Chimeric antigen receptor targeting MUC16 and application thereof in tumor treatment

Abstract

The invention belongs to the technical field of biological medicine and molecular biology, and particularly relates to a chimeric antigen receptor targeting MUC16 and application of the chimeric antigen receptor in tumor treatment. Specifically, aiming at MUC16 molecules, a single-chain antibody with high affinity is successfully prepared, on the basis of high-affinity scFv, a CAR carrier and CAR-NK cells for recognizing MUC16 are constructed, PD1 of the CAR-NK cells is further knocked out through a CRISPR / Cas9 system, immune cell depletion is reduced, and then the purpose of synergistically and effectively treating tumors is achieved. According to the invention, severe cytokine storm, neurotoxicity or graft versus host disease can be avoided, the side effect is small, and immune escape can be prevented. Moreover, the NK92 cell line can be amplified and passaged infinitely, and the cost is lower, so that the NK92 cell line is more suitable for treating solid tumors, and has a good practical application value.

Description

Technical Field

[0001] This invention belongs to the fields of biomedicine and molecular biology, specifically relating to a chimeric antigen receptor targeting MUC16 and its application in tumor treatment. Background Technology

[0002] The information disclosed in the background section of this invention is intended only to enhance the understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Ovarian cancer is a common malignant tumor of the female reproductive system, ranking third in incidence but first in mortality among gynecological malignancies. According to the latest statistics from the American Cancer Society, there were 19,680 new cases of ovarian cancer and 12,740 deaths in 2024, with a five-year overall survival rate of approximately 49%. Due to the insidious nature of early clinical symptoms and poor prognosis, traditional surgery combined with platinum-based paclitaxel chemotherapy has made some progress, but has not significantly improved patient survival rates. Therefore, new treatment strategies are urgently needed to improve the current situation.

[0004] Tumor immunotherapy has become one of the most promising treatment directions in oncology. It mainly utilizes the body's own immune system to induce tumor immune surveillance or reverse tumor immune escape to kill cancer cells. Studies have shown that ovarian cancer is an immunogenic tumor, and its survival rate is positively correlated with the degree of tumor-infiltrating lymphocytes (especially CD8+ T cells). Immune escape mechanisms mediated by inhibitory cells such as T regulatory cells are associated with poor survival rates. Based on the above, patients with epithelial ovarian cancer may benefit from immunotherapy. Currently, the main immunotherapy strategies for ovarian cancer include: (1) monoclonal antibody therapy (including bispecific antibodies, checkpoint inhibitors, etc.); (2) vaccine therapy; (3) adoptive cell therapy. In this study, based on ovarian cancer, we constructed the CAR-NK immunotherapy target MUC16, precisely targeting a specific antigen protein. We then used the CRISPR / Cas9 system to knock out PD1, blocking its binding to the PDL1 ligand, thereby enhancing the ability of NK cells to fight tumors and achieving the goal of synergistic and effective tumor treatment. This provides a new strategy for the treatment of ovarian cancer and solid tumors.

[0005] Chimeric antigen receptor T-cell immunotherapy (CAR-T) is a novel, precise, targeted immunotherapy that has achieved significant clinical efficacy in hematological malignancies. CAR-T involves gene modification, inserting a specially designed DNA fragment encoding a CAR into T cells. This CAR fragment binds directly to antigens on the tumor surface, activating the T cells to release a large number of effector factors, thereby efficiently killing tumor cells. In some preclinical animal model studies and registered clinical trials, CAR-T therapy has brought new hope to ovarian cancer patients. However, this therapy also has certain limitations, mainly due to its complex manufacturing process, high cost, and serious adverse reactions such as cytokine release syndrome. Compared to the emerging T-cell immunotherapy, natural killer (NK) cells may be a better carrier for CAR. According to data from the first CAR-NK clinical trial in the United States published by MD Anderson Cancer Center, among 11 patients with relapsed or refractory non-Hodgkin's lymphoma (NHL) and chronic lymphocytic leukemia (CLL) treated with umbilical cord blood-derived CAR-NK cells, 7 achieved significant remission without side effects such as cytokine storms or neurotoxicity, demonstrating its safety and efficacy. NK cells are widely available, inexpensive, and have low immunogenicity; their cell lines can be expanded and passaged indefinitely. Furthermore, CAR-NK cells possess broad-spectrum anti-cancer properties. Besides inhibiting cancer cells by recognizing tumor surface antigens with single-chain antibodies, NK cells can also inhibit cancer cells by recognizing various ligands through multiple receptors, such as natural cytotoxic receptors (NKp46, NKp44, and NKp30), NKG2D, and DNAM-1 (CD226), and are not MHC-restricted. However, there are still few reports on CAR-NK therapy for ovarian cancer. Summary of the Invention

