Novel siRNA constructs, therapeutic agents and modifications
By optimizing and modifying the target sequence of siRNA, the instability and off-target effects of siRNA therapeutic agents during delivery were resolved, achieving effective silencing of the LRRK2 gene and disease treatment, especially for Parkinson's disease and neovascular ophthalmopathy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-26
- Publication Date
- 2026-05-22
AI Technical Summary
Existing siRNA therapeutics suffer from instability, rapid metabolism, and off-target effects during delivery, especially when target cells are isolated by the blood-brain barrier, and there is a lack of effective treatments for Parkinson's disease and neovascular eye diseases.
By optimizing the targeting sequence and modifying siRNA, its stability and delivery efficiency are increased. siRNA can be delivered to target cells using lipid nanoparticles or modified viral capsids. In particular, siRNA duplexes with phosphorylated 5' ends, phosphonated 5' ends, blunt ends, nucleotide overhangs, acyclic/unlocked nucleic acid motifs, and ethylene glycol nucleic acid motifs are designed to reduce off-target effects.
It achieves effective silencing of the LRRK2 gene, reduces Lrrk2 protein expression and activity, treats Parkinson's disease and neovascular eye disease, reduces off-target effects, and improves the stability and delivery efficiency of siRNA.
Smart Images

Figure FT_1 
Figure SMS_1 
Figure SMS_2
Abstract
Description
Technical Field
[0001] This disclosure relates generally to the field of synthetic biology, and more specifically to siRNA oligonucleotides and their uses. Background Technology
[0002] Recently, small interfering RNAs (siRNAs), sometimes called short interfering RNAs or RNAi agents (e.g., siRNA, dsRNA, antisense oligonucleotides, etc.), have been found to be therapeutic agents for treating genetic and / or gene-related diseases, such as those that cannot be treated with medications by more conventional therapies. Unbound by theory, siRNAs are thought to arise from a natural phenomenon in which small (i.e., about 15 to about 30 nucleotides) non-coding RNAs are found to regulate genes and the genome through a mechanism called RNA interference (RNAi), in which double-stranded RNA (dsRNA) or antisense oligonucleotides induce gene silencing by targeting complementary mRNAs for degradation. More specifically, it is believed that an RNase III-like endonuclease called Dicer cleaves long dsRNA or hairpin RNA to form siRNAs, which typically contain short dsRNA regions, with each RNA strand phosphorylated at the 5' end and containing a 2-nucleotide overhang at the 3' end. Intracellular siRNA encounters and binds to a multi-protein component complex of the argonaute family (Ago2), called the RNA-induced silencing complex (RISC). Upon binding, the 5' end of the siRNA, with its lower thermodynamic stability, typically integrates into the activated RISC complex. Subsequently, the antisense single-stranded siRNA component guides the RISC complex and aligns it with the complementary mRNA. Once the RISC complex finds a complementary portion between its antisense siRNA chain and the mRNA sequence, the catalytic function of the RISC enzyme cleaves the mRNA. This cleavage prevents further translation into protein and instead marks the mRNA for degradation. This mechanism effectively silences genes with sequences complementary to the siRNA sequence. However, the efficacy of siRNA as a therapeutic agent is limited by its instability, rapid metabolism and elimination in vivo, off-target effects, and difficulties in delivering charged molecules (such as oligonucleotides) to the cytoplasm of target cells. These difficulties are further exacerbated when target cells are isolated by the blood-brain barrier.
[0003] Regarding off-target effects as a challenge in the development of siRNA therapeutics, one of the off-target effects of siRNA is the mi-RNA-like effect. (Lam et al., (2015) Molecular Therapy Nucleic Acids) Molecular Therapy Nucleic Acid(2015, 4, e252). miRNAs primarily recognize target genes through base pairing between their seed region (e.g., positions 2-9 starting from the 5' end) and the target mRNA used for gene repression. Off-target effects caused by siRNAs arise from base complementarity between the seed region of the antisense strand of the siRNA loaded into RISC and one or more mRNAs. miRNA-like off-target effects of siRNAs have been reported in several studies, affecting the expression of many genes. This effect depends on the sequence of the seed region and can be severe enough to cause up to 30% positive results in siRNA-based phenotypic screening. Furthermore, with respect to miRNAs, it has been reported that when the interaction between the seed region and the target weakens, they silence the target gene through compensatory pairing in their 3'-end regions (3'-compensatory pairing), suggesting that miRNA-like off-target effects may be mediated by such a mechanism.
