SNP (Single Nucleotide Polymorphism) molecular marker located on chromosome 11 and related to abnormal content of creatinine in porcine serum and application of SNP molecular marker

Abstract

The invention belongs to the technical field of molecular biotechnology and molecular markers, and particularly relates to an SNP molecular marker located on a chromosome 11 and related to abnormal content of creatinine in porcine serum and application of the SNP molecular marker. An SNP site of the SNP molecular marker corresponds to G / A mutation at the 68587544 bp position on a chromosome 11 of an international pig reference genome version 11.1, and the polymorphism of a base of the site affects the abnormal occurrence rate of the content of creatinine in Wuzhishan pig serum. By optimizing the dominant alleles of the variation sites, the frequency of the dominant alleles can be increased generation by generation, and the abnormal occurrence rate of the serum creatinine content of the Wuzhishan pigs is reduced. According to the method, the problem of genetic improvement of abnormal CREA content of the Wuzhishan pigs is solved by means of molecular breeding, the commercial and scientific research values of the Wuzhishan pigs are improved, and the genetic improvement progress of the Wuzhishan pigs is accelerated, so that the economic benefit of breeding pig breeding is effectively improved.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to a SNP molecular marker located on chromosome 11 that is associated with abnormal serum creatinine levels in pigs and its application. Background Technology

[0002] Creatinine (CREA) is a core end product of protein and muscle metabolism in pigs. Its serum concentration is stable and it is a key serum biochemical indicator for assessing glomerular filtration function and muscle metabolic efficiency.

[0003] Wuzhishan pig is one of my country's famous small pig resources, commonly known as "rat pig" or "five-legged pig." As a rare local pig breed, it has excellent characteristics such as delicious meat and strong resistance to disease. In addition, Wuzhishan pig has the advantages of small size, light weight, docile temperament, uniform phenotype, and genetic stability, making it an ideal experimental animal model with important application prospects in biomedical research.

[0004] However, the genetic regulatory basis and metabolic mechanism related to CREA content have not been systematically elucidated. In healthy pig farming and genetic improvement, abnormal CREA levels (significantly elevated or decreased) may indicate kidney damage, protein metabolism disorders, or abnormal muscle mass, directly affecting the pig's ability to excrete metabolic waste, nutritional balance, and long-term health status.

[0005] Therefore, genetic analysis and selection of the ideal CREA content phenotype (such as being within a suitable and stable range) is of great theoretical and practical significance for breeding a new Wuzhishan pig breed with sound kidney function, high metabolic efficiency and excellent overall physiological condition.

[0006] Currently, traditional breeding methods rely on phenotypic testing to screen individuals for target traits, which suffers from problems such as long cycles, low efficiency, and accuracy being greatly affected by the environment. Molecular marker-assisted breeding technology, by screening genetic markers closely associated with target traits, can achieve early, rapid, and precise selection, significantly accelerating the breeding process. Genome-wide association study (GWAS) refers to screening genetic markers that are significantly associated with the target trait across the entire genome. GWAS has been widely used in the genetic improvement of important traits in livestock and poultry. However, no SNP molecular markers related to CREA content in Wuzhishan pigs have been reported, and the lack of molecular tools that can be directly applied to breeding practices limits the efficiency of genetic improvement of CREA content in Wuzhishan pigs.

[0007] Therefore, identifying SNP molecular markers that are significantly associated with CREA content in Wuzhishan pigs and developing corresponding detection technologies and breeding methods are of great theoretical and practical value for promoting the improvement of Wuzhishan pig breeds and enhancing the economic benefits of pig farming. Summary of the Invention

[0008] To overcome the shortcomings and defects of the prior art, the primary objective of this invention is to provide a SNP molecular marker located on chromosome 11 that is associated with abnormal serum creatinine levels in pigs.

[0009] Another object of the present invention is to provide applications of the above-mentioned SNP molecular markers.

[0010] Another object of the present invention is to provide an application of a product for detecting the above-mentioned SNP molecular markers.

[0011] The fourth objective of this invention is to provide a method for detecting the high or low incidence of abnormal serum creatinine levels in pigs.

