Gene composition, mitochondrial-containing vesicles based on adipocytes and application of mitochondrial-containing vesicles

By delivering CD38, shLDHA, and ANXA1 genes into adipocytes, a biofactory that continuously secretes targeted mitochondrial vesicles is constructed, solving the problems of operational complexity, low delivery efficiency, and immune rejection in mitochondrial therapy, and achieving long-term and precise repair of myocardial injury.

CN122060748APending Publication Date: 2026-05-19CHINA PHARM UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
CHINA PHARM UNIV
Filing Date
2026-02-25
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Existing mitochondrial therapies are complex to operate, have low delivery targeting, short-lived effects, and can cause immune rejection, making them difficult to effectively treat myocardial damage diseases.

Method used

By reprogramming adipocytes in vivo with a gene composition to continuously secrete targeted mitochondrial vesicles, the CD38 gene is used to activate the calcium signaling pathway to promote vesicle packaging and efflux, the shLDHA gene inhibits lactate metabolism to enhance vesicle transport, and the ANXA1 gene endows vesicles with targeting capabilities, thus achieving precise delivery.

Benefits of technology

It achieves simple, efficient and safe myocardial injury repair. Vesicles are passively enriched at the site of injury, effectively repairing myocardial cell energy metabolism and angiogenesis, and reducing immune response.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122060748A_ABST
    Figure CN122060748A_ABST
Patent Text Reader

Abstract

The invention discloses a gene composition, a mitochondrial-containing vesicle based on fat cells and application of the mitochondrial-containing vesicle. The gene composition containing a CD38 gene, an shLDHA gene and an ANXA1 gene is delivered or transferred into the fat cells; after the adipocyte expresses the gene, the adipocyte continuously secretes vesicles which express ANXA1 on the surface and internally contain functional mitochondria. The vesicle constructed by the invention is used as a natural carrier, functional mitochondria is accurately delivered to a myocardial injury area through blood circulation, myocardial cell energy metabolism is repaired, vascular endothelial cell functions and angiogenesis are promoted, cell apoptosis and fibrosis are inhibited, and finally heart functions are improved. According to the method, complex processes of in-vitro separation, purification and vesicle reinjection are avoided, a biological factory with a continuous effect is constructed by utilizing endogenous fat cells, the method has the outstanding advantages of simplicity and convenience in operation, lasting effect, strong targeting property, low immunogenicity and the like, and a brand new treatment strategy is provided for myocardial injury diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a gene composition, mitochondrial vesicles based on adipocytes, and their applications. Background Technology

[0002] Myocardial injury, such as myocardial infarction, ischemia-reperfusion injury, and chemotherapy-induced cardiomyopathy, is a major cause of heart failure and death. One of its core pathological mechanisms is severe dysfunction of cardiomyocyte mitochondria. Damaged mitochondria lead to insufficient ATP production and excessive accumulation of reactive oxygen species, which in turn triggers cardiomyocyte apoptosis, necrosis, and pathological fibrotic remodeling, ultimately impairing the heart's pumping function. Furthermore, the disruption of the vascular network following myocardial injury leads to insufficient perfusion, further exacerbating ischemia and the energy crisis. Therefore, the ideal treatment strategy should simultaneously focus on repairing cardiomyocytes and promoting angiogenesis to comprehensively restore cardiac structure and function.

[0003] In recent years, mitochondrial transplantation or supplementation has received widespread attention as an emerging treatment strategy. The basic idea is to compensate for or replace functionally deficient mitochondria in damaged cardiomyocytes by externally supplementing healthy mitochondria. However, existing technical approaches mainly rely on isolating mitochondria or mitochondrial-enriched vesicles from cells cultured in vitro (such as mesenchymal stem cells) and then delivering them via local injection into the myocardium or intravenous injection throughout the body. This method has several significant limitations: (1) The operation process is complex and costly, involving the expansion of donor cells, extraction, purification, and quality control of mitochondria or vesicles; (2) The isolation process may cause structural damage and functional inactivation of mitochondria; (3) The systemic delivery targeting efficiency is extremely low, with the vast majority of mitochondria being cleared by the mononuclear phagocytic system in the liver, spleen, etc., and only a small number reaching the heart; (4) Allogeneic mitochondria or vesicles may trigger an immune rejection reaction; (5) The therapeutic effect of a single injection is short-lived and difficult to cope with chronic and continuous damage processes.

[0004] Adipose tissue, as an organ with abundant reserves, easy access, and high metabolic activity and secretory function, offers a new approach to solving this problem. Adipocytes can secrete large amounts of extracellular vesicles, participating in long-range intercellular communication. If genetic engineering technology could be used to directly modify autologous adipocytes in vivo into a source for the continuous production and release of "therapeutic mitochondrial vesicles," it would be possible to overcome all the bottlenecks of existing technologies.