[0004] Dual-luciferase reporter gene assays are one of the standard methods for screening off-target effects of siRNA therapeutics. They are a powerful tool for quantifying gene expression. The assay involves co-transfecting cells with two different luciferase genes, each controlled by a different promoter. One promoter is constitutive, driving the expression of a reference luciferase (e.g., Renalis luciferase), while the other is controlled by the target gene. By measuring the ratio of the two luciferases, researchers can accurately assess changes in gene expression.
[0005] Ongoing efforts are being made to eliminate or reduce miRNA-like off-target effects of siRNAs by judiciously applying chemical modifications to modulate siRNA design, without compromising the gene-silencing efficacy of siRNA therapeutics. This disclosure relates in part to these efforts.
[0006] Leucine-rich repeat kinase 2 ( LRRK2The LRRK2 gene encodes the protein Lrrk2, also known as dardarin or PARK8. Lrrk2 includes kinase and GTPase domains and is expressed in many organs and tissues throughout the body, including the kidneys, lungs, heart, liver, and central nervous system. Lrrk2 enables the phosphorylation of a wide range of proteins involved in various processes, such as neuronal plasticity, innate immunity, autophagy, and vesicle transport, and is believed to play a role in signal transduction and cytoskeleton assembly. The LRRK2 gene is located in the chromosomal region 12q11.2–12q13.1 and is highly conserved across a wide range of organisms. The LRRK2 gene consists of 51 exons encoding 2527 amino acids, containing enzyme domains including a ROC (complex Ras) domain, a GTPase domain, a serine / threonine kinase domain, a leucine-rich repeat (LRR) domain, a C-terminal WD40 repeat domain, an armadillo repeat (ARM) domain, and an ankyrin repeat (ANK) domain. Mutations in LRRK2 have been found to be associated with inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), susceptibility to bacterial infections (such as Hansen's disease / leprosy), and Parkinson's disease (PD).
[0007] Parkinson's disease (PD) is a progressive, disabling neurodegenerative syndrome that is ultimately fatal. Clinically, PD can manifest as tremor, loss of balance and coordination, rigidity, bradykinesia, speech changes, and cognitive decline. The motor symptoms of PD are thought to be caused by the death of neurons in the substantia nigra, a midbrain region that supplies dopamine to the basal ganglia. The progression of the disease is associated with the aggregation of α-synuclein within neurons into Lewy bodies. Currently, there are no approved curative or disease-modifying therapies for PD, and available treatments focus on supplementing dopamine function using dopamine precursors (carbidopa or levodopa), monoamine oxidase inhibitors that reduce dopamine metabolism, and / or dopamine receptor agonists. However, as the disease progresses, these treatments become less effective, and due to the dopamine deficiency resulting from disease progression, increased doses are required to compensate. At this point, modulating dopaminergic stimulation becomes increasingly difficult, and these medications can have serious side effects, including motor disturbances, gastrointestinal symptoms, cognitive difficulties, and hallucinations.
[0008] LRRK2 Mutations have been found in both hereditary PD (autosomal dominant Parkinson's disease) and sporadic PD cases. Similar mutations have been found in both familial and sporadic PD cases. LRRK2 Mutations indicate that these missense and / or deletion mutations play a key role in the etiology of PD. PD-related LRRK2 Mutations are typically associated with enhanced kinase and / or GTPase activity. Some single nucleotide polymorphisms (SNPs) highly associated with the development of PD include: LRRK2Two missense mutations in the kinase domain, namely G2019S and I2020T, and LRRK2 Three missense mutations in the GTPase domain, namely R1441C, R1441G, and R1441H, were identified. All five mutations were associated with increased kinase activity in the LRRK2 protein. Furthermore, no other mutations were identified. LRRK2 Mutations but elevated Lrrk2 kinase activity may lead to idiopathic PD.
[0009] There is a need for improved methods to treat Parkinson's disease, as well as improved methods for stabilizing and delivering siRNA.
[0010] Vascular endothelial growth factor A (Vegf-A) is a protein that stimulates angiogenesis. It is a member of the platelet-derived growth factor family and is essential for both physiological and pathological angiogenesis. Inhibition of Vegf-A can be used to treat certain cancers, such as solid tumors and myeloma, as well as certain degenerative eye diseases, such as wet macular degeneration, whose pathology depends on angiogenesis. Vegf-A inhibitors include monoclonal antibodies, such as bevacizumab marketed under the brand name Avastin, which bind to Vegf-A and prevent it from binding to its receptors (Flt-1 and KDR) on the surface of endothelial cells. Inhibition of Vegf-A inhibits the angiogenesis required for tumor growth and suppresses the growth of new lymphatic vessels (lymphangiogenesis), which can promote tumor metastasis to distant organs. Inhibition of Vegf-A can also control excessive angiogenesis and prevent vision loss in neovascular eye diseases such as wet age-related macular degeneration and macular edema, which are major causes of vision loss in adults. Avastin is approved for the treatment of a variety of solid tumors, including metastatic colorectal cancer, cervical cancer, endometrial cancer, non-small cell lung cancer, glioblastoma, metastatic hepatocellular carcinoma, metastatic renal cell carcinoma, ovarian cancer, primary peritoneal cancer, and fallopian tube cancer. Another anti-Vegf-A mAb, ranibizumab, marketed under the brand name Lucentis, is used to treat degenerative eye diseases characterized by abnormal angiogenesis, such as neovascular (wet) age-related macular degeneration (AMD), macular edema following retinal vein occlusion, diabetic macular edema, diabetic retinopathy, and myopic choroidal neovascularization.