[0012] The fifth objective of this invention is to provide a method for screening pigs with a low incidence of abnormal serum creatinine levels.

[0013] The sixth objective of this invention is to provide a method for genetic improvement of pigs.

[0014] The objective of this invention is achieved through the following technical solution: A molecular marker for a single nucleotide polymorphism (SNP) located on chromosome 11 that is associated with abnormal serum creatinine levels in pigs has been identified. The SNP site corresponds to the G / A mutation at position 68,587,544 bp on chromosome 11 in the International Pig Reference Genome 11.1. The polymorphism of this site affects the incidence of abnormal serum creatinine levels in pigs. The incidence of abnormal serum creatinine levels is higher in pigs with the GA genotype than in pigs with the AA genotype.

[0015] The preferred type of pig is the Wuzhishan pig.

[0016] The preferred nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, where M in the sequence is G or A. This molecular marker affects the incidence of abnormal serum creatinine levels in pigs.

[0017] The SNP site of the SNP molecular marker is the G121-A121 single base mutation at position 121 of the sequence marked in SEQ ID NO.1, named g.121 G / A (corresponding to position 68587544 bp on chromosome 11 of the International Pig Reference Genome 11.1).

[0018] The preferred type of pig is the Wuzhishan pig.

[0019] The application of the molecular markers includes at least one of the following (1)-(5): (1) Identify traits associated with abnormal serum creatinine levels in pigs; (2) Prepare products for identifying abnormal traits related to serum creatinine levels in pigs; (3) Screen pigs with a low incidence of abnormal serum creatinine levels; (4) Prepare products from pigs with low incidence of abnormal serum creatinine levels; (5) Genetic breeding of abnormal serum creatinine levels in pigs.

[0020] The application of a product for detecting SNP molecular markers located on chromosome 11 that are associated with abnormal serum creatinine levels in pigs, said application comprising at least one of the following (1)-(5): (1) Identify traits associated with abnormal serum creatinine levels in pigs; (2) Prepare products for identifying traits related to abnormal serum creatinine levels in pigs; (3) Screen pigs with a low incidence of abnormal serum creatinine levels; (4) Prepare products from pigs with low incidence of abnormal serum creatinine levels; (5) Application in genetic breeding of traits related to abnormal serum creatinine content in pigs.

[0021] The products include reagents, reagent kits, chips, and testing equipment.

[0022] The reagent comprises primer pairs or probes, wherein the primer pairs are used to amplify nucleic acid fragments containing the above-mentioned SNP sites, and the probes are capable of specifically recognizing and binding to the nucleic acid sequences of the above-mentioned SNP sites; probes carrying different labeling groups (e.g., fluorescent groups) can be designed to correspond to different genotypes of the above-mentioned SNP sites, thereby achieving genotyping detection.

[0023] The primer pair preferably comprises primers primer-F and primer-R, and their nucleic acid sequences are as follows: Upstream primer-F: 5'-TGTCCTCAGATTTCCAGGAGC-3'; Downstream primer primer-R: 5'-TGGCCAAAGTCTTGAATGAAAAAG-3'.

[0024] The kit contains the aforementioned primer pairs or probes; more preferably, it also contains reaction buffer, etc.

[0025] The chip uses a solid-phase carrier to fix the primer pairs or probes to achieve high-throughput detection.

[0026] The aforementioned detection equipment is compatible with the detection process of the above-mentioned reagents, kits, and chips, and completes signal acquisition, genotype interpretation, and result output.

[0027] The preferred type of pig is the Wuzhishan pig.

[0028] A method for detecting a high or low incidence of abnormal serum creatinine levels in pigs includes the following steps: The SNP sites of the aforementioned SNP molecular markers on pig chromosome 11 were detected, and the incidence of abnormal serum creatinine levels in pigs was determined to be high or low based on whether the single nucleotide of the SNP site was G or A; among them, the incidence of abnormal serum creatinine levels in pigs with the GA genotype was higher than that in pigs with the AA genotype.

[0029] The preferred type of pig is the Wuzhishan pig.