[0005] To achieve this goal, three key scientific questions need to be addressed: how to drive adipocytes to actively package functional mitochondria into vesicles, how to enhance the secretion efficiency of these vesicles, and how to endow them with precise targeting capabilities against myocardial injury. Currently, no technological solution can systematically address all three questions simultaneously. Summary of the Invention

[0006] Purpose of the Invention: To address the shortcomings of existing mitochondrial therapies in terms of operational complexity, delivery targeting, duration of action, and immune safety, the present invention aims to provide a gene composition, adipocyte-based mitochondrial vesicles, and their applications. This invention represents a novel, integrated treatment strategy. The system constructed using this invention eliminates the need for in vitro operations and, through a single in vivo gene delivery, reprograms endogenous adipocytes into a "biofactory" that sustainably secretes targeted mitochondrial vesicles, achieving long-lasting, precise, and safe repair of myocardial injury.

[0007] Technical solution: To achieve the above objective, the present invention provides a gene composition comprising the CD38 gene, the shLDHA gene, and the ANXA1 gene. The NCBI numbers for the CD38 gene and the ANXA1 gene are ENSG00000004468 and ENSG00000135046, respectively, and the gene sequence of the shLDHA gene is GTTCATCATTCCCAACATTCTCGAGAATGTTGGGAATGATGAAC.

[0008] The CD38 gene is used to upregulate CD38 protein expression, which activates the calcium signaling pathway by catalyzing the generation of cyclic adenosine diphosphate ribose (cADPR), inducing mitochondrial calcium overload, thereby promoting mitochondrial packaging and efflux into vesicles.

[0009] Furthermore, the expression product of the CD38 gene (CD38 protein) is a multifunctional enzyme whose core function is to catalyze the conversion of nicotinamide adenine dinucleotide (NAD+) to cyclic adenosine diphosphate ribose (cADPR). cADPR is an important intracellular second messenger that can activate the reniform base receptor (RyR), causing the release of calcium ions from the endoplasmic reticulum into the cytoplasm. This transient increase in calcium signaling induces mitochondrial calcium overload, which in turn leads to the opening of the mitochondrial osmotic transition pore (mPTP), initiating the active packaging and expulsion of mitochondrial structures (including mitochondrial contents) into exosomes or microvesicles.

[0010] The shLDHA gene is used to inhibit the expression of lactate dehydrogenase A (LDHA), reduce intracellular lactate levels, thereby reducing lactation modification of lysine at position 40 of the ARF1 protein, enhancing the binding of ARF1 to the COPI complex, and promoting the transport and exocytosis of mitochondrial vesicles via the Golgi-endosome system.

[0011] Furthermore, the shLDHA gene is used to specifically knock down the expression of lactate dehydrogenase A (LDHA). LDHA is a key enzyme in the final step of glycolysis, catalyzing the conversion of pyruvate to lactate. Inhibition of LDHA significantly reduces intracellular lactate levels. Studies have shown that lactate can act as a substrate for lactation modification of proteins. ARF1 (ADP-ribosylation factor 1) is a key protein regulating vesicle transport between the Golgi apparatus and endosomes. Lactation modification of its 40th lysine residue (K40) weakens its binding ability to COP I (coating protein complex I), thereby hindering vesicle transport. shLDHA reduces lactate levels, decreases ARF1K40 lactation, and enhances ARF1-COP I interaction, thereby promoting the transport of mitochondrial-loaded vesicles from the Golgi apparatus to endosomes and the cell membrane, ultimately enhancing their exocytosis. This pathway is independent of mitophagy, providing a novel dimension of vesicle secretion regulation.

[0012] The ANXA1 gene is used to enable the expression of annexin A1 (ANXA1) on the surface of secreted vesicles. ANXA1 mediates the specific binding of vesicles to the surface of vascular endothelial cells and cardiomyocytes in ischemic / injured myocardial tissue, thereby achieving targeted delivery.

[0013] Furthermore, the expression product of the ANXA1 gene (annexin A1) is a calcium-dependent phospholipid-binding protein that plays a crucial role in inflammation resolution and tissue repair. When ANXA1 is expressed on the surface of vesicles, it can specifically recognize and bind to corresponding receptors (such as formyl peptide receptors) that are highly expressed on the surface of vascular endothelium and cardiomyocytes in ischemic / injured myocardial tissue, thereby mediating vesicle adhesion, retention, and content delivery at the injury site, achieving precise targeting. It can also passively accumulate locally in the lesion area due to increased vascular permeability and inflammatory cell infiltration in the ischemic area. In addition, ANXA1 can upregulate SIRT3 expression at the transcriptional level, thereby reducing oxidative stress-related damage; and increase PGC-1α levels, promoting mitochondrial biogenesis and energy metabolism remodeling.

