Kit product for detecting SNP (Single Nucleotide Polymorphism) capacity of human for absorbing micro ribonucleic acid

The SNP site detection method is simplified to DNA extraction and high-resolution melting curve PCR reaction, which solves the problem of time-consuming and labor-intensive detection in existing technologies. It realizes low-cost and simple operation of small ribonucleic acid detection and improves detection efficiency.

CN122060871APending Publication Date: 2026-05-19NANJING UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NANJING UNIV
Filing Date
2026-03-20
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Existing methods for detecting the human ability to absorb microRNAs are time-consuming, labor-intensive, technically complex, and require highly skilled personnel, making it difficult to achieve rapid and low-cost detection.

Method used

The SNP site (SNP1 and SNP2) detection method was adopted. By designing specific primer pairs, a high-resolution melting curve PCR reaction was performed, which was simplified to two steps: DNA extraction and high-resolution melting curve PCR reaction. The absorption capacity was determined by the correspondence between melting curve peak shape and genotype.

Benefits of technology

It achieves a low-cost, simple-to-operate detection process, high DNA sample stability, and improved detection efficiency, which can help with drug delivery strategies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122060871A_ABST
    Figure CN122060871A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biomedical detection, and discloses a kit product for detecting SNP (Single Nucleotide Polymorphism) of human micro ribonucleic acid absorption capacity, which comprises one or more of an SNP1 site and an SNP2 site. The method has the advantages that the operation process is simple, and the capacity of the main body of the detected sample for absorbing the micro ribonucleic acid can be determined according to the condition of the SNP site only through the two steps of DNA extraction and high-resolution melting curve method PCR reaction; the detection sample is more stable and easier to store; the method can provide help for drug effect identification of drugs containing micro ribonucleic acid and determination of clinical medication of the drugs, can improve the detection efficiency, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical detection technology, and more specifically to a kit product for detecting SNPs (microRNAs) that enable humans to absorb microRNAs. Background Technology

[0002] Plant-derived microRNAs have been found in tissue samples from animals, including humans, and increasing research indicates that exogenous microRNAs from food sources regulate gene expression in ingesting animals, affecting physiological functions and pathological processes. Measuring the ability to absorb microRNAs helps to adjust drug delivery strategies based on the absorption capacity of different populations, thereby facilitating drug development. However, determining the ability of animals, including humans, to absorb microRNAs is currently very difficult. The current accurate technique for measuring the ability of humans to absorb exogenous microRNAs typically involves calculating the absorption rate by measuring the microRNA content in the blood before and after eating. The measurement procedure is as follows: (1) Venous blood was collected from the subjects before eating, plasma was separated and stored at -80 degrees Celsius; (2) The subjects consumed several foods containing known concentrations of specific plant microRNAs; (3) Venous blood was collected from the subjects after eating, plasma was separated and stored at -80 degrees Celsius; (4) Extract RNA from plasma, reverse transcribe plant microRNA, and perform quantitative PCR detection; (5) Calculate the content of plant microRNA based on the standard curve, and then calculate the absorption rate to determine the human ability to absorb exogenous microRNA.

[0003] The methods described above are time-consuming, labor-intensive, and technically complex, requiring three experiments: RNA extraction, reverse transcription, and quantitative PCR. Furthermore, these assays demand higher technical skills from the personnel involved. Therefore, there is an urgent need to develop a new technology to determine the human capacity to absorb microRNAs. Summary of the Invention

[0004] To address the above issues, this invention provides a kit for detecting SNPs that enable humans to absorb microRNAs. This method is low-cost, simpler, and easier to operate.

[0005] To solve the above technical problems, the present invention provides the following technical solutions: A kit product for detecting SNPs in the human ability to absorb microRNA, wherein the SNP sites include one or more of SNP1 and SNP2, wherein the SNP1 site is located at position 113285276 on human chromosome 3 and the SNP2 site is located at position 113320477 on human chromosome 3.

[0006] Furthermore, the SNP1 site is mutated from G to A, and the SNP2 site is mutated from C to T.

[0007] Furthermore, the kit includes one or more pairs of primer pairs, namely primer pair one for amplifying SNP1 and primer pair two for amplifying SNP2, wherein the forward primer sequence of primer pair one is shown in SEQ ID NO. 1 and the reverse primer sequence is shown in SEQ ID NO. 2; and the forward primer sequence of primer pair two is shown in SEQ ID NO. 3 and the reverse primer sequence is shown in SEQ ID NO. 4.