[0030] A method for screening pigs with a low incidence of abnormal serum creatinine levels includes the following steps: The SNP sites of the aforementioned SNP molecular markers on pig chromosome 11 were detected. Individuals with the AA genotype were selected as breeding pigs, while individuals with the GA genotype were culled. Among them, the incidence of abnormal serum creatinine levels in GA genotype pigs was higher than that in AA genotype pigs.

[0031] The preferred type of pig is the Wuzhishan pig.

[0032] The detection method includes the following steps: (1) Extract genomic DNA from the pigs to be tested; (2) Using the above primer pair as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification was performed to obtain PCR amplification products; (3) Sequencing the PCR amplification products to obtain sequencing results; (4) Determine the genotype based on the sequencing results.

[0033] A method for genetic improvement of pigs, comprising the following steps: The above-mentioned SNP molecular markers of breeding pigs in the core breeding pig herd were identified, and corresponding selections were made based on the molecular markers: the AA genotype individuals at chromosome 68587544 bp on chromosome 11 of the International Swine Reference Genome 11.1 were selected for successive generations, and GA genotype individuals were eliminated, so as to increase the frequency of allele A at this locus in each generation, thereby reducing the incidence of abnormal serum creatinine levels in pigs.

[0034] The preferred type of pig is the Wuzhishan pig.

[0035] The above applications or methods are for purposes other than disease treatment or diagnosis.

[0036] The present invention has the following advantages and effects compared with the prior art: (1) Based on genome-wide association analysis and genotype filling strategy, this invention studies and identifies the SNP molecular marker associated with abnormal CREA content in Wuzhishan pigs located at 68,587,544 bp on chromosome 11 of the International Pig Reference Genome Version 11.1, which is a G / A mutation. The polymorphism of this mutation site is significantly associated with the incidence of abnormal CREA content in Wuzhishan pigs.

[0037] (2) Based on the above molecular markers, the present invention provides a method for identifying products (primer pairs, kits, etc.) of the above molecular markers and for genetic improvement of Wuzhishan pigs. It establishes an efficient and accurate molecular marker-assisted breeding technology and applies it to the genetic improvement of abnormal CREA content in Wuzhishan pigs, thereby reducing the incidence of abnormal CREA content in Wuzhishan pigs, increasing enterprise profits and scientific research value, and increasing core competitiveness.

[0038] (3) This invention uses molecular breeding to solve the problem of genetic improvement of abnormal CREA content in Wuzhishan pigs. By selecting the superior alleles of the above-mentioned mutations, the frequency of superior alleles can be increased generation by generation, the incidence of abnormal CREA content in Wuzhishan pigs can be reduced, and the genetic improvement of Wuzhishan pigs can be accelerated, thereby effectively improving the economic benefits of breeding pigs. Attached Figure Description

[0039] Figure 1 This is a genome-wide association study (GWAS) diagram of abnormal CREA content on chromosome 11 in Wuzhishan pigs; where: the horizontal axis represents the chromosome number of Wuzhishan pigs; the vertical axis represents -log 10 ( P -value).

[0040] Figure 2 This is a graph showing the incidence of abnormal serum CREA levels in different genotypes of Wuzhishan pigs (all individuals in the experimental pig herd).

[0041] Figure 3 This is a box plot showing the distribution of serum CREA content in different genotypes of Wuzhishan pigs. The box plot shows the median, interquartile range and range, the scatter plot represents individual values, and the two horizontal dashed lines represent the lower limit (50.00 μmol / L) and upper limit (156.58 μmol / L) of the normal reference range, respectively. Detailed Implementation

[0042] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0043] Example 1 explains in detail the process of obtaining the reference range of normal serum creatinine (CREA) content in this invention. 1. Laboratory animals (1) Experimental pig herd: A total of 161 Wuzhishan pigs were used in this embodiment, including 33 pigs at 1 month old (post-weaning), 47 pigs at 3 months old (pre-sexual maturity), 37 pigs at 5 months old (post-sexual maturity), and 44 pigs at 12 months old (post-physical maturity). The experimental pig herd used in this embodiment was the core breeding pig herd of a certain Wuzhishan pig farm, and the herd pedigree records were detailed. In order to ensure the reliability and consistency of the experimental data, the healthy Wuzhishan pigs selected in this embodiment all met the following criteria: glossy skin, normal appetite, free movement and no respiratory abnormalities, and no obvious signs of disease.