[0011] Angiopoietin-2 (Angpt-2) is encoded by the ANGPT2 gene and is also involved in angiogenesis. Inhibition of Angpt-2 should complement or provide an alternative to current anti-angiogenic strategies in the treatment of cancer and neovascular eye diseases.
[0012] There is a need to improve methods for treating cancer and neovascular eye diseases, as well as methods for stabilizing and delivering RNAi agents. Summary of the Invention
[0013] We have unexpectedly discovered that, corresponding to certain LRRK2 siRNA of the gene sequence can effectively reduce or silence Lrrk2 expression, but for other... LRRK2 siRNAs based on gene sequences are relatively ineffective. By optimizing the targeting sequence, and further by optimizing and preparing siRNAs to increase stability, reduce off-target effects, and enhance delivery, we can provide a therapeutically effective method to reduce Lrrk2 expression and activity in cells, and thereby treat diseases, including PD.
[0014] This disclosure provides compounds, pharmaceutical compositions, and methods of preparation and use thereof for reducing LRRK2 expression.
[0015] In one aspect, this disclosure provides a compound (compound 1) comprising a double-stranded siRNA duplex. In some embodiments, the siRNA duplex comprises a sense sequence and an antisense sequence, wherein at least one of the sense sequence and / or antisense sequence is any one of the sequences in Tables 1-34. In a further embodiment, the siRNA duplex comprises a sense sequence and an antisense sequence, wherein at least one of the sense sequence and / or antisense sequence is any one of the sequences in Tables 1-34. LRRK2 or VEGFA or ANGPT2 The gene-complementary sequence optionally has one or more mutations associated with a disease, symptom, or pathological condition. In a further embodiment, the siRNA duplex comprises one or more modified sequences, such modifications being, for example, a phosphorylated 5' end, a phosphonated 5' end, a blunt end, at least one nucleotide overhang, an acyclic / unlocked nucleic acid (UNA) and / or glycol nucleic acid (GNA) motif, a lipophilic motif, a phosphate thioester bond, or modified nucleotides, such as 2'-deoxy-2'-fluorine and / or 2'-O-methylribose. In some embodiments, the siRNA duplex is part of a pharmaceutical composition, accompanied by a pharmaceutically acceptable diluent or carrier, or encapsulated within a delivery carrier such as lipid nanoparticles or a modified viral capsid.
[0016] On the other hand, this disclosure provides a method (method 2) that includes suppression LRRK2 Gene expression in, for example, cells or subjects. In some embodiments, the method includes administering a double-stranded siRNA comprising a sense sequence and an antisense sequence, wherein at least one of the sense sequence and / or antisense sequence is any one of the sequences in Tables 1-34. In a further embodiment, the method includes administering a double-stranded siRNA comprising a sense sequence and an antisense sequence, wherein the sense sequence and / or antisense sequence is any one of the sequences in Tables 1-34. LRRK2The gene-complementary sequence optionally has one or more mutations associated with a disease, symptom, or pathological condition. In a further embodiment, the method includes administering a double-stranded siRNA containing one or more sequences having the modifications listed above. In another embodiment, the method includes administering siRNA or a pharmaceutical composition thereof to a subject, optionally wherein the subject is a mammal, such as a human. In some embodiments, the method includes administering to a person already diagnosed with... LRRK2 Subjects with relevant diseases, symptoms, or pathological conditions were given siRNA, the LRRK2 Related diseases, conditions, or pathological conditions such as inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), susceptibility to bacterial infections (such as Hansen's disease / leprosy), and / or Parkinson's disease (PD). In another embodiment, the method includes administering siRNA to the subject via intravascular, subcutaneous, intramuscular, intraperitoneal, intracerebral, intraventricular, or intrathecal injection, optionally wherein the siRNA is administered at a dose of about 0.01 mg / kg to about 50 mg / kg. In a further embodiment, the method includes administering the siRNA therein to prevent, inhibit, reduce, treat, and / or improve conditions related to... LRRK2 Symptoms related to the relevant disease, condition, or pathological state.