[0014] Furthermore, the ANXA1 gene is used to express annexin A1 (ANXA1) on the surface of secreted vesicles. ANXA1 passively accumulates and increases its local concentration at the site of injury by leveraging the microenvironmental characteristics formed by increased vascular permeability and inflammatory cell infiltration in ischemic areas. It also upregulates the expression of deacetylase SIRT3 at the molecular level by activating downstream protective signaling pathways to reduce oxidative stress-related damage. At the same time, it increases the level of peroxisome proliferator-activated receptor gamma coactivator 1α (PGC-1α) to promote mitochondrial biogenesis and energy metabolism reconstruction, thereby synergistically improving the survival and tissue repair of ischemic / injured cardiomyocytes.

[0015] The present invention is based on a plasmid vector system of the gene composition described above, which is formed by mixing plasmids containing three genes and then adding them into liposomes.

[0016] The mitochondrial vesicles based on adipocytes described in this invention deliver or transfer a gene composition containing the CD38 gene, shLDHA gene, and ANXA1 gene into adipocytes; after expressing the genes, the adipocytes continuously secrete vesicles that express ANXA1 on their surface and contain functional mitochondria inside.

[0017] The gene composition is delivered or introduced via liposome nanoparticles, adeno-associated virus vectors, lentiviral vectors, or adenovirus vectors.

[0018] The adipocytes are brown adipocytes, white adipocytes, or preadipocytes in vivo.

[0019] Preferably, the adipocytes are mammalian adipocytes.

[0020] The vesicles have a particle size ranging from 100 nm to 1000 nm, their membrane structure is derived from adipocytes, and they carry one or more complete or substructured functional mitochondria.

[0021] The application of the gene composition, plasmid vector system, or adipocyte-based mitochondrial vesicles described in this invention in the preparation of drugs targeting the repair of myocardial injury.

[0022] The present invention relates to the application of adipocyte-based mitochondrial vesicles in the preparation of drugs that target the repair of myocardial damage.

[0023] The aforementioned myocardial injury diseases include myocardial infarction, myocardial ischemia-reperfusion injury, anthracycline-induced cardiomyopathy, chronic heart failure, and associated myocardial fibrosis.

[0024] The adipocyte-based mitochondrial vesicles deliver functional mitochondria that are internalized by cardiomyocytes and vascular endothelial cells in the damaged area, thereby promoting angiogenesis in ischemic myocardial tissue by improving endothelial cell energy metabolism and function.

[0025] This invention is based on an innovative combination of molecular mechanisms: upregulation of the CD38 gene can actively induce mitochondrial efflux through the cADPR-mediated calcium signaling pathway; shLDHA enhances vesicle transport and exocytosis pathways by inhibiting lactate metabolism and regulating lactation modification of the ARF1 protein; and the ANXA1 gene acts as a "navigation molecule," endowing vesicles with the ability to target damaged tissues. The combined application of these three mechanisms constitutes the theoretical basis of the core technical solution of this invention.

[0026] This invention introduces a gene composition into adipocytes, where CD38 and shLDHA work synergistically to significantly increase the production of functional mitochondrial vesicles at two levels: promoting mitochondrial efflux and enhancing vesicle transport. Simultaneously, ANXA1, a key component, is integrated into the vesicle membrane. These engineered vesicles, upon entering the bloodstream, accumulate in areas of myocardial injury and, through membrane fusion or endocytosis, transfer the healthy mitochondria they carry to energy-depleted cardiomyocytes and impaired vascular endothelial cells. This restores the oxidative phosphorylation function of cardiomyocytes, improves endothelial cell viability, migration, and tubular formation, induces angiogenesis, and ultimately improves cardiac structure and function.

[0027] This invention delivers three gene constructs—encoding CD38 protein, shRNA targeting LDHA (shLDHA), and ANXA1 protein—to adipocytes in mammals. CD38 and shLDHA work synergistically, promoting mitochondrial efflux via the cADPR-mediated calcium signaling pathway and enhancing vesicle transport by regulating lactate metabolism and ARF1 protein lactation modification, respectively, thereby significantly improving the adipocyte's ability to secrete functional mitochondrial vesicles. ANXA1 endows these vesicles with specific targeting capabilities to ischemic / damaged myocardial tissue, synergistically improving ischemic / damaged cardiomyocyte survival and tissue repair through mitochondrial transplantation. These vesicles, acting as natural carriers, precisely deliver functional mitochondria to the damaged myocardial region via blood circulation, repairing cardiomyocyte energy metabolism, promoting vascular endothelial cell function and angiogenesis, inhibiting apoptosis and fibrosis, and ultimately improving cardiac function. This invention avoids the complex process of in vitro separation, purification, and re-injection of vesicles, and utilizes endogenous adipocytes to construct a continuously acting "biofactory". It has outstanding advantages such as simple operation, long-lasting effect, strong targeting, and low immunogenicity, providing a brand-new treatment strategy for myocardial injury diseases.

[0028] This invention designs specific gene compositions that exert therapeutic effects through ANXA1 synergistic mitochondrial transplantation.