[0006] To address the shortcomings of the existing technologies, the present invention aims to provide a chimeric antigen receptor targeting MUC16 and its application in tumor therapy. Specifically, the present invention successfully prepared a high-affinity single-chain antibody targeting the MUC16 molecule. Based on this high-affinity scFv, a CAR vector recognizing MUC16 and CAR-NK cells were constructed. Furthermore, the PD1 of CAR-NK cells was knocked out using the CRISPR / Cas9 system to reduce immune cell exhaustion, thereby achieving a synergistic and effective treatment of tumors. Based on the above research results, the present invention is thus completed.

[0007] To achieve the above-mentioned technical objectives, the present invention provides the following technical solution:

[0008] In a first aspect, the present invention provides a chimeric antigen receptor targeting MUC16, which is composed of at least a signal peptide, an antigen-binding domain, a transmembrane region, a co-stimulatory signal transduction domain, and a signal transduction domain connected in series.

[0009] The signal peptide may be the CD8 signal peptide; The antigen-binding domain contains a single-chain antibody (scFv) targeting MUC16. The transmembrane region can be a CD28 transmembrane region; The co-stimulatory signal transduction domain can be a CD28 and CD137 (4-1BB) co-stimulatory signal transduction domain; The signal conduction structure domain can be the CD3ζ signal conduction structure domain.

[0010] Furthermore, the chimeric antigen receptor targeting MUC16 is a third-generation CAR.

[0011] In a second aspect, the present invention provides a nucleic acid molecule that encodes a chimeric antigen receptor for the target MUC16.

[0012] The nucleic acid molecule encodes a third-generation CAR vector targeting MUC16, and the vector sequence structure sequentially includes EF1a promoter-CD8 leader-MUC16 single-chain antibody-human Fc hinge region-CD28 transmembrane region-CD28 and CD137(4-1BB) intracellular region-CD3ζ intracellular signaling molecule.

[0013] Furthermore, in this invention, to facilitate subsequent screening and detection, an EGFP fluorescent reporter gene is inserted and ligated using 2A.

[0014] Therefore, the vector sequence structure sequentially includes EF1a promoter-CD8 leader-MUC16 single-chain antibody-human Fc hinge region-CD28 transmembrane region-CD28 and CD137(4-1BB) intracellular region-CD3ζ intracellular signaling molecule-2A-EGFP.

[0015] In one specific embodiment of the present invention, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.1.

[0016] A third aspect of the present invention provides a recombinant expression vector comprising the above-described nucleic acid molecules.

[0017] According to the present invention, the recombinant expression vector can be a viral vector, including retroviral vectors and lentiviral vectors; more preferably, it is a lentiviral vector, wherein the recombinant expression vector is obtained by inserting a nucleic acid molecule encoding the above-mentioned single-chain antibody or chimeric antigen receptor into a virus to obtain a recombinant viral expression vector expressing the above-mentioned single-chain antibody or chimeric antigen receptor.

[0018] In a fourth aspect, the present invention provides a CAR-NK cell, wherein the CAR-NK cell is an NK cell modified by the chimeric antigen receptor targeting MUC16, thereby providing a necessary therapeutic means for the treatment of diseases mediated by MUC16 high expression.

[0019] In this invention, the CAR-NK cells can be obtained by infecting NK cells with lentivirus; wherein the lentivirus is obtained by transfecting lentivirus packaging cells with a recombinant lentivirus expression vector, followed by cell culture; the recombinant lentivirus expression vector is obtained by inserting the coding gene of the chimeric antigen receptor into a lentivirus expression vector. In fact, those skilled in the art can prepare the above-mentioned CAR-NK cells using existing known techniques, and no specific limitations are made here.

