

29. The cell of claim 28, wherein the modified SpCas9 is specific for the nucleic acid sequence 5'-NGC-3'.

30. The cell of claim 28, wherein the modified SpCas9 is specific for the nucleic acid sequence 5'-NCA-3'.

31. The cell of claim 28, wherein the modified SpCas9 is specific for the nucleic acid sequence 5'-NAA-3'.

32. The cell of claim 28, wherein the modified SpCas9 is specific for the nucleic acid sequence 5'-NAG-3'.

33. The cell of claim 28, wherein the modified SpCas9 is specific for the nucleic acid sequence 5'-NGT-3'.

34. The cell of claim 28, wherein the modified SpCas9 is specific for the nucleic acid sequence 5'-NGN-3'.

35. The cell of claim 28, wherein the modified SpCas9 is not specific to the nucleic acid sequence.

36. The cell according to any one of claims 23-35, wherein the polynucleotide programmable DNA binding domain is non-nuclease-active or a nickase variant.

37. The cell according to any one of claims 23-36, wherein the adenosine deaminase domain is capable of deaminating adenosine in deoxyribonucleic acid (DNA).

38. The cell according to any one of claims 23-37, wherein the base editor is compounded with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to a nucleic acid sequence encoding PAH containing a PKU-related mutation.

39. Multiple adenosine base editor / guide polynucleotides for correcting mutations causing PKU, comprising: (i) Modified SpCas9 or SaCas9; (ii) adenosine deaminase or a functional fragment thereof; and iii) Guide polynucleotides that target base editors to achieve A•T to G•C alterations associated with PKU, such as c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln) mutations.

40. The cell according to any one of claims 23-38, or the base editor / guide polynucleotide according to claim 39, wherein the mutation is c.1222C>T (p.Arg408Trp), and the guide polynucleotide has a sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11, or a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence.

41. The cell according to any one of claims 23-38, or the base editor / guide polynucleotide according to claim 39, wherein the mutation is c.1222C>T (p.Arg408Trp), and the guide polynucleotide comprises a nucleic acid sequence complementary to the nucleic acid sequence encoding PAH of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 or SEQ ID NO:

12.

42. The cell according to any one of claims 23-38, or the base editor / guide polynucleotide base editing complex according to claim 39, wherein the mutation is c.1066–11G>A, and the guide polynucleotide has a sequence having at least 90% identity with SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23 or SEQ ID NO: 25, or a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence.

43. The cell according to any one of claims 23-38, or the base editor / guide polynucleotide base editing complex according to claim 39, wherein the mutation is c.1066–11G>A, and the guide polynucleotide comprises a nucleic acid sequence complementary to the following: a nucleic acid sequence encoding a PAH having at least 90% identity with SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, or SEQ ID NO:

26.

44. The cell according to any one of claims 23-38, or the base editor / guide polynucleotide editing complex according to claim 39, wherein the mutation is c.782G>A (p.Arg261Gln), and the guide polynucleotide has a sequence having at least 90% identity with SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37 or SEQ ID NO: 39, or has a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region.

45. The cell according to any one of claims 23-38, or the base editor / guide polynucleotide base editing complex according to claim 39, wherein the mutation is c.782G>A (p.Arg261Gln), and the guide polynucleotide comprises a nucleic acid sequence complementary to the following: a nucleic acid sequence encoding PAH having at least 90% identity with SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO:

40.

46. ​​The cell according to any one of claims 23-38, or the base editor / guide polynucleotide editing complex according to claim 39, wherein the mutation is c.728G>A (p.Arg243Gln), and the guide polynucleotide has a sequence having at least 90% identity with SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51 or SEQ ID NO: 53, or a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence.

47. The cell according to any one of claims 23-38, or the base editor / guide polynucleotide base editing complex according to claim 39, wherein the mutation is c.728G>A (p.Arg243Gln), and the guide polynucleotide comprises a nucleic acid sequence complementary to the following: a nucleic acid sequence encoding a PAH having at least 90% identity with SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, or SEQ ID NO:

54.

48. The method according to any one of claims 1-22, the cell according to any one of claims 23-38, or the base editor / guide polynucleotide according to claim 39, wherein the mutation is c.1222C>T (p.Arg408Trp), and the guide polynucleotide has the sequence of SEQ ID NO: 7, or is a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence.