[0029] This invention reprograms endogenous adipocytes into "biofactories" that secrete mitochondrial vesicles. In contrast, existing technologies require the separation of mitochondria in vitro before drug delivery. This invention only requires transfecting the constructed plasmid complex containing the gene composition (i.e., the plasmid vector system) into adipocytes, and the vesicles secreted by the adipocytes can enter the heart through blood circulation.

[0030] Beneficial results: Compared with the prior art, the present invention has the following advantages:

[0031] 1. Simple operation, avoiding in vitro procedures: It completely eliminates the complex steps of in vitro cell culture, mitochondrial / vesicle separation, purification, and storage. The entire treatment process can be initiated with just one in vivo gene delivery (such as intravenous injection of liposome nanoparticles), greatly reducing the technical threshold, cost, and risk of contamination.

[0032] 2. Constructing an endogenous "continuous production factory": Transfected adipocytes can survive in the body for a long time and express the target gene, thereby continuously producing and secreting therapeutic vesicles. This provides a long-term treatment modality, especially suitable for diseases such as chronic heart failure that require long-term intervention, overcoming the short-lived effect of a single injection.

[0033] 3. Improved targeted delivery efficiency: ANXA1 modification enables passive enrichment and increased local concentration of vesicles carrying mitochondria at the site of injury; and by activating downstream protective signaling pathways, it reduces oxidative stress-related damage, promotes mitochondrial biogenesis and energy metabolism reconstruction, thereby synergistically improving the survival and tissue repair of ischemic / injured cardiomyocytes.

[0034] 4. High biocompatibility and low immunogenicity: Utilizing the host's own adipocytes as a production facility, the generated vesicles are highly homologous to the host in terms of membrane proteins and lipid composition, almost completely eliminating immune recognition and rejection responses. In vivo safety experiments have also confirmed that it does not induce significant systemic inflammatory responses.

[0035] 5. Synergistic therapeutic effect: CD38, shLDHA and ANXA1 are not simply added together, but form a clever synergy and complement in promoting vesicle generation, secretion and therapeutic effect. The vesicles produced are optimal in terms of quantity, quality (mitochondrial activity) and therapeutic effect, thus achieving a powerful myocardial repair effect. Attached Figure Description

[0036] Figure 1 The particle size distribution and potential of the plasmid vector system in Example 1 are shown, where A is the LNP-DP dual plasmid vector system and B is the LNP-TP triple plasmid vector system.

[0037] Figure 2 The image shows the results of treating AC16 cardiomyocytes with hypoxia-reoxygenation injury using engineered vesicles in Example 2. In the image, A represents cell viability as determined by CCK-8 assay, B represents cytotoxicity as determined by LDH assay, C represents intracellular ATP levels, D represents mitochondrial membrane potential as determined by JC-1 staining, E represents intracellular MDA levels, F represents total intracellular SOD activity, and G represents apoptosis rate as determined by flow cytometry.

[0038] Figure 3This image shows the results of treating HUVEC human umbilical vein endothelial cells with hypoxia-reoxygenation injury using engineered vesicles in Example 2. In the image, A represents cell viability as determined by CCK-8 assay, B represents cytotoxicity as determined by LDH assay, C represents intracellular ATP levels, D represents mitochondrial membrane potential as determined by JC-1 staining, E represents intracellular MDA levels, F represents total intracellular SOD activity, and G represents apoptosis rate as determined by flow cytometry.

[0039] Figure 4 This image shows the results of treating AC16 cardiomyocytes with isoproterenol-induced damage using engineered vesicles in Example 2. In the image, A represents cell viability as determined by CCK-8 assay, B represents cytotoxicity as determined by LDH assay, C represents intracellular ATP levels, D represents mitochondrial membrane potential as determined by JC-1 staining, E represents intracellular MDA levels, F represents total intracellular SOD activity, and G represents apoptosis rate as determined by flow cytometry.

[0040] Figure 5 This image shows the results of treating HUVEC human umbilical vein endothelial cells with isoproterenol-induced damage using engineered vesicles in Example 2. In the image, A represents cell viability as determined by CCK-8 assay, B represents cytotoxicity as determined by LDH assay, C represents intracellular ATP levels, D represents mitochondrial membrane potential as determined by JC-1 staining, E represents intracellular MDA levels, F represents total intracellular SOD activity, and G represents apoptosis rate as determined by flow cytometry.

[0041] Figure 6 The test was conducted to detect the reactive oxygen species level in engineered vesicles of Example 2 that were damaged by ischemia-reperfusion / isoproterenol.

[0042] Figure 7 The content of mitochondrial protein-producing protein (PGC1α) and mitochondrial respiratory chain complex proteins (UQCRC2, SDHB, NDUFB8) in the engineered vesicles of Example 2 was detected. Specific implementation methods

[0043] To make the present invention easier to understand, the present invention will be further described below with reference to specific embodiments. These embodiments are not intended to limit the present invention in any way. They are only used to illustrate the present invention and are not intended to limit the scope of the present invention. Any modifications or changes to the present invention that are easily implemented by those skilled in the art without departing from the technical solution of the present invention will fall within the scope of the claims of the present invention.

