Application of Hinderein protein in regulation and control of cilia length

Abstract

The invention discloses application of Hinderein protein in regulation and control of cilia length and the fields of biomedicine and molecular cell biology, in-vivo and in-vitro experiments prove that knockdown or knockout of Hinderein can cause significant shortening of cilia length of mouse retina photoreceptor cells and APRE19 cells, but does not affect the occurrence rate of cilia, and mechanism research shows that knockdown or knockout of Hinderein can cause significant shortening of cilia length of mouse retina photoreceptor cells and APRE19 cells without affecting the occurrence rate of cilia. The Hinderein interacts with the central grain satellite protein PCM1, and is crucial to the positioning of the Hinderein around the central grain. Therefore, the Hinderein protein, the agonist of the Hinderein protein or the coding gene of the Hinderein protein can be used for preparing products for promoting cilia elongation, and a new target spot is provided for treatment of diseases related to abnormal cilia length.

Description

Technical Field

[0001] This invention relates to the fields of biomedicine and molecular cell biology, and in particular to the application of Hinderin protein in regulating cilia length. Background Technology

[0002] Cilia are microtubule-based organelles widely distributed on the surface of eukaryotic cells, playing a crucial role in various physiological processes such as cell signal transduction, photoreception, and fluid sensing. Abnormalities in the structure or function of cilia are associated with a variety of human diseases, collectively known as cilia disorders. The development and maintenance of cilia length is a highly regulated process involving complex intracellular transport and signaling networks. Although many proteins have been identified as playing roles in cilia development, the specific molecular mechanisms regulating cilia length, particularly axonal elongation, remain not fully elucidated. The function of hinderin proteins, especially in cilia development, is still a technological gap.

[0003] Therefore, the discovery of new ciliary length regulators is of great significance for understanding ciliary biology and developing treatment strategies for ciliary diseases.

[0004] Therefore, this invention proposes the application of Hinderin protein in regulating cilia length. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by proposing the application of Hinderin protein in regulating cilia length.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides the use of Hinderin protein or its encoding gene in the preparation of products for promoting ciliary elongation.

[0007] Furthermore, the cilia are the cilia of animal retinal photoreceptor cells.

[0008] Furthermore, the cilia are those of APRE19 cells.

[0009] Furthermore, the application promotes ciliary elongation by increasing the expression or activity of Hinderin protein in target cells or tissues.

[0010] Furthermore, the product is a reagent, pharmaceutical composition, or gene therapy vector containing Hinderin protein, an agonist of Hinderin protein, or a gene encoding Hinderin protein.

[0011] Furthermore, the gene encoding the Hinderin protein is delivered via a plasmid or adeno-associated virus vector containing the gene.

[0012] In a second aspect, the present invention provides the use of the Hinderin protein or its encoding gene in the preparation of products for maintaining or promoting the correct localization of the PCM1 protein around the centrioles.

[0013] Furthermore, the Hinderin protein is a Hinderin protein capable of interacting with the PCM1 protein.

[0014] Furthermore, the application is based on the interaction between the Hinderin protein and the PCM1 protein.

[0015] Thirdly, the present invention provides a method for screening candidate substances for promoting ciliary elongation, the method comprising detecting the effect of the candidate substance on the expression or activity of Hinderin protein, and / or detecting the effect of the candidate substance on the interaction between Hinderin protein and PCM1 protein.

[0016] The beneficial effects of this invention are as follows: 1. This invention reveals for the first time the crucial role of Hinderin protein in regulating cilia length. In vitro and in vivo experiments demonstrate that knocking down or eliminating Hinderin leads to a significant shortening of cilia length without affecting cilia formation, indicating that Hinderin specifically participates in the elongation process of cilia axons.