[0020] In this invention, the NK cells can specifically be NK92 cells.

[0021] In another specific embodiment of the present invention, the CAR-NK cells are CAR-NK cells with the PD1 gene knocked out.

[0022] The PD1 gene knockout can be performed using the CRISPR / Cas9 system. Specifically, a highly specific sgRNA for the PD1 gene sequence is designed, and the sgRNA and Cas9 coding sequence are cloned into a vector. The vector is then introduced into MUC16-CAR-NK cells using electroporation, and further screening is performed to obtain MUC16-CAR-NK cells with the PD1 gene knocked out.

[0023] Furthermore, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.3.

[0024] In a fifth aspect, the present invention provides a medicament for the prevention and / or treatment of diseases mediated by MUC16 overexpression, comprising any one or more of the following: the chimeric antigen receptor, CAR-NK cells, or the nucleic acid molecule and recombinant expression vector.

[0025] The drug, according to conventional practices, can be formulated into oral, topical, suppository, and sterile injectable solutions in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, and sprays.

[0026] The drug may also include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may be a buffer, emulsifier, suspending agent, stabilizer, preservative, excipient, filler, coagulant and modifier, surfactant, dispersant, or defoamer.

[0027] The drug may also include a pharmaceutically viable carrier. The pharmaceutically viable carrier may be a microcapsule, liposome, nanoparticle, or polymer, or any combination thereof. The delivery carrier of the pharmaceutically viable carrier may be a liposome, a biocompatible polymer (including natural and synthetic polymers), a lipoprotein, a polypeptide, a polysaccharide, a lipopolysaccharide, an artificial viral envelope, inorganic (including metal) particles, and bacterial, bacteriophage, viscous, or plasmid carriers, thereby broadening its application scope.

[0028] The drug may also be used in combination with other drugs for the prevention and / or treatment of diseases mediated by MUC16 high expression. Other preventive and / or therapeutic compounds may be administered simultaneously with the main active ingredient or in the same composition.

[0029] Furthermore, the drug can be administered into the body via known methods, such as intravenous systemic delivery or local injection into the tissue of interest. Such administration can be performed via single or multiple doses. Those skilled in the art will understand that the actual dose to be administered in this invention can vary considerably depending on a variety of factors, such as the target cells, biological type or tissue, the general condition of the subject to be treated, the route of administration, the manner of administration, etc.

[0030] Furthermore, the drug can be administered to humans or non-human mammals, including mice, rats, guinea pigs, rabbits, dogs, monkeys, and chimpanzees, with humans being the preferred candidate.

[0031] This invention demonstrates through research that in vitro experiments using CAR-NK cells targeting MUC16 show that these cells can effectively eliminate MUC16+ ovarian cancer cells, while in vivo experiments show that MUC16 CAR-NK cells are effective against ovarian cancer. In particular, CAR-NK cells with PD1 gene knockout exhibit even better anti-tumor effects. Therefore, diseases mediated by high MUC16 expression include neoplastic diseases, specifically solid tumors and hematologic malignancies, with ovarian cancer being a preferred candidate.

[0032] A sixth aspect of the present invention provides a detection product that may comprise any one or more of the following: chimeric antigen receptor, CAR-NK cells, drug, nucleic acid molecule and recombinant expression vector.

[0033] The testing product may be a test kit or a test device, etc., and there is no limitation on it.

[0034] Of course, as a test kit or test device, test reagents such as buffer solutions and cleaning solutions are readily available and are not specifically limited here.

[0035] In this invention, the detection product can be used to qualitatively or quantitatively detect the expression of MUC16, and can then be used for basic research on MUC16-related physiological or pathological changes or applied in actual clinical practice. Actual clinical applications include, but are not limited to, screening, (aid) diagnosis, monitoring or predicting the progression of diseases mediated by high expression of MUC16, thereby broadening its application scope.