[0044] The gene IDs of the genes in this invention on NCBI are as follows:

[0045] ANXA1: ENSG00000135046;

[0046] CD38: ENSG00000004468.

[0047] The gene sequence of shLDHA is: GTTCATCATTCCCAACATTCTCGAGAATGTTGGGAATGATGAAC (SEQ ID NO.1).

[0048] The mouse preadipocyte line 3T3-L1, the human cardiomyocyte line AC16, and the human umbilical vein endothelial cell line HUVEC were purchased from Zhong Qiao Xinzhou.

[0049] Cationic lipids: APExBIO, A8791.

[0050] DSPC: APExBIO, C4911.

[0051] Cholesterol: APExBIO, B1702.

[0052] DSG-PEG2000: APOxBIO, M2002.

[0053] Other commercially available reagents and raw materials of the same type can be used as described above.

[0054] Example 1

[0055] This embodiment aims to illustrate how to obtain the engineered vesicles described in this invention through in vitro transfection.

[0056] In Example 1 of this invention, a biotechnology company was commissioned to construct the following vector plasmids containing the ANXA1 gene, CD38 gene, and shLDHA gene: pcDNA3.1-EGFP-Homo_sapiens_annexin_A1_(ANXA1), pCDNA3.1-Cd38(mouse)-EBFP, and pLKO.1-U6-Ldha(mouse)-shRNA1-Puro, respectively. Their sequences are shown in SEQ ID NO. 2-4, respectively. These vector plasmids were used for subsequent plasmid vector system construction.

[0057] 1. Preparation and characterization of plasmid vector systems:

[0058] Dual plasmid expression genome (LNP-DP): Liposome solutions were prepared by dissolving cationic lipids (898.926 μg), DSPC (221.242 μg), cholesterol (416.809 μg), and DSG-PEG2000 lipids (106.092 μg) in 280 μL of ethanol at a molar ratio of 50 / 10 / 38.5 / 1.5. Then, 81 μg of a vector plasmid containing both the CD38 and shLDHA genes (N / P=6) was diluted with 3 mL of enzyme-free water, with a molar ratio of CD38:shLDHA = 1:1. The aqueous solution was adjusted to pH 4 using 25 mM sodium acetate buffer. Next, the ethanol injection method was used: the lipid solution was slowly and uniformly added dropwise to the rapidly stirred plasmid aqueous solution, followed by rapid stirring for 30 min. Finally, the liposomes were extruded through a liposome extruder three times each at 200 nm and 100 nm polycarbonate membranes. Next, the sample was dialyzed with PBS at room temperature for 20 hours (6-8 kDa) and filtered through a 0.22 μm membrane. Finally, the sample was concentrated by centrifugation at 5000 g and 4 °C for 15 min using a 50 K ultrafiltration tube to obtain the dual plasmid vector system.

[0059] The three-plasmid expression genome (LNP-TP) consisted of cationic lipids (898.926 μg), DSPC (221.242 μg), cholesterol (416.809 μg), and DSG-PEG2000 lipids (106.092 μg) dissolved in 280 μL of ethanol at a molar ratio of 50 / 10 / 38.5 / 1.5, respectively. Then, 81 μg of plasmids containing the ANXA1, CD38, and shLDHA genes (N / P=6) were diluted with 3 mL of enzyme-free water, with a molar ratio of CD38:shLDHA:ANXA1 = 1:1:1. The aqueous solution was adjusted to pH 4 using 25 mM sodium acetate buffer. The ethanol injection method was then used: the lipid solution was slowly and uniformly added dropwise to the rapidly stirred plasmid aqueous solution, followed by rapid stirring for 30 min. Finally, the solution was passed through a liposome extruder three times each at 200 nm and 100 nm polycarbonate membranes. Next, the sample was dialyzed with PBS at room temperature for 20 hours (6-8 kDa) and filtered through a 0.22 μm membrane. Finally, the sample was concentrated by centrifugation at 5000 g and 4 °C for 15 min using a 50 K ultrafiltration tube to obtain the three-plasmid vector system.

[0060] Characterization: The particle size distribution and potential of LNP were measured using a Malvern ZS90 particle size analyzer. The particle size of LNP-DP showed a peak at 167.3 nm, and the potential was around -24.5 mV. Figure 1 A); The LNP-TP particle size has a peak at 181.4 nm, and the potential is around -23.5 mV ( Figure 1 B).

[0061] 2. Cell Culture and Transfection:

[0062] Cells: Mouse preadipocyte line 3T3-L1 was used.