[0008] Furthermore, the method for detecting the ability of humans to absorb microRNA using the aforementioned kit is as follows: S1: Obtain standard biological samples, extract DNA, and determine the genotype using sequencing; S2: Perform high-resolution melting curve PCR using the DNA sample obtained in step S1, record the melting curve peak shape of the corresponding SNP site, and establish the correspondence between melting curve peak shape and genotype; the primers used in the high-resolution melting curve PCR reaction are primer pair one, primer pair two, or a combination of both. S3: Obtain the biological sample to be tested, extract DNA, and perform a high-resolution melting curve PCR reaction. The high-resolution melting curve PCR reaction process is the same as the reaction process in step S2. Then, the genotype of the biological sample to be tested is determined by the melting curve peak type-genotype correspondence established in step S2, and the ability of the biological sample to absorb microRNA is determined.

[0009] Furthermore, the high-resolution melting curve PCR reaction system in step S2 is as follows:

[0010] The detection limit of the kit is 2 pg / µL, meaning that the final concentration X3 of the DNA template in the high-resolution melting curve PCR reaction system is not less than 2 pg / µL, and the values ​​of X1 and X2 vary with the change of X3.

[0011] Furthermore, the high-resolution melting curve PCR reaction procedure in step S2 is as follows:

[0012] Furthermore, the temperature corresponding to the peak value of the melting peak at the SNP1 site is 77.6℃, and the temperature corresponding to the peak value of the melting peak at the SNP2 site is 77.7℃.

[0013] Furthermore, when the high-resolution melting peak value is between 77.6℃ and 77.7℃, it can be determined that the biological sample to be tested carries SNP1 or SNP2, and the biological sample to be tested has a weak ability to absorb microRNAs.

[0014] Furthermore, the DNA extraction method in step S1 is magnetic bead extraction, and the genotype determination method is Sanger sequencing.

[0015] Furthermore, the final concentration X3 of the DNA template in the high-resolution melting curve PCR reaction system in step S2 is 40 ng / µl.

[0016] Compared with the prior art, the beneficial effects of the present invention are: the operation process of the present invention is simple, requiring only two steps: DNA extraction and high-resolution melting curve PCR reaction, which can determine the ability of the main body of the tested sample to absorb microRNA based on the SNP site. The detection target of this invention is DNA samples. Compared with RNA samples in the prior art, the DNA samples of this invention are not easily degraded, are more stable, and are easier to preserve. Compared with the prior art, the detection cost of this invention is lower. This invention can help identify the efficacy of drugs containing microRNA and determine their clinical use, improve detection efficiency, and has broad application prospects. Attached Figure Description

[0017] Figure 1 This is a diagram showing the peak shape-genotype correspondence of the melting curve of the SNP1 locus in Example 1 of the present invention; Figure 2 This is a diagram showing the peak shape-genotype correspondence of the melting curve of the SNP2 locus in Example 1 of the present invention; Figure 3 This is a graph showing the absorption of MIR2911 by SNP1 carriers in Example 3 of the present invention. Figure 4 This is a graph showing the results of nucleic acid uptake by cells transfected with wild-type and mutant plasmids in Example 4 of the present invention. Detailed Implementation

[0018] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments and accompanying drawings. The illustrative embodiments and descriptions of the present invention are only used to explain the present invention and are not intended to limit the present invention.

[0019] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0020] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0021] Example 1: This embodiment identifies the SIDT1 protein, which is responsible for absorbing exogenous microRNAs, and detects the human ability to absorb exogenous microRNAs by measuring the SNP sites that affect protein function or expression.

[0022] This embodiment ultimately identified two SNP loci: SNP1 and SNP2. SNP1 is located at position 113285276 on human chromosome 3, where the mutation changes from G to A. SNP2 is located at position 113320477 on human chromosome 3, where the mutation changes from C to T.

[0023] This embodiment designs primer pair one for amplifying the SNP1 site and primer pair two for amplifying the SNP2 site. The sequence of primer pair one is as follows: Forward primer: GGTTTGCATGTGTGCATGTGC (see SEQ ID NO. 1 in the sequence listing) Reverse primer: TTTCTGCTGGCGAACCACAAC (see SEQ ID NO. 2 in the sequence listing) The sequence of primer pair two is as follows: Forward primer: GGCTCTGGAAATATGGTGGCA (see SEQ ID NO. 3 in the sequence listing) Reverse primer: ACAGACCTGGTAGGACATACC (see SEQ ID NO. 4 in the sequence listing) In this embodiment, plasma from different populations was collected, and DNA was extracted by Beijing Qingke Biotechnology Co., Ltd. using the magnetic bead method, and then the genotype was determined by Sanger sequencing.