[0044] (2) Sampling: All 3, 5, and 12-month-old sows were not pregnant at the time of sampling to rule out the potential influence of pregnancy on hematological and biochemical indicators. Before sampling, all pigs were fasted for 12 hours (with free access to water) to standardize their metabolic state; blood samples were collected between 7:00 and 10:00 AM to eliminate diurnal variations. No sedatives were used during sampling; gentle restraint was performed by trained personnel to minimize stress-induced physiological changes. During the experiment, the pigs were managed using conventional feeding and watering methods, with free access to feed and water, and feeding conditions were consistent with the environment.

[0045] (3) Determination of serum creatinine (CREA) levels ① Let all blood samples from pigs collected in step (2) stand at room temperature for 2 hours, and then centrifuge at 3000 rpm for 10 minutes at 4℃ to separate serum.

[0046] ②Using a fully automated biochemical analyzer (Hitachi 3110 model) and a creatinine assay kit (sarcosine oxidase method) (Shanghai Kehua, catalog number K131), strictly follow the instrument and kit instructions to determine the serum CREA content (μmol / L).

[0047] 2. Determination of the normal reference range for CREA content To ensure data accuracy, samples with coagulation and hemolysis were excluded. Serum samples from 161 Wuzhishan pigs were ultimately tested. After outlier removal, 139 valid samples remained. Data recording was performed using Microsoft Excel, and all statistical analyses were completed using SPSS 27.0 for Windows, as detailed below: ① The Shapiro-Wilk test was used to assess the normality of the distribution, and the identification of outliers was combined with the Dixon test (α=0.05) and box plots (outside 1.5 interquartile range).

[0048] ② For normally distributed traits, the results are expressed as “mean ± standard deviation (SD)”, and the reference range (RI) is calculated as mean ± 2 SD; for non-normally distributed traits, the reference range is estimated using the 2.5th and 97.5th percentiles, and the results are expressed as “median (interquartile range, IQR)”.

[0049] ③ The reliability of the reference range was evaluated by calculating a 95% confidence interval using the Bootstrap method (1000 resampling).

[0050] The Shapiro-Wilk test showed that the serum CREA levels of all individuals in the Wuzhishan pig population exhibited a non-normal distribution. Table 1 shows the reference range for serum CREA levels in Wuzhishan pigs, indicating that the normal serum CREA levels ranged from 50.00 to 156.58 μmol / L.

[0051] Table 1. Reference range of normal serum creatinine (CREA) levels in Wuzhishan pigs.

[0052] Note: n is the sample size used to determine the reference range after excluding outliers.

[0053] Example 2 explains in detail the process of determining abnormal serum CREA levels in this invention. 1. Laboratory animals Experimental pig herd: This example is based on 152 Wuzhishan pig individuals with both phenotypic and genotypic data, including 30 1-month-old pigs, 47 3-month-old pigs, 35 5-month-old pigs, and 40 12-month-old pigs.

[0054] The experimental pig herd used in this embodiment was the core breeding pig herd from a pig farm in Wuzhishan, with detailed pedigree records. The pigs had free access to feed and water, and the feeding method and rearing conditions remained consistent throughout, following conventional practices.

[0055] 2. Detection of serum CREA levels and determination of abnormal serum CREA levels The serum CREA content of Wuzhishan pigs was detected and recorded according to Example 1. The serum CREA content was considered normal if it was between 50.00 and 156.58 μmol / L, and abnormal if it was below that range.

[0056] 3. Sample Collection The collected pig ear-like tissue from Wuzhishan was soaked in a 75% ethanol solution and stored at -20°C for later use.