[0017] In another embodiment, this disclosure provides a method (method 2A) for treating a disease or condition characterized by or dependent on angiogenesis or lymphangiogenesis (e.g., cancer or ocular neovascularization), the method comprising administering an effective amount of a compound, said compound being a double-stranded siRNA duplex or an antisense oligonucleotide (ASO), said double-stranded siRNA duplex comprising a sense sequence and a complementary antisense sequence, wherein said sequence corresponds to VEGFA or ANGPT2 The region of the gene, wherein the siRNA duplex or ASO effectively and significantly reduces VEGFA or ANGPT2 mRNA in the cell.
[0018] In another embodiment, this disclosure provides modified siRNAs that enhance stability and delivery to cells by linking the lipid moiety to one or both ends of a sense or antisense oligonucleotide (ASO) or to any location within the sense or ASO.
[0019] In another embodiment, this disclosure provides siRNA with antisense modifications that reduce off-target effects, and novel nucleoside analogs that provide such modifications.
[0020] In another embodiment, this disclosure provides siRNAs with antisense modifications at the ends of the construct to enhance RISC binding, and novel nucleoside analogs providing such modifications. Attached Figure Description
[0021] Figure 1 Optional modifications to RNAi agents are described to increase efficacy, delivery and stability and reduce off-target effects. Detailed Implementation
[0022] The following descriptions of different embodiments are merely exemplary in nature and are by no means intended to limit the invention, its application, or its use.
[0023] I. Definition As used herein, unless otherwise specified, the following terms have the meanings assigned to them.
[0024] As used in this article, the term " LRRK2 "Genes are considered equivalent to genes with alternative names but the same basic sequence, such as DRDN, RIPK7, PARK8, AURA17, ROCO2, and leucine-rich repeat kinase 2, and also include..." LRRK2 Natural variants, such as those associated with disease, include G2019S, I2020T, R1441C, R1441G, R1441H, Y1699C, N2081D, and Rs11175593. LRRK2 / MUC19 Rs11564258 LRRK2 / MUC19 M2397T, R1398H, N551K, Rs1873613, Rs1491938, and R1628P; and especially including mutations associated with Parkinson's disease, such as mutations at positions 1371, 1437, 1441, 1699, 2019, and 2020, such as I1371V, N1437H, N1437D, R1441C, R1441G, R1441H, R1441S, Y1699C, G2019S, and I2020T.
[0025] As used herein, sequences containing nucleotide chains using the standard nucleotide nomenclature “G”, “C”, “A”, “T”, and “U” should be understood to refer to guanine, cytosine, adenine, thymine, and uracil nucleotide bases, which are modified or unmodified and have natural or non-natural linkages. RNAi agents refer to any molecule that induces RNA interference (RNAi), such as siRNA, dsRNA, dsRNA duplexes, or antisense oligonucleotides (ASO).
[0026] As used in this article, gene, DNA, and / or RNA “expression” should be understood as a process along the classical pathway, which begins with DNA, which can be transcribed into RNA, and RNA can be translated into protein.
[0027] As used in this article, “treating” or “treatment” encompasses the prevention, reduction, improvement of symptoms, or delay of the progression of a disease or condition.
[0028] As used herein, "off-target effect" or "off-target" encompasses symptoms associated with the administration and / or presence of exogenous therapeutic agents (e.g., siRNA) caused by interactions with the exogenous therapeutic agent at locations other than the site targeted by the therapeutic agent. For example, siRNA designed to target... LRRK2 Off-target effects of siRNA on the gene and / or LRRK2 mRNA, including effects caused by said siRNA interacting with the target gene. LRRK2 Any effect caused by binding or interaction of parts other than the gene and / or LRRK2 mRNA.
[0029] This disclosure provides compounds, pharmaceutical compositions, and methods of using the same to reduce [the risk of infection]. LRRK2 Methods for expressing (i.e. translating) LRRK2 mRNA transcribed from the gene into protein.
[0030] For example, the disclosed compounds, pharmaceutical compositions, and methods are designed to reduce the presence and / or function of the Lrrk2 protein. In some embodiments, the Lrrk2 protein is a functional natural protein. In other embodiments, the Lrrk2 protein is derived from a mutated nucleotide sequence, such that the resulting Lrrk2 protein exhibits an activity rate exceeding that of a typical natural protein, for example, enhanced kinase activity. In a further embodiment, the Lrrk2 protein is derived from a mutated nucleotide sequence, such that the resulting Lrrk2 protein has lower or no activity than a typical natural protein, optionally wherein the Lrrk2 protein is misfolded and / or cannot be efficiently degraded by endogenous cellular metabolism.