[0063] Culture: First, 3T3-L1 cells were cultured at a rate of 2 x 10⁻⁶. 5 Cells were seeded at a density of 70%-80% in T25 cell culture flasks and placed in DMEM high-glucose medium containing 10% fetal bovine serum. The flasks were incubated at 37°C with 5% CO2 for 24 hours. Two hours before transfection, the medium was replaced with serum-free medium to eliminate serum interference. Then, 100 μL of the three-plasmid vector system (LNP-TP) was precisely added to each flask using a micropipette, slowly dripping along the flask wall to avoid shear damage to the cells. The transfection system was maintained under standard culture conditions for 48 hours.

[0064] 2. Vesicle isolation and collection:

[0065] Cell supernatant was collected 48 hours after transfection.

[0066] Vesicle collection: At 4°C, centrifuge at 2000 ×g for 10 minutes to collect the supernatant, and centrifuge at 20000 ×g for 30 minutes to collect the precipitate.

[0067] Finally, the precipitated vesicles were resuspended in an appropriate amount of PBS (pH 7.4) to obtain engineered vesicles, namely adipocyte-based mitochondrial vesicles.

[0068] Example 2

[0069] Engineered vesicles repair in vitro cardiomyocyte ischemia-reperfusion injury model

[0070] This embodiment aims to verify the repair effect of the engineered vesicles obtained in Example 1 on ischemia-reperfusion injury cardiomyocytes and human umbilical vein endothelial cells.

[0071] 1. Construction of cell damage model:

[0072] Human cardiomyocyte line AC16 and human umbilical vein endothelial cell line HUVEC were used.

[0073] A hypoxia / reoxygenation model was constructed to simulate ischemia-reperfusion injury: Cells were placed in DMEM medium containing 10 mM sodium pyruvate (glucose-free, serum-free) and cultured in a tri-gas incubator (1% O2, 5% CO2, 94% N2) for 12 hours (hypoxia phase). The medium was then replaced with normal complete medium and cultured for another 4 hours under normoxic (21% O2) conditions (reoxygenation phase).

[0074] 2. Grouping and Processing:

[0075] Control group: Normally cultured AC16 cells and HUVEC human umbilical vein endothelial cells.

[0076] Model group: Experiencing hypoxia / reoxygenation injury without treatment.

[0077] Control group vesicle treatment group: At the beginning of the reoxygenation period, vesicles that were not transfected with the ANXA1 plasmid were introduced into the culture medium (prepared using a dual plasmid vector system (LNP-DP in Example 1)).

[0078] ANXA1 modified vesicle group: engineered vesicles prepared in Example 1 (at the same concentration) were added during the reoxygenation period.

[0079] 3. Effectiveness Evaluation:

[0080] Cell viability was detected using the CCK-8 assay. Results ( Figure 2 A, Figure 3 A) shows that cell survival rate in the model group was significantly decreased. Compared with the model group, cell survival rate in the engineered vesicle treatment group was significantly restored.

[0081] Cell damage: Cell membrane damage was assessed by detecting lactate dehydrogenase (LDH) activity in the culture medium. Results ( Figure 2 B. Figure 3 B) shows that, compared with the model group and the vesicle control group, the engineered vesicle treatment group had a significantly lower LDH release, indicating that the treatment can more effectively reduce cell membrane damage.

[0082] Apoptosis: Flow cytometry analysis was performed using Annexin V-FITC / PI double staining. Results ( Figure 2 G, Figure 3 G) showed that the apoptosis rate in both cell model groups was as high as about 20%, while the engineered vesicle treatment group reduced it to about 6%, which was significantly better than the model group and the vesicle control group (about 10%).

[0083] Oxidative stress: Intracellular malondialdehyde (MDA) levels were measured using a lipid oxidation assay kit. Figure 2 E, Figure 3 E). Compared with the model group, the engineered vesicle treatment group showed a significant decrease in MDA content, indicating that intracellular lipid peroxidation was inhibited; compared with the vesicle control group, the engineered vesicle treatment group also showed a lower MDA content. Intracellular superoxide dismutase (SOD) activity was detected by the WST-8 assay. Figure 2 F, Figure 3F). The results showed that the SOD activity in the engineered vesicle treatment group was significantly higher than that in the model group, indicating that this treatment could enhance the antioxidant capacity of cells; compared with the vesicle control group, the increase in SOD activity in the engineered vesicle treatment group was more significant. Intracellular reactive oxygen species (ROS) levels were detected using the fluorescent probe DCFH-DA. Figure 6 The engineered vesicle treatment group showed a significant decrease in ROS levels compared to the model group, indicating a reduction in oxidative stress damage; compared to the vesicle control group, the engineered vesicle treatment group performed better in reducing ROS levels.

[0084] Mitochondrial function:

[0085] ATP levels: Intracellular ATP content was detected using the luciferase assay. Results ( Figure 2 C Figure 3 C) shows that the ATP level of cells decreases by about 50% after injury, and engineered vesicle treatment can restore it to more than 80% of the normal level, with a better recovery effect than the vesicle control group.