[0017] 2. Hinderin, as described in this invention, interacts with the centriole satellite protein PCM1 and is crucial to its localization around the centriole, which may be the molecular basis for its regulation of cilia length. Therefore, Hinderin can serve as a target for promoting cilia elongation and can be applied to the development of intervention strategies and drug screening for diseases related to cilia dysfunction. Attached Figure Description

[0018] Figure 1 This is a schematic diagram of the ciliary phenotype of the Hinderin knockout mouse of the present invention. Figure 2 This is a schematic diagram of the ciliary phenotype of Hinderin knockdown at the cellular level according to the present invention. Figure 3 This is a schematic diagram illustrating the co-localization of Hinderin with the centriole satellite protein PCM1 according to the present invention; Figure 4 This is a schematic diagram illustrating the interaction between Hinderin and PCM1 in this invention; Figure 5 This is a schematic diagram illustrating the disruption of PCM1 satellite positioning by Hinderin knockout according to the present invention. Detailed Implementation

[0019] The technical solution of the present invention will be further described in detail below with reference to specific embodiments.

[0020] In the description of this invention, it should be noted that, unless otherwise explicitly specified and limited, the terms "installation," "connection," "linking," and "setting" should be interpreted broadly. For example, they can refer to a fixed connection or setting, a detachable connection or setting, or an integral connection or setting. Those skilled in the art can understand the specific meaning of the above terms in this invention according to the specific circumstances.

[0021] Example 1: Hinderin knockout leads to shortening of retinal cilia length in mice Experimental animals: Hinderin systemic knockout mice with C57BL / 6 background (purchased from Suzhou Cyagen Biotech Co., Ltd.) and their littermate wild-type control mice (purchased from the Experimental Animal Center of Chongqing Medical University).

[0022] Tissue processing and frozen sectioning: Mouse retinal tissue was collected, washed with PBS, and fixed in 4% paraformaldehyde at 4°C for 24 hours. After rinsing with running water for 30 minutes, the tissue was sequentially dehydrated with 20% and 30% sucrose solutions. The dehydrated tissue was embedded in OCT and sections of 3 μm thickness were prepared on a cryostat and attached to glass slides.

[0023] The PBS buffer is prepared as follows: reagents Mass (g) NaCl 8 KCl 0.2 <![CDATA[KH2PO4]]> 0.28 <![CDATA[Na2HPO4]]> 1.42 Tissue immunofluorescence staining: a. After the sections have stood at room temperature for 30 minutes, wash them with PBS for 10 minutes.

[0024] b. Fix with 4% paraformaldehyde at room temperature for 10 minutes, then wash 3 times with PBS.

[0025] c. Disrupt the membrane with 0.3% Triton X-100 at room temperature for 15 minutes, then wash three times with PBS.

[0026] d. Add 10% donkey serum (diluted with PBS) and block at room temperature for 1 hour.

[0027] e. Dilute the primary antibody (anti-ARL13B antibody) with 2% BSA, add it to the slide, and incubate overnight at 4°C.

[0028] f. After washing with PBS, add fluorescent secondary antibody (goat anti-rabbit IgG-555) diluted with 2% BSA and DAPI (1:500), and incubate at room temperature in the dark for 50 minutes.

[0029] g. After washing with PBS, mount the slides with an anti-fluorescence quencher.

[0030] Imaging and statistical analysis: Images were captured using a laser confocal microscope. Quantitative analysis and unpaired Student's test were performed on the ciliary density (n=10 fields of view) and ciliary length (n=150 cilia) of the retinas of wild-type and knockout mice using GraphPad Prism 9 software.

[0031] Results: Compared with wild-type mice, Hinderin knockout mice showed a significant reduction in the length of cilia in retinal photoreceptor cells, but no significant difference in cilia density, indicating that Hinderin is a protein essential for maintaining normal retinal cilia length.

[0032] Example 2: Hinderin knockdown leads to shortened cilia length in APRE19 cells Cell culture and ciliation induction: ARPE-19 cells were cultured in complete medium. To induce ciliation, cells were seeded in 24-well plates coated with poly-L-lysine (0.01 mg / mL) and cultured in serum-free medium for 48 hours.