[0057] Example 3 provides a detailed explanation of the invention process of the gene marker in this invention. 1. Extraction of DNA from ear tissue of experimental pig herds Genome DNA was extracted from ear tissue samples of the experimental pig population in Example 2 using the standard phenol-chloroform method. The DNA from this population was analyzed for quality and concentration using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8-2.0 and an A260 / 230 ratio of 1.7-1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 ng / μL.

[0058] 2. Detection of 50K SNP genotypes in the whole pig genome ① DNA samples were genotyped using a GeneSeek Porcine 50K SNP chip (Neogen, Lincoln, NE, United States) following standard procedures.

[0059] ② Use Plink v1.9 software to perform quality control (QC) on the genotype data obtained in step ①, with the following standards: remove individuals with a detection rate <90%, remove SNPs with a minor allele frequency (MAF) <0.05, and remove individuals that have passed the Hardy-Weinberg equilibrium (HWE) test. P Value <10 -6 SNPs were identified and removed from regions not located on the chip and from sex chromosomes.

[0060] 3. Filling in missing genotypes in pigs Using public data (https: / / doi.org / 10.1038 / s41467-023-40434-3) as the imputation reference population, the 50K microarray genotype data was imputed using Beagle v5.4 software, and variants with MAF < 0.05 and model-based imputation accuracy (DR²) < 0.75 were removed.

[0061] 4. Genome-wide association study (GWAS) Genome-wide association analysis (GWAS) based on quantitative traits was employed. This involved detecting differences in allele and genotype frequencies between normal and abnormal individuals at each variant locus across the entire genome, thereby identifying loci in linkage disequilibrium that control the target trait. In this embodiment, GEMMA v0.98 software, jointly developed by Xiang Zhou of the University of Michigan and Matthew Stephens of the University of Chicago, was used for GWAS analysis of Wuzhishan pigs. Individuals with serum CREA levels within the normal range were considered normal; those with levels exceeding the normal range were considered abnormal. In this embodiment, the serum CREA levels of 23 Wuzhishan pigs used for subsequent analysis were abnormal, while those of 129 Wuzhishan pigs were within the normal range. The specific analysis method is as follows: ① The linear mixture model used is: y = Wα + Xβ + u + ε u ~MVN n (0, λτ -1 K); ε~MVN n (0, λτ -1 I n )

[0062] in, n =152 represents the number of individuals; y for n The phenotypic value vector of ×1 represents the individual's serum CREA content (measured value). W for n × c ( c Design a covariate (fixed effects) matrix for the number of covariates, including the first three eigenvectors obtained from principal component analysis (calculated using GCTA v1.92.4beta), sex, and age in months; α for c A fixed effects coefficient vector of ×1; X for n ×1 SNP genotype vector; β The effect value corresponding to the label; u for n A random effects vector of ×1; ε for n A random error vector of ×1; λ This represents the ratio between two variance components; τ -1 The variance represents the residuals; K To estimate using GEMMA software n ×n Inter-individual genomic kinship matrix; I n for n × n identity matrix; MVN This represents a multivariate normal distribution.

[0063] ②Given the assumption that the number of independent haplotype frames is substantially the same in pigs and humans, and considering that the genomic significance threshold for human-related GWAS analyses is set at 5.00 × 10⁻⁶, -8 This invention references the human genome significance threshold, which is 5.00 × 10⁻⁶. -8 The significance threshold at the chromosome level is 1.00 × 10⁻⁶. -6 .

[0064] GWAS analysis results are as follows Figure 1 As shown. From Figure 1 It was found that in the experimental pig population, there were SNP sites on chromosome 11 that significantly affected the incidence of abnormal CREA levels in the serum of Wuzhishan pigs. The most strongly associated SNP was g.121 G / A (the G / A mutation at position 121 in SEQ ID NO.1, corresponding to the G / A mutation at position 68587544 bp on chromosome 11 in International Swine Reference Genome Version 11.1). P =1.875248×10 -8 ).