[0086] Mitochondrial membrane potential: Detected using the JC-1 fluorescent probe. Flow cytometry analysis ( Figure 2 D、 Figure 3 D) showed that the mitochondrial membrane potential of the model group cells decreased significantly (red / green fluorescence ratio decreased), while the ratio of the engineered vesicle treatment group increased significantly, with the recovery level close to that of the normal control group and better than that of the vesicle control group.

[0087] Mitochondrial functional proteins: Western blot analysis confirmed that the expression levels of mitochondrial generation-related proteins (PGC1α) and mitochondrial respiratory chain complex proteins (UQCRC2, SDHB, NDUFB8) in the engineered vesicle treatment group were significantly higher than those in the model group and also higher than those in the vesicle control group. Figure 7 ).

[0088] Example 3

[0089] Engineered vesicles repair an in vitro ISO-induced cardiomyocyte injury model

[0090] This embodiment aims to verify the repair effect of the engineered vesicles obtained in Example 1 on ISO-induced damaged cardiomyocytes and human umbilical vein endothelial cells.

[0091] 1. Construction of cell damage model:

[0092] Human cardiomyocyte line AC16 and human umbilical vein endothelial cell line HUVEC were used.

[0093] To construct an ISO-induced cell damage model, cells were placed in DMEM medium containing 10% fetal bovine serum, and isoproterenol was added to a final concentration of 1 mM. The cells were then incubated in the dark for 24 hours. Subsequently, the medium was replaced with normal complete medium.

[0094] 2. Grouping and Processing:

[0095] Control group: Normally cultured AC16 cells and HUVEC human umbilical vein endothelial cells.

[0096] Model group: Experiencing ISO-induced damage without treatment.

[0097] Control vesicle treatment group: After replacing with normal complete culture medium, vesicles that were not transfected with ANXA1 plasmid (prepared using a dual plasmid vector system (LNP-DP in Example 1)) were added to the culture medium.

[0098] ANXA1 modified vesicle group: After replacing with normal complete culture medium, engineered vesicles prepared in Example 1 (at the same concentration) were added.

[0099] 3. Effectiveness Evaluation:

[0100] Cell viability was detected using the CCK-8 assay. Results ( Figure 4 A, Figure 5 A) shows that cell survival rate in the model group was significantly decreased. Compared with the model group, cell survival rate in the engineered vesicle treatment group was significantly restored.

[0101] Cell damage: Cell membrane damage was assessed by detecting lactate dehydrogenase (LDH) activity in the culture medium. Results ( Figure 4 B. Figure 5 B) shows that, compared with the model group and the vesicle control group, the engineered vesicle treatment group had a significantly lower LDH release, indicating that the treatment can more effectively reduce cell membrane damage.

[0102] Apoptosis: Flow cytometry analysis was performed using Annexin V-FITC / PI double staining. Results ( Figure 4 G, Figure 5 G) showed that the apoptosis rate in both cell model groups was as high as about 20%, while the engineered vesicle treatment group reduced it to about 6%, which was significantly better than the model group and the control vesicle group (about 10%).

[0103] Oxidative stress: Intracellular malondialdehyde (MDA) levels were measured using a lipid oxidation assay kit. Figure 4 E, Figure 5E). Compared with the model group, the engineered vesicle treatment group showed a significant decrease in MDA content, indicating that intracellular lipid peroxidation was inhibited; compared with the vesicle control group, the engineered vesicle treatment group also showed a lower MDA content. Intracellular superoxide dismutase (SOD) activity was detected by the WST-8 assay. Figure 4 F, Figure 5 F). The results showed that the SOD activity in the engineered vesicle treatment group was significantly higher than that in the model group, indicating that this treatment could enhance the antioxidant capacity of cells; compared with the vesicle control group, the increase in SOD activity in the engineered vesicle treatment group was more significant. Intracellular reactive oxygen species (ROS) levels were detected using the fluorescent probe DCFH-DA. Figure 6 The engineered vesicle treatment group showed a significant decrease in ROS levels compared to the model group, indicating a reduction in oxidative stress damage; compared to the vesicle control group, the engineered vesicle treatment group performed better in reducing ROS levels.

[0104] Mitochondrial function:

[0105] ATP levels: Intracellular ATP content was detected using the luciferase assay. Results ( Figure 4 C Figure 5 C) shows that the ATP level of cells decreases by about 50% after injury, and engineered vesicle treatment can restore it to more than 80% of the normal level, with a better recovery effect than the vesicle control group.

[0106] Mitochondrial membrane potential: Detected using the JC-1 fluorescent probe. Flow cytometry analysis ( Figure 4 D、 Figure 5 D) showed that the mitochondrial membrane potential of the model group cells decreased significantly (red / green fluorescence ratio decreased), while the ratio of the engineered vesicle treatment group increased significantly, with the recovery level close to that of the normal control group and better than that of the vesicle control group.