[0036] The beneficial technical effects of one or more of the above technical solutions are as follows: The aforementioned technical solution provides a novel method for treating ovarian cancer by combining a CAR vector targeting MUC16 with NK92 immune cells. Utilizing a CAR vector targeting MUC16, the target is precisely locked onto a specific antigen protein, enabling accurate identification and efficient elimination of cancer cells. Furthermore, the CRISPR / Cas9 system is used to knock out PD1, reducing immune cell exhaustion and achieving a synergistic and effective treatment of tumors.

[0037] Furthermore, the aforementioned technical solutions avoid severe cytokine storms, neurotoxicity, or graft-versus-host disease, have fewer side effects, and can prevent immune escape. Moreover, the NK92 cell line can be infinitely expanded and passaged, and its low cost makes it more suitable for the treatment of solid tumors, thus demonstrating significant practical application value. Attached Figure Description

[0038] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0039] Figure 1 The infection efficiency of the MUC16-CAR-NK92 constructed in Example 1 of this invention.

[0040] Figure 2 This refers to the knockout efficiency of the PD1 gene in MUC16-CAR-NK92 / PD1 (-) in Example 1 of this invention.

[0041] Figure 3 This illustrates the killing effect of MUC16-CAR-NK92 on various ovarian cancer cells in Example 2 of this invention.

[0042] Figure 4 This describes the killing effect of MUC16-CAR-NK92 / PD1 (-) on various ovarian cancer cells in Example 2 of this invention.

[0043] Figure 5 This demonstrates the cell-killing effect of MUC16-CAR-NK92 / PD1 (-) on in vitro tumor cultures of ovarian cancer in Example 3 of this invention.

[0044] Figure 6 This is the result of the in vivo tumor-killing experiment in Example 4 of the present invention. Detailed Implementation

[0045] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0046] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0047] The present invention will now be further illustrated with specific examples. These examples are for illustrative purposes only and do not limit the scope of the invention. Unless otherwise specified, experimental conditions not explicitly stated in the examples are generally performed under conventional conditions or as recommended by the reagent company. Unless otherwise specified, all reagents and consumables used in the following examples are commercially available.

[0048] The following examples further illustrate the present invention, but do not constitute a limitation thereof. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention. The following examples illustrate test methods with specific conditions, which are generally performed under conventional conditions.

[0049] Example 1: Construction of MUC16-CAR-NK92 / PD1(-) The scFv sequence of the MUC16-targeting antibody was obtained, and a CAR sequence structure was constructed. The CAR sequence structure sequentially includes the EF1a promoter, CD8 signal peptide sequence, scFv sequence of the MUC16-targeting antibody, human Fc hinge region sequence, CD28 transmembrane region sequence, CD28 and CD137 (4-1BB) intracellular region sequences (second signal for T cell activation), and CD3ζ intracellular signal molecule (first signal for T cell activation). Simultaneously, for convenient subsequent screening and detection, an EGFP fluorescent reporter gene was inserted and linked using 2A. The second-generation lentiviral packaging systems psPAX2 and pMD2.G were used. The lentiviral expression vector was packaged in HEK293T cell lines using Lipofectamine 2000. The packaged virus was concentrated and purified, and then used to infect NK92 cells to obtain MUC16-targeting CAR-NK92 cells (MUC16-CAR-NK92). Flow cytometry analysis was performed on EGFP-positive cells. CAR-NK92 cells targeting CD19 were obtained using the same method as a control group. Detection efficiency see Figure 1 .