[0031] In another example, the disclosed compounds, pharmaceutical compositions, and methods are designed to selectively induce [something] from [something]. LRRK2 Targeted degradation of mRNA transcribed from genes. In some implementations, LRRK2 A gene is a healthy, naturally occurring nucleotide sequence that does not contain any mutations. In other implementations, LRRK2 The gene contains a mutation, optionally said mutation includes a missense mutation, one or more single nucleotide polymorphisms (SNPs), deletions, or combinations thereof, optionally said mutation is located in LRRK2 Within the coding and / or non-coding regions of a gene. In some embodiments, the mutation is associated with pathology, disease state, disease etiology, or disease progression. LRRK2 Examples of gene mutations include, but are not limited to, G2019S, I2020T, R1441C, R1441G, R1441H, Y1699C, N2081D, and Rs11175593. LRRK2 / MUC19Rs11564258 LRRK2 / MUC19 M2397T, R1398H, N551K, Rs1873613, Rs1491938, and R1628P. Among these, it is expected that... LRRK2 Targeted degradation of gene-transcribed mRNA is an example of therapeutic pathological conditions and / or disease states, including but not limited to inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), bacterial infections such as Hansen's disease / leprosy, and Parkinson's disease (PD).
[0032] In some embodiments, the disclosed compounds, pharmaceutical compositions, and methods are functional within cells (e.g., one or more cells in a subject's body). The subject may be a mammal, such as a mouse, rat, dog, cat, pig, cow, sheep, goat, horse, or human. Alternatively, the subject may be a bird, reptile, amphibian, fish, or invertebrate.
[0033] In some embodiments, this disclosure provides methods for suppressing LRRK2 A double-stranded siRNA duplex or ASO for gene expression, wherein the siRNA duplex comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises at least 15, at least 17, or at least 19 consecutive nucleotides that differ from the nucleotide sequence of any one of Tables 1-34 by no more than 3 nucleotides.
[0034] In some embodiments, this disclosure provides methods for suppressing LRRK2 A double-stranded siRNA duplex or ASO for gene expression, wherein the siRNA duplex comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of any one of Tables 1-34 by no more than 3 nucleotides.
[0035] In some embodiments, this disclosure provides methods for suppressing LRRK2 A double-stranded siRNA duplex or ASO for gene expression, wherein the siRNA duplex comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a region complementary to the mRNA encoding the Lrrk2 protein, and wherein the complementary region comprises at least 15, at least 17, or at least 19 consecutive nucleotides differing by no more than 3 nucleotides from any of the sense and / or antisense nucleotide sequences in any of Tables 1-34.
[0036] In some embodiments, this disclosure provides methods for suppressing LRRK2 A double-stranded siRNA duplex or ASO for gene expression, wherein the siRNA duplex comprises a sense strand and an antisense strand forming a double-stranded region, wherein the length of the double-stranded region is at least 21, at least 19, at least 17, at least 15, or at least 13 nucleotide bases.
[0037] In some embodiments, this disclosure provides methods for suppressing LRRK2 A double-stranded siRNA duplex or ASO for gene expression, wherein the siRNA duplex comprises a sense strand and an antisense strand forming a complementary double-stranded region, wherein the sense strand and / or antisense strand further comprises blunt ends or non-complementary 3' protrusions having at least one, at least two, at least three, or at least four nucleotides.
[0038] In some implementations, relative to the control level, siRNA duplexes or ASO will LRRK2 The expression of the gene is suppressed by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, and the level of lesions containing both sense and antisense is reduced.
[0039] In some embodiments, this disclosure provides for inhibiting cells LRRK2 A method for gene expression, comprising contacting the cell with the RNAi agent of the present invention or the pharmaceutical composition of the present invention, thereby inhibiting gene expression in the cell. LRRK2 Gene expression. In some embodiments, the cells are in a subject, optionally wherein the subject is a mammal, optionally wherein the subject is a human.
[0040] In some embodiments, this disclosure provides for using cells LRRK2 A method for inhibiting gene expression by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% relative to a control level, the method comprising contacting the cells with an RNAi agent of the present disclosure, or a pharmaceutical composition comprising a double-stranded siRNA or an ASO of the present disclosure. In some embodiments, the cells are in a subject, optionally wherein the subject is a mammal, optionally wherein the subject is a human.
[0041] In some embodiments, this disclosure provides a method for inhibiting the expression of LRRK2 mRNA in cells by at least 90%, at least 80%, 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% relative to a control level, the method comprising contacting the cells with an RNAi agent of the present invention or a pharmaceutical composition of the present invention. In some embodiments, the cells are in a subject, optionally wherein the subject is a mammal, optionally wherein the subject is a human. In a further embodiment, the subject has been diagnosed with an LRRK2-related disease, such as inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), bacterial infection such as Hansen's disease / leprosy, and Parkinson's disease (PD).