[0107] Mitochondrial functional proteins: Western blot analysis confirmed that the expression levels of mitochondrial generation-related proteins (PGC1α) and mitochondrial respiratory chain complex proteins (UQCRC2, SDHB, NDUFB8) in the engineered vesicle treatment group were significantly higher than those in the model group and also higher than those in the vesicle control group. Figure 7 ).

[0108] In summary, the results of Examples 2 and 3 indicate that the ANXA1-modified functional mitochondrial vesicles secreted by adipocytes after modification with the plasmid vector system of this invention significantly improved cell viability, reduced LDH release, and alleviated apoptosis in hypoxia / reoxygenation and ISO-induced AC16 cardiomyocyte and HUVEC endothelial cell injury models. The apoptosis rate was reduced from approximately 20% to approximately 6%, which was superior to the control vesicles without ANXA1 transfection (approximately 10%). Simultaneously, these vesicles effectively restored mitochondrial function and energy metabolism (ATP levels recovered to over 80% of normal levels after a decrease of approximately 50%), improved mitochondrial membrane potential, and upregulated the expression of PGC-1α and respiratory chain complex-related proteins. Therefore, the plasmid vector system of this invention can transform adipocytes into a "biofactory" continuously secreting targeted mitochondrial vesicles in vivo, demonstrating comprehensive advantages and good therapeutic effects in treating myocardial injury-related diseases, including more precise targeted delivery, more thorough mitochondrial function repair, more significant antioxidant / anti-apoptotic effects, and consideration of endothelial function recovery and angiogenesis potential.

Claims

1. A gene composition, characterized in that, It contains the CD38 gene, shLDHA gene and ANXA1 gene. The NCBI numbers for the CD38 gene and ANXA1 gene are ENSG00000004468 and ENSG00000135046, respectively. The gene sequence of the shLDHA gene is GTTCATCATTCCCAACATTCTCGAGAATGTTGGGAATGATGAAC.

2. The adipocyte-based mitochondrial vesicle based on claim 1, characterized in that, The CD38 gene is used to upregulate CD38 protein expression, which activates the calcium signaling pathway by catalyzing the generation of cyclic adenosine diphosphate ribose (cADPR), inducing mitochondrial calcium overload, thereby promoting mitochondrial packaging and exocytosis into vesicles. The shLDHA gene is used to inhibit the expression of lactate dehydrogenase A (LDHA), reduce intracellular lactate levels, thereby reducing lactation modification of lysine 40 of ARF1 protein, enhancing the binding of ARF1 to the COPI complex, and promoting the transport and exocytosis of mitochondrial vesicles via the Golgi-endosome system. The ANXA1 gene is used to cause the expression of annexin A1 (ANXA1) on the surface of secreted vesicles. ANXA1 mediates the specific binding of vesicles to the surface of vascular endothelial cells and cardiomyocytes in ischemic / injured myocardial tissue, achieving targeted delivery.

3. A plasmid vector system based on the gene composition of claim 1, characterized in that, The plasmid containing three genes was mixed and then added to liposomes to form the liposome.

4. A mitochondrial vesicle based on adipocytes, characterized in that, A gene composition comprising the CD38 gene, the shLDHA gene, and the ANXA1 gene is delivered or transferred into adipocytes; the adipocytes, after expressing the genes, continuously secrete vesicles that express ANXA1 on their surface and contain functional mitochondria internally.

5. The adipocyte-based mitochondrial vesicle based on claim 4, characterized in that, The gene composition is delivered or introduced via liposome nanoparticles, adeno-associated virus vectors, lentiviral vectors, or adenovirus vectors.

6. The adipocyte-based mitochondrial vesicles according to claim 4, characterized in that, The adipocytes are brown adipocytes, white adipocytes, or preadipocytes in the body.

7. The adipocyte-based mitochondrial vesicles according to claim 4, characterized in that, The vesicles preferably have a particle size range of 100 nm to 1000 nm, their membrane structure is derived from adipocytes, and they carry one or more complete or substructured functional mitochondria.

8. The use of the gene composition of claim 1, the plasmid vector system of claim 3, or the adipocyte-based mitochondrial vesicles of claim 4 in the preparation of a drug for targeted repair of myocardial injury.

9. The application according to claim 8, characterized in that, The aforementioned myocardial injury diseases include myocardial infarction, myocardial ischemia-reperfusion injury, anthracycline-induced cardiomyopathy, chronic heart failure, and associated myocardial fibrosis.

10. The application according to claim 8, characterized in that, The adipocyte-based mitochondrial vesicles deliver functional mitochondria that are internalized by cardiomyocytes and vascular endothelial cells in the damaged area, thereby promoting angiogenesis in ischemic myocardial tissue by improving endothelial cell energy metabolism and function.