[0050] (1) Nucleotide sequence of chimeric antigen receptor targeting MUC16 GCTTGGGCTGCAGGTCGACTCTAGA GGATCC GGATCC ATGGGCAGCGGCGCCACCAACTTCAGCCTGCTGAAGCAGGCCGGTGACGTGGAGGAGAATCCCGGCCCTGATCCCCGGGTACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGT (SEQ ID NO. 1) (2) Nucleotide sequence of the chimeric antigen receptor targeting CD19 GAGAGCTTGGGCTGCAGGTCGACTCTAGA GGATCC GGATCC ATGGCCACCAACTTCAGCCTGCTGAAGCAGGCCGGTGACGTGGAGGAGAATCCCGGCCCTGGAGGAGGTGGAAGCGGA (SEQ ID NO.2) (3) CRISPR / Cas9 system knockout of PD1 Based on the database, a highly specific sgRNA for the PD1 gene sequence and corresponding TIDE detection primers were designed. Then, purified Cas9 was fused with an in vitro complex of sgRNA and ribonucleoproteins (RNPs). Using 4D-Nucleofector™ X-Unit electroporation technology, small pores were instantaneously created in the cell membrane by applying electrical pulses, and the complex was introduced into MUC16-CAR-NK92 cells to exert its effect. Further screening yielded MUC16-CAR-NK92 / PD1(-) cells, and the knockout efficiency was detected using TIDE. Experimental results are shown below. Figure 2 The successful construction of the PD1 gene knockout MUC16-CAR-NK92 / PD1 was confirmed. - cell.

[0051] The sgRNA and primer sequence information are as follows: PD1-sgRNA: GTCTGGGCGGTGCTACAACT (SEQ ID NO.3) TIDE-PD1-F:TCTGTCTCTCTCTCCTCC (SEQ ID NO.4) TIDE-PD1-R: CACACAGCTCAGGGTAAGG (SEQ ID NO.5) Example 2 In vitro tumor-killing experiment The killing ability against target cells (ovarian cancer cells OVCAR3-LUCI and overexpressing cell lines OVCAR3-MUC16, COV362-LUCI and overexpressing cell line COV362-MUC16, SKOV3 and overexpressing cell line SKOV3-MUC16) was detected using the Luciferase luminescence intensity method.

[0052] 1) Target cells stably expressing Luciferase were divided into groups of 1×10⁻⁶ cells. 4 Lay it in a 96-well plate; 2) MUC16-CAR-NK92, MUC16-CAR-NK92 / PD1 - Cells were added to the target cells at an effector-to-target ratio of 2.5:1; 3) The luminescence intensity of Luciferase was detected in the target cells 4 hours later; The specific procedures should be performed according to the instructions of the Bright-Lumi™ Firefly Luciferase Reporter Gene Detection Kit (Beyotime, RG051M).

[0053] 4) Tumor inhibition rate = 1 - (lumen value of experimental group - lumen value of blank control group) / (lumen value of negative control group - lumen value of blank control group) × 100%.

[0054] The experimental results are shown in Figure 3-4 The results showed that MUC16-CAR-NK92 had a specific killing ability against ovarian cancer cells with high MUC16 expression, which differed from the control group (unmodified NK92, etc.). PD1 gene knockout followed by MUC16-CAR-NK92 / PD1... - The killing efficiency of cells against SKOV3, COV362, OVCAR3 and their MUC16 overexpression strains was significantly improved.

[0055] Example 3: In vitro tumor culture cytotoxicity experiment 1) Fresh tumor tissue was obtained from the operating room (written informed consent was obtained from the patient for all tissue samples), and the tissue was minced into pieces of approximately 1-5 mm. 3 Size. The cells were digested using collagenase I and IV, passed through a 70µm sieve, and red blood cells were removed to obtain a primary single-cell suspension.

[0056] 2) One part was analyzed by flow cytometry for NK cell exhaustion markers: LAG3, TIGIT, PD-1, and TIM-3. The other part was fixed with paraformaldehyde for immunohistochemical detection.

[0057] 3) Primary single cells were divided into groups of 1×10⁻⁶. 4 Lay them in a 96-well plate; NK92, CD19-CAR-NK92, MUC16-CAR-NK92, MUC16-CAR-NK92 / PD1 - They were co-cultured with tumor single-cell suspension at an efficacy-to-target ratio of 2.5:1.

[0058] 4) Perform an LDH release assay on the target cells 4 hours later. Follow the MCE instruction manual for specific procedures.

[0059] 5) Cytotoxicity (%) = [(XZ) / (YZ)] × 100% Where X: absorbance value of sample well - absorbance value of background blank well Where Y: absorbance value of high control well - absorbance value of high control blank well Where Z: absorbance value of low control wells - absorbance value of background blank wells The experimental results are shown in Figure 5 This indicates that MUC16-CAR-NK92 / PD1 - It exhibits stronger in vitro cytotoxicity against tumor cells derived from fresh clinical ovarian cancer tissue, indicating that the cells can also effectively kill primary tumor cells.