[0065] 5. Association analysis between different genotypes and the phenotype of abnormal CREA content in Wuzhishan pig serum. Table 2 shows that the SNP site g.121 G / A of the molecular marker is significantly correlated with the incidence of abnormal serum CREA levels. P =1.875248×10 -8 This indicates that this molecular marker is significantly associated with abnormal serum CREA levels in Wuzhishan pigs. By using assisted selection at this variant site in Wuzhishan pigs, the incidence of abnormal serum CREA levels in this population can be reduced, thereby accelerating the breeding process of Wuzhishan pigs.

[0066] In addition, according to Table 2, Figure 2 Furthermore, the incidence of abnormal serum CREA levels was higher in the GA genotype than in the AA genotype, indicating that heterozygous GA genotype is associated with a higher risk of abnormal serum CREA levels. Therefore, during breeding, it is necessary to gradually eliminate GA genotype breeding pigs and select AA genotype individuals to increase the frequency of allele A at this locus generation by generation, thereby reducing the incidence of abnormal serum CREA levels in Wuzhishan pigs.

[0067] Figure 3The figure shows a box plot of serum CREA content distribution in Wuzhishan pigs with different genotypes. As can be seen from the figure, the mean CREA content of individuals with abnormal serum CREA content in the GA genotype (175.10±17.54 μmol / L) is significantly higher than the upper limit of the normal reference range (156.58 μmol / L). This indicates that abnormal serum CREA content in the GA genotype is mostly due to excessively high levels, which leads to a higher risk of abnormalities. Therefore, culling individuals with the GA genotype and retaining individuals with the AA genotype in breeding is beneficial to maintaining the CREA content of the population within the normal range, thereby reducing the incidence of abnormalities.

[0068] Table 2. Correlation between the variant site g.121 G / A of the molecular marker and abnormal serum CREA levels in Wuzhishan pigs.

[0069] Example 4 Heredity Analysis To assess the genetic basis of serum CREA content, this example uses serum CREA content data from 152 Wuzhishan pigs with both phenotypic and genotypic data from Example 2. Combined with whole-genome SNP marker information, the heritability of SNPs was estimated using the genomic restriction maximum likelihood method (GREML) in GCTA software. A genomic relationship matrix was constructed during the analysis, and age, sex, and batch were included as fixed effects in the model.

[0070] The results are shown in Table 3. The SNP heritability of serum CREA content in Wuzhishan pigs was 0.635 (standard error 0.132), which is a highly heritable trait, indicating that this trait is mainly controlled by genetic factors, with relatively little influence from environmental factors. Therefore, serum CREA content is suitable as a target trait for molecular marker-assisted breeding, and early precise improvement can be achieved through genetic selection, providing an important genetic basis for the subsequent application of SNP markers.

[0071] Table 3. Heritability analysis of serum CREA content in Wuzhishan pigs

[0072] Example 5 explains the invention process of detecting molecular markers. (1) The target fragment containing a mutation site that is significantly associated with the abnormal incidence of serum CREA content in Wuzhishan pigs is a 419 bp nucleotide sequence from chromosome 11 (SEQ ID NO.1). The upstream and downstream primers for sequence amplification are primer-F and primer-R, and its nucleic acid sequence is as follows: Upstream primer-F: 5'-TGTCCTCAGATTTCCAGGAGC-3'; Downstream primer primer-R: 5'-TGGCCAAAGTCTTGAATGAAAAAG-3'.

[0073] (2) PCR amplification system and conditions Prepare a 10 μL system, including 1.0 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O. The PCR reaction program is as follows: 95°C for 3 min; 94°C for 30 s, 60°C for 30 s, 72°C for 60 s, 30 cycles; 72°C for 10 min.