49. The method of any one of claims 1-22, the cell of any one of claims 23-38, or the base editor / wizard editing complex of claim 39, wherein the mutation is c.1222C>T(p.Arg408Trp), and wherein the base editor has the sequence of SEQ ID NO:

78.

50. The method according to any one of claims 1-22, the cell according to any one of claims 23-38, or the base editor / guide according to claim 39, wherein the mutation is c.1222C>T (p.Arg408Trp). i) The guide polynucleotide has the sequence of SEQ ID NO: 7, or is a hybrid gRNA having one of these sequences containing at least one DNA nucleotide substitution in the spacer region sequence; and ii) The base editor has the sequence of SEQ ID NO:

78.

51. A method of treating PKU in a subject, comprising administering to the subject an effective amount of the adenosine base editor / guided polynucleotide editing complex according to any one of claims 39 to 50.

52. The method of claim 51, wherein the subject is a mammal or a human.

53. The method of claim 51 or 52, further comprising delivering the base editor or the polynucleotide encoding the base editor, and one or more guide polynucleotides, to the cells of the subject.

54. The method according to any one of claims 51-53, wherein the cell is a hepatocyte.

55. The method according to any one of claims 51-54, wherein the base editor / guide polynucleotide assembly is encapsulated in a lipid nanoparticle formulation and delivered to the subject's hepatocytes.

56. The method of claim 55, wherein the formulation comprises an ionizable cationic lipid, 1,2-distearate-sn-glycerol-3-phosphate choline, cholesterol, and PEG-lipid.

57. The method according to any one of claims 51-55, wherein the base editor and guide polynucleotide are delivered to hepatocytes in a single or dual AAV vector system.

58. The method according to any one of claims 51-54, wherein the base editor and guide polynucleotide are delivered to hepatocytes in virus-like particles.

59. A transgenic mouse containing a humanized PAH gene, wherein the first mutation is selected from c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln).

60. The transgenic mouse of claim 59, wherein the mouse further comprises at least one additional mutation selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln), wherein the first mutation is different from the at least one additional mutation.

61. A method for identifying an effective adenosine base editor (ABE) / guided polynucleotide editing complex for correcting target mutations, the method comprising: a) Contact cells containing the control mutation with a control ABE / guided polynucleotide editing complex that edits the control mutation; b) Contact cells containing the target mutation with the test ABE / guided polynucleotide editing complex that edits the target mutation; c) Compare the corrective activity of the control ABE / guided polynucleotide editing complex with the corrective activity of at least one tested ABE / guided polynucleotide editing complex; and e) Identify and test the ABE / guided polynucleotide editing complex, which has at least 50% of the corrective activity of the control ABE / guided polynucleotide editing complex.

62. The method of claim 61, wherein the control mutation is c.842C>T (p.Pro281Leu) or c.1222C>T (p.Arg408Trp).

63. The method according to claim 61 or 62, wherein the control ABE / guided polynucleotide editing complex has the guide polynucleotide of SEQ ID NO: 7, and the base editor has the sequence of SEQ ID NO:

78.

64. The method according to any one of claims 61-63, wherein the target mutation and / or control mutation is a PKU-related mutation.

65. The method according to any one of claims 61-64, wherein the target mutation is selected from c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), and c.728G>A (p.Arg243Gln).

66. The method according to any one of claims 61-65, wherein the test ABE / guided polynucleotide editing complex comprises at least one guide polynucleotide selected from Table 1.

67. The method according to any one of claims 61-66, wherein the test ABE / guided polynucleotide editing complex comprises at least one base editor selected from Table 2.

68. The method according to any one of claims 61-67, wherein the test ABE / guided polynucleotide editing complex has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% of the correction activity of the control ABE / guided polynucleotide editing complex.

69. The method according to any one of claims 61-68, wherein the test ABE / guided polynucleotide editing complex has higher correction activity than the control ABE / guided polynucleotide editing complex.

70. The method according to any one of claims 61-69, further comprising comparing the bystander editing level of the ABE / guided polynucleotide editing complex with the bystander editing level of the control ABE / guided polynucleotide editing complex.

71. The method of claim 70, wherein the test ABE / guided polynucleotide editing complex has approximately the same or fewer bystander edits as the control ABE / guided polynucleotide editing complex.

72. The method of claim 70 or 71, further comprising selecting a test ABE / guided polynucleotide editing complex that does not have intolerance and a test ABE / guided polynucleotide editing complex that does not have nonsynonymous bystander editing.