[0042] In some embodiments, this disclosure provides a method for reducing the level of Lrrk2 protein in the serum of a subject by at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% relative to a control level, the method comprising administering to the subject the RNAi agent of the present invention or the pharmaceutical composition of the present invention.
[0043] In some embodiments, this disclosure provides a treatment for patients who will benefit from LRRK2 A method for treating a subject with a disease, symptom, or pathological condition characterized by reduced gene expression, the method comprising administering to the subject a therapeutically effective amount of the RNAi agent of the present invention or the pharmaceutical composition of the present invention, thereby treating the subject who would benefit from LRRK2 Subjects with reduced expression of disease, symptom, or pathological condition.
[0044] In some embodiments, this disclosure provides an improvement for patients who will benefit from LRRK2 A method for relieving at least one symptom in a subject with a disease, symptom, or pathological condition characterized by reduced gene expression, the method comprising administering to the subject a therapeutically effective amount of the RNAi agent of the present invention or a pharmaceutical composition of the present invention, thereby improving and / or reducing the condition in which the subject would benefit. LRRK2 The subject expresses at least one symptom of a disease, condition, or pathological condition that is reduced.
[0045] In some embodiments, this disclosure provides for patients who will benefit from LRRK2 A method for preventing at least one symptom in a subject with a disease, condition, or pathological condition characterized by reduced gene expression, the method comprising administering to the subject a preventatively effective amount of the RNAi agent of the present invention or the pharmaceutical composition of the present invention, thereby benefiting the subject. LRRK2 Prevention of at least one symptom in subjects with reduced expression of disease, condition, or pathological condition.
[0046] In some embodiments, any of the methods disclosed herein further includes measuring the concentration of [unclear - possibly related to a specific substance or ingredient] in a sample collected from a subject. LRRK2 The levels of genes, LRRK2 mRNA, and / or Lrrk2 protein. In some embodiments, the sample is blood, serum, and / or cerebrospinal fluid.
[0047] In some implementations, the RNAi agent is administered to the subject at a dose of about 0.01 mg / kg to about 50 mg / kg.
[0048] In some implementations, the RNAi agent is administered via intravenous injection.
[0049] In some implementations, the RNAi agent is administered to the cerebrospinal fluid, for example by intrathecal injection or intraventricular injection (ICV injection).
[0050] In some embodiments, the RNAi agent is delivered using lipid nanoparticles (LNPs). For example, the RNAi agent can be delivered in a lipid nanoparticle formulation, wherein the lipid nanoparticles comprise siRNA or ASO surrounded by one or more ionizable lipids (e.g., tertiary amines linked to lipid chains, such as MC3), one or more phospholipids (e.g., DSPC (1,2-distearate-sn-glycero-3-phosphocholine)), and cholesterol to form a stable nanoparticle structure, which is coated with one or more polyethylene glycol-modified lipids. Within the lipid nanoparticles, the relatively anionic siRNA or ASO interacts with the relatively cationic ionizable lipids... The ionized lipid complex maintains a stable conformation during administration, and upon delivery (e.g., when the lipid nanoparticles reach the endosomes of the target cells), it decomposes and releases the RNAi agent. In some embodiments, the lipid component of the lipid nanoparticles comprises ionizable lipids (e.g., DLin-MC3-DMA), phospholipids (e.g., DSPC), cholesterol, and polyethylene glycol-modified lipids (e.g., PEG-DMG ((R)-2,3-bis(octadecoxy)propyl-1-(methoxy polyethylene glycol 2000)carbamate), for example, in a molar ratio of about 50 / 10 / 38.5 / 1.5.
[0051] In some embodiments, the RNAi agent is delivered using a viral capsid or an alternative transfection method. In some embodiments, the siRNA duplex is a hairpin sequence, i.e., the sense and antisense strands of the siRNA duplex are on a single molecule. In a further embodiment, a DNA construct corresponding to the siRNA hairpin sequence is delivered.
[0052] In some embodiments, the RNAi agent comprises a sequence complementary to the LRRK2 mRNA sequence. In some embodiments, the RNAi agent comprises one or more sequences that are or are complementary to one or more sequences listed in Tables 1-34 herein. In other embodiments, the RNAi agent comprises one or more sequences that are substantially complementary to one or more sequences listed in Tables 1-34 herein, for example, wherein three or fewer nucleotides do not match the listed sequences. In some embodiments, the two strands of the siRNA duplex are mismatched or not fully complementary to each other, for example, wherein at least one, at least two, or at least three nucleotides are not complementary to the corresponding nucleotide positions within the sense or antisense strand, or wherein there are 0, 1, 2, or 3 nucleotide overhangs at either end or both ends.