[0033] Gene silencing: Using Lipofectamine 3000 transfection reagent, siRNA targeting Hinderin (Sequence 1: TCCAAAAGTTGATGTTAAAGTTA; Sequence 2: TGCCAACTTAATTAAAGAACTGG) or control siRNA was transfected into cells.

[0034] Cellular immunofluorescence staining: a. Wash cells three times with pre-cooled PBS and fix with 4% paraformaldehyde at room temperature for 10 minutes.

[0035] b. Disrupt the membrane with 0.1% Triton-X-100 for 10 minutes, then wash 3 times with PBS.

[0036] c. 10% BSA, sealed at room temperature for 2 hours.

[0037] d. Dilute the primary antibody (anti-acetylated α-tubulin antibody) with 2% BSA, invert the slide onto the primary antibody droplet, and incubate at room temperature for 1 hour.

[0038] e. Wash 3 times with PBST (0.01% Tween-20), 5 minutes each time.

[0039] f. Dilute the fluorescent secondary antibody (goat anti-mouse IgG-488) and DAPI (1:500) with 2% BSA and incubate at room temperature in the dark for 50 minutes.

[0040] g. Sealing (same as in Example 1).

[0041] Imaging and statistical analysis: Cells were observed and photographed using a fluorescence microscope. Each group analyzed >100 cells per experiment, with independent replicates in triplicate. Quantitative analysis of the proportion of ciliating cells and ciliary length (n=150 cilia) was performed using GraphPad Prism 9, along with unpaired Student's t-tests.

[0042] Results: Compared with cells transfected with control siRNA, APRE19 cells transfected with Hinderin siRNA showed significantly shorter ciliary lengths, but the proportion of ciliating cells remained unchanged. This indicates that at the cellular level, Hinderin specifically regulates ciliary elongation without affecting the initiation of ciliogenesis.

[0043] Example 3: Co-localization and interaction of Hinderin and PCM1 protein Subcellular colocalization (immunofluorescence): a. Transfecting ARPE-19 cells with plasmids expressing GFP-Hinderin fusion protein.

[0044] b. After 48 hours, the cells were treated with the cell immunofluorescence procedure in Example 2, using anti-GFP mouse antibody and anti-PCM1 rabbit antibody as primary antibodies, and goat anti-mouse IgG-488 and goat anti-rabbit IgG-555 as secondary antibodies.

[0045] c. Laser confocal microscopy imaging. The results showed that the fluorescence signals of GFP-Hinderin and centriole satellite protein PCM1 almost completely overlapped, indicating that the two are co-localized in the cell.

[0046] Protein-protein interaction verification (immunoprecipitation): a. Protein extraction: FLAG-tagged Hinderin expression plasmids were transfected into 293T cells. After 48 hours, cells were washed with pre-chilled PBS, and RM lysis buffer containing 0.2% SDS was added. Lysis was performed on ice for 30 minutes, followed by sonication. The cells were centrifuged at 12,000 rpm for 15 minutes at 4°C, and the supernatant was collected to determine protein concentration.

[0047] The SDS configuration is as follows: reagents Final concentration SDS 1% Tris-HCl, pH 7.5 50 mM NaCl 150 mM Sodium orthovanadate 2 mM EDTA 1 mM PMSF 1 mM Protease inhibitor cocktail 1× Phosphatase inhibitor cocktail 1× After preparation, immediately dispense into 1.5mL enzyme-free EP tubes and freeze at -20℃ for later use.

[0048] b. Immunoprecipitation: Take 800 μL of the lysate supernatant containing 2 mg of total protein, add 0.5 μL of anti-GFP antibody (since FLAG-Hinderin and GFP-Hinderin work on the same principle, GFP antibody is used as an example here), and incubate overnight at 4°C by rotation. The next day, add pretreated Protein A agarose beads and incubate for 7 hours at 4°C by rotation.