[0074] (3) DNA sequence sequencing identification: Sequencing was performed at BGI Genomics Co., Ltd. in Shenzhen, with two sequencing reactions for each gene fragment. The obtained sequences were compared with the NCBI genome sequence to identify the mutations at the corresponding variant sites. The sequencing results are shown below: TGTCCTCAGATTTCCAGGAGC CTGTTGTTAAACTTCATTCAAAGAAAACATTTGGCACACTAGGTTCTGGTGTGAGAAACAGCATTCTAAAAAACAGGGTAGGAGTTCCCGTTGTGACAC M(A / G) GTGGGTTAAGGATTGAGCATTGCCACAGCTGTGACATAGGTTGCAGCTACAGCTCAGATTACCTTTCCCTGGGAACTTCCATATGCTGTAGGTGTGGCTGAAAAAGAAAACCAACCAACAAATAAAAAAATAGCAAT GTACAGCAATTACTCTCTGCTGCTGATACTTAGAATTTAAATAACAATATCTAAATAACCATGTTTTATTTGGGAGCAATATTTAATATGAAAGTTTAGGATCCCTGGTTTACATTTTTCAATATTTGTGTTGGAAA CTTTTTCATTCAAGACTTTGGCCA Note: M marked in the sequence is the mutation site (the mutated base in parentheses is the allele mutation), and the underlined parts at the beginning and end of the sequence are the primer binding positions.

[0075] Example 6: G / A effect analysis of the variant site g.121 of SNP molecular markers This invention provides an SNP molecular marker that can significantly reduce the incidence of abnormal serum CREA levels in Wuzhishan pigs. Using this SNP molecular marker for marker-assisted selection, the incidence of abnormal serum CREA levels in Wuzhishan pig populations can be effectively reduced by eliminating unfavorable heterozygous GA individuals.

[0076] To assess its potential breeding benefits, estimates were made based on data obtained at locus 68587544 (G / A) on chromosome 11. In the current observed population, the frequencies of the AA and GA genotypes are approximately 82.24% and 17.76%, respectively. The CREA abnormality rates for individuals with the AA and GA genotypes are approximately 11.20% and 33.33%, respectively. After weighted calculation, the overall CREA abnormality rate of the current population is approximately 15.13% (23 / 152). If a marker-assisted breeding program is implemented, i.e., all GA-type individuals (who have extremely high CREA levels and a high risk of abnormality) are eliminated, and only AA-type individuals are retained and selected, the expected CREA abnormality rate of the new population can be reduced to approximately 11.20%. Therefore, by precisely eliminating high-risk GA genotype individuals, the CREA abnormality rate of the population can theoretically be significantly reduced from 15.13% to 11.20%. Taking a Wuzhishan pig farm with a scale of 10,000 pigs as an example, after implementing this breeding program, the proportion of individuals with normal CREA phenotype in the herd can be increased from 84.87% to 88.80%. Since abnormal CREA is closely related to health problems such as kidney damage and protein metabolism disorders, increasing the proportion of individuals with normal CREA helps improve the overall health level of the herd, thereby improving its production performance and scientific research value. In summary, precise culling of the G allele at the 11:68587544 locus, while retaining individuals with the AA genotype, provides an efficient molecular breeding strategy for reducing the incidence of abnormal CREA content in Wuzhishan pigs, and has significant application and promotion value and industrial prospects.

[0077] The SNP molecular marker provided by this invention not only reveals the genetic loci associated with the CREA abnormality risk in Wuzhishan pigs, but also identifies the dominant genotype (AA) and the inferior genotype (GA) through genotype-phenotype association analysis. Applying this marker to marker-assisted breeding enables early and precise selection of breeding pigs, gradually optimizing the genotype frequency of the population, effectively reducing the incidence of abnormalities, and improving the overall health and production performance of the herd. This marker has significant theoretical value and broad application prospects for the preservation and innovative utilization of rare local pig breeds.

[0078] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a SNP molecular marker located on chromosome 11 that is associated with abnormal serum creatinine levels in pigs, characterized in that... The application includes at least one of the following (1)-(5): (1) Identify traits associated with abnormal serum creatinine levels in pigs; (2) Prepare products for identifying traits related to abnormal serum creatinine levels in pigs; (3) Screen pigs with a low incidence of abnormal serum creatinine levels; (4) Prepare products from pigs with low incidence of abnormal serum creatinine levels; (5) Genetic breeding of traits related to abnormal serum creatinine levels in pigs; The SNP molecular markers mentioned above correspond to the G / A mutation at 68,587,544 bp on chromosome 11 of the International Pig Reference Genome Version 11.