[0053] However, we noted that neurons appear to take up RNAi agents more readily than other cell types, so when RNAi agents are delivered directly to the CNS, they can be delivered as naked RNAi agents or as lipid-conjugated RNAi agents (e.g., 2'-O-hexadecyl (C16) conjugates or novel lipid conjugates of compound A).
[0054] In some implementations, administration of an RNAi agent to a subject can cause the production, activity, accumulation and / or aggregation of Lrrk2 protein and / or a decrease, inhibition, suppression and / or decline in its mRNA levels.
[0055] In some embodiments, the RNAi agent comprises one or more sequences corresponding to one or more hotspot locations on the LRRK2 mRNA sequence, for example, wherein these hotspots are sequence segments corresponding to regions of mRNA that are complementary to antisense sequences identified in Tables 1-34 (e.g., Tables 1, 4, 5, 7, 13, 20, 22, 26 and / or 30).
[0056] In some embodiments, the siRNA duplex comprises complementary sense and antisense nucleotide sequences having a length of 15-30 nucleotides, optionally 18-25 nucleotides, optionally 18-23 nucleotides, wherein the sequences may be offset by 1, 2, or 3 or more nucleotides, and / or one strand may be 1, 2, or 3 or more nucleotides longer than the other strand, such that there are overhangs at one or both ends; for example, wherein the sense strand is 19 nucleotides long and the antisense strand is 21 nucleotides long, or the sense strand is 20 nucleotides long and the antisense strand is 22 nucleotides long, or the sense strand is 21 nucleotides long and the antisense strand is 23 nucleotides long, such that the siRNA duplex has two nucleotide overhangs.
[0057] In some embodiments, the RNAi agent (compound A) comprises one or more of the following modifications, such as Figure 1 The description in the text: 1. RISC is loaded at position 1 of the antisense (AS) chain (numbered from the 5' end). Modified nucleosides and analogues can be incorporated into an end position of oligomeric compounds, such as the 5'-end or 3'-end of the AS chain. The guide strand of the siRNA duplex can carry a 5'-phosphate or other analogue to bind to the effector protein of the RNA-induced silencing complex Argonaute 2 (AGO2).
[0058] 2. Modification of the seed region (positions 2-8) in the AS chain (numbered from the 5' end) to reduce off-target effects.Off-target effects are primarily driven by the binding of RISC-loaded siRNAs to off-target transcripts. This binding is mediated by base pairing between the seed region (nucleotides 2-8) of the siRNA guide strand and complementary sites in the mRNA. Thermally unstable modifications to the seed region of the siRNA guide strand can enhance the specificity of the siRNA, mitigate off-target effects, and still allow for effective full-length targeted recognition.
[0059] 3. Lipid conjugation on sense (SS) or antisense (AS) strands Oligonucleotide-ligand conjugates can promote the delivery and uptake of siRNA duplexes by target cells.
[0060] 4. Terminal thiophosphate (PS) bonds are used to increase stability. The design of terminal thiophosphate (PS, Rp, or Sp isomer) bonds provides protection against 3' and / or 5' exonucleases, increases protein binding, and improves PK; chiral selection enhances RISC loading and metabolic stability and can be used for siRNA conjugation.
[0061] 5. Ribose modification to increase stability The design combines 2'-O-methyl (2'-OMe) and 2'-deoxy-2'-fluoro (2'-F) ribose modifications in both strands of the siRNA; this is associated with reduced immune stimulation.
[0062] 6. 5'-blocking to enhance efficacy This invention provides modified nucleosides and analogues that can be incorporated into an end position of oligomeric compounds, such as the 5' end of the sense strand (SS). The strand with the thermodynamically less stable 5' end in the duplex will be selected as the antisense strand by the RISC. Preferential loading of the desired antisense strand can be achieved in most cases through inventive design. However, loading of the sense strand into the RISC cannot be ruled out, especially when the thermodynamic asymmetry between the two ends of the siRNA is not significant. The presence of a 5' monophosphate group helps anchor the antisense strand in the RISC, and there is an interaction between the 5' monophosphate of the antisense strand and the MID domain of Argonaute 2, the protein component of the RISC responsible for targeted cleavage. Therefore, loading of the sense strand into the RISC can be prevented by blocking 5' phosphorylation.
[0063] In some implementations, GNA- S GNA- R One or more modifications of the antisense strand (AS) in UNA and / or SNA, such as positions 2-8, or position 5 (starting from the 5' end). In some embodiments, said one or more modifications reduce full-length targeting activity while mitigating off-target effects, for example in dual-luciferase reporter gene assays. For example, in one embodiment, GNA- is used at position 7. Sand GNA- R Modifications maintained targeting activity, while UNA and SNA modifications reduced full-length targeting activity but mitigated off-target effects, for example, in dual-luciferase reporter gene assays.