[0060] Example 4: In vivo tumor-killing experiment 1) Overexpressing the cell line COV362-MUC16 (1x10) 7 NOG mice were subcutaneously inoculated with 100 μL PBS to construct a subcutaneous CDX model of epithelial ovarian cancer.

[0061] 3) One week later, the mice were randomly divided into 5 groups (n=5 per group). On days 0, 7, 14, and 21, the mice were injected via the tail vein with 100 μL of PBS, NK92, CD19-CAR-NK92, MUC16-CAR-NK92, and MUC16-CAR-NK92 / PD1. - (5×10) 6 (Number) cells. 4) At the specified analysis time, all mice were euthanized by intraperitoneal injection of sodium pentobarbital (200 mg / kg), and then the tumors were removed.

[0062] Results of tumor killing in vivo Figure 6 As shown, the PBS group exhibited the fastest tumor growth, while the MUC16-CAR-NK92 and MUC16-CAR-NK92 / PD1 groups showed the fastest growth. - The group showed significant anti-tumor effects.

[0063] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A chimeric antigen receptor targeting MUC16, characterized in that, It consists of at least a signal peptide, an antigen-binding domain, a transmembrane region, a co-stimulatory signal transduction domain, and a signal transduction domain connected in series; Wherein, the signal peptide is the CD8 signal peptide; The antigen-binding domain contains a single-chain antibody targeting MUC16; The transmembrane region is the CD28 transmembrane region; The co-stimulatory signal transduction domain is the CD28 and CD137 (4-1BB) co-stimulatory signal transduction domain; The signal conduction structure domain is the CD3ζ signal conduction structure domain.

2. The chimeric antigen receptor as described in claim 1, characterized in that, The chimeric antigen receptor targeting MUC16 is a third-generation CAR.

3. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the chimeric antigen receptor for the target MUC16.

4. The nucleic acid molecule as described in claim 3, characterized in that, The nucleic acid molecule encodes a third-generation CAR vector targeting MUC16, and the vector sequence structure sequentially includes EF1a promoter-CD8 leader-MUC16 single-chain antibody-human Fc hinge region-CD28 transmembrane region-CD28 and CD137(4-1BB) intracellular region-CD3ζ intracellular signaling molecule. Furthermore, the nucleic acid molecule also includes an inserted EGFP fluorescent reporter gene, linked using 2A; Furthermore, the vector sequence structure sequentially includes EF1a promoter-CD8 leader-MUC16 single-chain antibody-human Fc hinge region-CD28 transmembrane region-CD28 and CD137(4-1BB) intracellular region-CD3ζ intracellular signaling molecule-2A-EGFP.

5. The nucleic acid molecule as described in claim 3, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

1.

6. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the nucleic acid molecule as described in any one of claims 3-5.

7. A CAR-NK cell, characterized in that, The CAR-NK cells are NK cells modified with a chimeric antigen receptor targeting MUC16 as described in claim 1 or 2; Furthermore, the CAR-NK cells are CAR-NK cells with the PD1 gene knocked out.

8. A medicament for the prevention and / or treatment of diseases mediated by MUC16 high expression, comprising any one or more of the following: the chimeric antigen receptor of claim 1 or 2, the CAR-NK cell of claim 7; or the nucleic acid molecule of any one of claims 3-5 and the recombinant expression vector of claim 6.

9. The medicament as described in claim 8, characterized in that, The diseases mediated by high MUC16 expression include neoplastic diseases, including solid tumors and hematologic malignancies, with ovarian cancer being a preferred option.

10. A testing product, characterized in that, It comprises: the chimeric antigen receptor of claim 1 or 2, the CAR-NK cell of claim 7; or any one or more of the nucleic acid molecule of any one of claims 3-5, the recombinant expression vector of claim 6, and the drug of claim 8 or 9; The detection product is used to qualitatively or quantitatively detect the expression of MUC16.

Images