1. The polymorphism of the bases at this site affects the incidence of abnormal serum creatinine levels in pigs; among them, the incidence of abnormal serum creatinine levels in GA genotype pigs is higher than that in AA genotype pigs. The pig mentioned is a Wuzhishan pig; The application described is for purposes other than disease treatment or diagnosis.

2. The application according to claim 1, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1.

3. The application of a product for detecting SNP molecular markers located on chromosome 11 that are associated with abnormal serum creatinine levels in pigs, characterized in that... The application includes at least one of the following (1)-(5): (1) Identify traits associated with abnormal serum creatinine levels in pigs; (2) Prepare products for identifying traits related to abnormal serum creatinine levels in pigs; (3) Screen pigs with a low incidence of abnormal serum creatinine levels; (4) Prepare products from pigs with low incidence of abnormal serum creatinine levels; (5) Genetic breeding of traits related to abnormal serum creatinine levels in pigs; The SNP molecular marker mentioned is the SNP molecular marker described in claim 1; The pig mentioned is a Wuzhishan pig; The products described include reagents, reagent kits, or chips; The application described is for purposes other than disease treatment or diagnosis.

4. The application according to claim 3, characterized in that: The reagents described contain primer pairs or probes.

5. The application according to claim 3, characterized in that: The kit contains primer pairs or probes; the kit also contains a reaction buffer.

6. The application according to claim 4, characterized in that: The primer pair comprises primers primer-F and primer-R, and their nucleic acid sequences are as follows: Upstream primer-F: 5'-TGTCCTCAGATTTCCAGGAGC-3'; Downstream primer primer-R: 5'-TGGCCAAAGTCTTGAATGAAAAAG-3'.

7. A method for detecting a high or low incidence of abnormal serum creatinine levels in pigs, characterized in that... It includes the following steps: The SNP sites of the SNP molecular markers described in claim 1 on pig chromosome 11 are detected, and the incidence of abnormal serum creatinine levels in pigs is determined to be high or low based on whether the single nucleotide of the SNP site is G or A; wherein, the incidence of abnormal serum creatinine levels in pigs with the GA genotype is higher than that in pigs with the AA genotype. The pig mentioned is a Wuzhishan pig; The method described is not for disease treatment or diagnosis purposes.

8. A method for screening pigs with a low incidence of abnormal serum creatinine levels, characterized in that... It includes the following steps: The SNP sites of the SNP molecular markers described in claim 1 on pig chromosome 11 were detected, and individuals with the AA genotype were selected as breeding pigs, while individuals with the GA genotype were culled; wherein, the incidence of abnormal serum creatinine levels in GA genotype pigs was higher than that in AA genotype pigs. The pig mentioned is a Wuzhishan pig; The method described is not for disease treatment or diagnosis purposes.

9. The method for screening pigs with a low incidence of abnormal serum creatinine levels according to claim 8, characterized in that: The detection process includes the following steps: (1) Extract genomic DNA from the pigs to be tested; (2) Using primer pairs as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification was performed to obtain PCR amplification products; (3) Sequencing the PCR amplification products to obtain sequencing results; (4) Determine the genotype based on the sequencing results; The primer pair comprises primers primer-F and primer-R, and their nucleic acid sequences are as follows: Upstream primer-F: 5'-TGTCCTCAGATTTCCAGGAGC-3'; Downstream primer primer-R: 5'-TGGCCAAAGTCTTGAATGAAAAAG-3'.

10. A method for genetic improvement of pigs, characterized in that... It includes the following steps: Identify the SNP molecular markers described in claim 1 for breeding pigs in the core breeding pig herd, and make corresponding selections based on the molecular markers: select individuals with the AA genotype at position 68587544 bp on chromosome 11 of the International Swine Reference Genome 11.1 for successive generations of breeding pigs, and eliminate individuals with the GA genotype, so as to increase the frequency of allele A at this locus in each generation, thereby reducing the incidence of abnormal serum creatinine levels in pigs; The pig mentioned is a Wuzhishan pig; The method described is not for disease treatment or diagnosis purposes.

Images