[0049] c. Washing and elution: Wash the agarose beads four times with RM lysis buffer, rotating at high speed for 5 minutes each time. Aspirate as much liquid as possible, add 40 μL of 2× Loading Buffer to the agarose beads, and heat at 95°C for 10 minutes to denature and dissociate the binding proteins.

[0050] The RM configuration is as follows: reagents Final concentration NaCl 150 mM NaF 10 mM Tris-HCl, pH 7.5 50 mM NP-40 1% Sodium orthovanadate 1mM Deoxycholate 0.1% β-Glycerolphosphate 10 mM PMSF 1mM Protease inhibitor cocktail 1× Phosphatase inhibitor cocktail 1× After adjusting the pH to 7.4-7.5, add PMSF, protease and phosphatase inhibitor, and finally add RO water to make up the volume.

[0051] d. Immunoblotting: IP samples and Input samples (total protein lysis buffer) were subjected to SDS-PAGE electrophoresis, transferred to a membrane, and blocked. Immunoblotting analysis was performed using anti-PCM1 antibody (rabbit-derived) and anti-GFP antibody (mouse-derived).

[0052] The electrophoresis buffer is prepared as follows: reagents Mass (g) SDS 5 Tris base 15 glycine 72 The transfer buffer is prepared as follows: reagents Mass (g) Tris base 30 glycine 141 e. Results: In cells transfected with FLAG-Hinderin, the PCM1 protein band was detected in the precipitate by immunoprecipitation with anti-GFP antibody, but not in the untransfected group or the group using the control antibody. This confirms that Hinderin and PCM1 interact directly in the cell.

[0053] Example 4: Hinderin knockout disrupts PCM1's satellite positioning Use Hinderin knockout APRE19 cell lines (which can be constructed using CRISPR / Cas9 technology) or serum-free induced Hinderin siRNA knockdown cells.

[0054] Cells were stained using the cell immunofluorescence procedure described in Example 2, with anti-acetylated α-tubulin antibody and anti-PCM1 antibody as primary antibodies.

[0055] High-resolution imaging using laser confocal microscopy.

[0056] Results: In Hinderin knockout / knockdown cells, the aggregation and localization (satellite-like structures) of PCM1 protein around the centrioles were significantly disrupted, exhibiting a diffuse or irregular distribution, while the signal of the ciliary marker acetylated α-tubulin showed cilia shortening. This suggests that Hinderin is essential for maintaining the proper localization of PCM1 around the centrioles, which may be a key mechanism for its regulation of ciliary length.

[0057] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. The use of a Hinderin protein or its encoding gene in the preparation of products for promoting ciliary elongation.

2. The application according to claim 1, characterized in that, The cilia are the cilia of the photoreceptor cells in the animal retina.

3. The application according to claim 1, characterized in that, The cilia are those of APRE19 cells.

4. The application according to any one of claims 1-3, characterized in that, The application promotes ciliary elongation by increasing the expression or activity of Hinderin protein in target cells or tissues.

5. The application according to claim 1, characterized in that, The product is a reagent, pharmaceutical composition, or gene therapy vector containing Hinderin protein, an agonist of Hinderin protein, or a gene encoding Hinderin protein.

6. The application according to claim 5, characterized in that, The gene encoding the Hinderin protein is delivered via a plasmid or adeno-associated virus vector containing the gene.

7. The use of a Hinderin protein or its encoding gene in the preparation of a product for maintaining or promoting the proper localization of PCM1 protein around centrioles.

8. The application according to claim 7, characterized in that, The Hinderin protein is a Hinderin protein that can interact with the PCM1 protein.

9. The application according to claim 1 or 7, characterized in that, The application is based on the interaction between the Hinderin protein and the PCM1 protein.

10. A method for screening candidate substances for promoting ciliary elongation, characterized in that, The method includes detecting the effect of candidate substances on the expression or activity of Hinderin protein, and / or detecting the effect of candidate substances on the interaction between Hinderin protein and PCM1 protein.

Images