[0024] Next, the obtained DNA samples were subjected to high-resolution melting curve PCR reaction, and the melting curve peak shape of the corresponding specific SNP was recorded to establish the correspondence between melting curve peak shape and genotype.

[0025] The high-resolution melting curve PCR reaction procedure is as follows: establish the HRM PCR reaction system, use the HRMAnalysis Kit (EvaGreen, TIANGEN) as the reagent kit, and use the fully automated medical PCR analysis system (Xi'an Tianlong Technology Co., Ltd.).

[0026] The high-resolution melting curve PCR reaction system is as follows:

[0027] The high-resolution melting curve PCR reaction procedure (two-step reaction procedure) is as follows:

[0028] See attached Figure 1 and attached Figure 2 The results show that the temperature corresponding to the melting peak of SNP1 is 77.6℃, which is 0.6℃ lower than the temperature corresponding to the melting peak of wild type. The temperature corresponding to the melting peak of SNP2 is 77.7℃, which is 0.5℃ lower than the temperature corresponding to the melting peak of wild type.

[0029] Next, plasma from individuals with unknown genotypes was obtained, DNA was extracted, and high-resolution melting curve PCR was performed (the reaction process was the same as described above). Then, the genotype of the biological sample to be tested (whether it contains SNP1 and SNP2 sites) was determined by the melting curve peak type-genotype correspondence established in the previous steps, thereby determining the ability of the biological sample to be tested to absorb microRNA.

[0030] When the high-resolution melting peak value is between 77.6℃ and 77.7℃, it can be determined that the biological sample to be tested carries SNP1 or SNP2, and the biological sample to be tested has a weak ability to absorb microRNA.

[0031] Example 2: In this embodiment, a sensitivity verification experiment was conducted to determine the minimum template amount (i.e., the detection limit) for the target DNA detected by the high-resolution melting curve PCR method in Example 1. As shown in Table 1, the same DNA sample was serially diluted to obtain five concentration gradients: 2000 pg / µL, 200 pg / µL, 20 pg / µL, 2 pg / µL, and 0.2 pg / µL.

[0032] Table 1 Sensitivity Verification Experiment

[0033] All the above concentrations were amplified using the same high-resolution melting curve PCR reaction system and procedure as in Example 1, and the CT values ​​corresponding to each concentration were recorded. Positive / negative results were determined based on the presence or absence of a specific amplification curve. See Table 1. The data in the table show that the sample could still be detected when the template concentration was as low as 2 pg / µL (CT≈34.264, positive), but could not be detected when the concentration was reduced to 0.2 pg / µL (CT value "—", negative). This indicates that under the experimental conditions, the lower limit of sensitivity of this detection method is approximately 2 pg / µL.

[0034] In subsequent actual sample testing, in order to ensure the stability of amplification and the reliability of detection, the inventors chose 40 ng / µL (i.e., the template concentration in Example 1) as the template addition concentration in the reaction system. This concentration is much higher than the detection limit (2 pg / µL) verified above, thereby ensuring the stability of amplification and the reliability of detection.

[0035] Example 3: This embodiment included 10 subjects, divided into two groups: the control group consisted of 5 wild-type individuals (who did not carry the SNP1 gene) and the experimental group consisted of 5 SNP1 gene carriers.

[0036] First, a decoction of honeysuckle (the active ingredient of honeysuckle is plant-derived microribonucleic acid (MIR2911)) was prepared: 30g of honeysuckle was added to 600ml of water, boiled for 1 hour, and then concentrated to 200ml. Baseline blood samples were collected from all subjects before taking the decoction, and venous blood samples were collected at 0.5, 1, 3, and 6 hours after administration. Serum total RNA was extracted using the TRIZOL method, and the expression level of MIR2911 was detected using the TaqMan miRNA probe method on a Roche LC96 quantitative PCR instrument.

[0037] The results are attached. Figure 3 As shown, the blue line and blue bars represent the control group, and the red line and red bars represent the experimental group. It can be seen that the plasma MIR2911 levels in both groups gradually increased within 0-3 hours after taking the honeysuckle decoction, reaching a peak at 3 hours, and then gradually decreased between 3-6 hours.

[0038] The key difference lies in the fact that, at each corresponding time point, the MIR2911 level in the plasma of the control group was significantly higher than that of the experimental group. Based on these results, it can be concluded that the SNP1 genotype affects the human body's absorption of MIR2911. Furthermore, it is expected that SNP2 gene carriers will also exhibit similar absorption characteristics to SNP1 carriers, namely, that the plasma MIR2911 level after taking honeysuckle decoction is significantly lower than that of the wild-type control group.

[0039] Example 4: This study used the SIDT1 gene knockout (sidt1-KO) 293T cell line as the research object. This cell line was transfected with wild-type (WT), SNP1 mutant, and SNP2 mutant recombinant plasmids, respectively. Forty-eight hours after plasmid expression, the cell culture medium was replaced with acidic medium (pH 3.5), and MIR156 and MIR168 were added to the medium at final concentrations of 40 pmol / µL and 40 pmol / µL, respectively. Finally, cells were collected, and the relative expression levels of MIR156 and MIR168 in each group were quantitatively detected using RT-qPCR.

[0040] The results are attached. Figure 4 RT-qPCR results showed that, compared with the control group cells transfected with wild-type plasmids, the intracellular MIR156 and MIR168 contents of cells transfected with SNP1 mutant and SNP2 mutant plasmids were significantly decreased (p<0.0001), indicating that the cells transfected with mutant plasmids had reduced ability to absorb microRNAs.

[0041] The above are embodiments of the present invention. The above embodiments and specific parameters are only for clearly illustrating the invention verification process and are not intended to limit the scope of protection of the present invention. The scope of protection of the present invention shall still be determined by its claims. Similarly, any equivalent structural changes made based on the description and drawings of the present invention shall also be included within the scope of protection of the present invention.

Claims

1. A kit product for detecting SNPs (specimens) that enable humans to absorb microRNAs, characterized in that, The SNP loci include one or more of SNP1 and SNP2, with SNP1 located at position 113285276 on human chromosome 3 and SNP2 located at position 113320477 on human chromosome 3.

2. The reagent kit product according to claim 1, characterized in that, The SNP1 site was mutated from G to A, and the SNP2 site was mutated from C to T.

3. The reagent kit product according to claim 1, characterized in that, The kit includes one or more primer pairs, namely primer pair one for amplifying SNP1 and primer pair two for amplifying SNP2. The forward primer sequence of primer pair one is shown in SEQ ID NO. 1 and the reverse primer sequence is shown in SEQ ID NO.

2. The forward primer sequence of primer pair two is shown in SEQ ID NO. 3 and the reverse primer sequence is shown in SEQ ID NO.

4.

4. The reagent kit product according to claim 3, characterized in that, The method for detecting the ability of humans to absorb microRNA using the aforementioned kit is as follows: S1: Obtain standard biological samples, extract DNA, and determine the genotype using sequencing; S2: Perform high-resolution melting curve PCR using the DNA sample obtained in step S1, record the melting curve peak shape of the corresponding SNP site, and establish the correspondence between melting curve peak shape and genotype; the primers used in the high-resolution melting curve PCR reaction are primer pair one, primer pair two, or a combination of both. S3: Obtain the biological sample to be tested, extract DNA, and perform a high-resolution melting curve PCR reaction. The high-resolution melting curve PCR reaction process is the same as the reaction process in step S2. Then, the genotype of the biological sample to be tested is determined by the melting curve peak type-genotype correspondence established in step S2, and the ability of the biological sample to absorb microRNA is determined.

5. The reagent kit product according to claim 4, characterized in that, The high-resolution melting curve PCR reaction system in step S2 is as follows: The detection limit of the kit is 2 pg / µL, meaning that the final concentration X3 of the DNA template in the high-resolution melting curve PCR reaction system is not less than 2 pg / µL.

6. The reagent kit product according to claim 5, characterized in that, The high-resolution melting curve PCR reaction procedure in step S2 is as follows: 。 7. The reagent kit product according to any one of claims 4-6, characterized in that, The temperature corresponding to the peak value of the melting peak at the SNP1 site is 77.6℃, and the temperature corresponding to the peak value of the melting peak at the SNP2 site is 77.7℃.

8. The reagent kit product according to any one of claims 4-6, characterized in that, When the high-resolution melting peak value is between 77.6℃ and 77.7℃, it can be determined that the biological sample to be tested carries SNP1 or SNP2, and the biological sample to be tested has a weak ability to absorb microRNAs.

9. The reagent kit product according to claim 4, characterized in that, The DNA extraction method in step S1 is magnetic bead extraction, and the genotype determination method is Sanger sequencing.

10. The reagent kit product according to claim 5, characterized in that, The final concentration X3 of the DNA template in the high-resolution melting curve PCR reaction system in step S2 is 40 ng / µl.