[0064] In some implementations, the off-target effects of dsRNA molecules can be mitigated by incorporating thermally unstable nucleotides (e.g., GNA) at selected sites in the antisense strand of the dsRNA and optionally in the sense strand. S GNA- R (UNA and / or SNA) to reduce or inhibit, for example as described in WO2018098328, the contents of which are incorporated herein by reference as a complement or alternative to incorporation of one or more novel nucleotide analogs as described herein.
[0065] In some implementations, the seed region (nucleotides 2-8) on the AS (antisense strand) may include or be modified to include one or more of the following nucleotides: in X is O, S, NH, -CONH- or -NHCO-; The wavy line represents the linkage to the phosphate backbone of the oligonucleotide; B is a modified or unmodified nucleobase; R1, R2, R3, and R4 are independently H, halogen, -OR5, or alkyl; and R5 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar.
[0066] In any of the expressions described herein, if they exist and are not defined, then p, q, n, and m are each independently integers defined as follows: p = 0-10, q = 0-10, n = 0-10, m = 1-30.
[0067] For example, this disclosure provides nucleoside analogs selected from formula 1a1 in Table A.
[0068] Table A Therefore, this disclosure provides a double-stranded siRNA duplex comprising a sense sequence and a complementary antisense sequence, wherein the antisense sequence comprises one or more nucleoside analogs of formula 1a or formula 1b, for example, wherein the antisense sequence comprises one or more nucleoside analogs selected from: [N3T1-U], [N3T1-A], [N3T1-C], [N3T1-G], [N3T1-U- R ]、[N3T1-U- S ]、[N3T1-A- R ]、[N3T1-A- S ]、[N3T1-C- R ]、[N3T1-C- S ]、[N3T1-G- R ]、[N3T1-G- S ], [N3T2-U], [N3T2-A], [N3T2-C], [N3T2-G], [N3T2-U- S ]、[N3T2-U- R ]、[N3T2-A- S ]、[N3T2-A- R ]、[N3T2-C- S ]、[N3T2-C- R ]、[N3T2-G- S ]、[N3T2-G- R This disclosure also provides phosphoramide intermediates for preparing nucleoside analogs of formula 1a or formula 1b of double-stranded siRNA duplexes, for example in an O-protected form, wherein the antisense sequence comprises one or more nucleoside analogs of formula 1a or formula 1b. For example, this disclosure provides [N3T12-027-01], [N3T12-031-01], [N3T12-068-01], [N3T12-069-01], [N3T12-027-01-] selected from phosphoramide forms. R [N3T12-027-01-] S ]、[N3T12-031-01- R ]、[N3T12-031-01- S ], [N3T12-047-01], [N3T12-070-01], [N3T12-048-01], [N3T12-071-01], [N3T12 -072-01], [N3T12-073-01], [N3T12-074-01], [N3T12-075-01], [N3T12-072-01- S [N3T12-072-01-] R [N3T12-073-01-]S [N3T12-073-01-] R [N3T12-074-01-] S [N3T12-074-01-] R [N3T12-075-01-] S [N3T12-075-01-] R Nucleoside analogues, for example, [N3T12-027-01] Monomer [N3T12-031-01] Monomer in Z1 is an O-protecting group, such as optionally substituted triphenylmethyl, for example, dimethoxytriphenylmethyl (DMTr). Z2 is a phosphoramidite group, for example, [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite: and Y is an H or N-protecting group, such as benzyl or tert-butyloxycarbonyl (BOC). For example, this disclosure provides nucleoside analogs selected from the following For example, this disclosure provides a method for preparing a double-stranded siRNA duplex comprising a sense sequence and a complementary antisense sequence, wherein the antisense sequence comprises one or more nucleoside analogs of formula 1a or formula 1b, for example, wherein the antisense sequence comprises one or more nucleoside analogs selected from: [N3T12-027-01], [N3T12-031-01], [N3T1-U], [N3T1-A], [N3T1-C], [N3T1-G], [N3T1-U- R ]、[N3T1-U- S ]、[N3T1-A- R ]、[N3T1-A- S ]、[N3T1-C- R ]、[N3T1-C- S ]、[N3T1-G- R ]、[N3T1-G- S ], [N3T2-U], [N3T2-A], [N3T2-C], [N3T2-G], [N3T2-U- S ]、[N3T2-U-R ]、[N3T2-A- S ]、[N3T2-A- R ]、[N3T2-C- S ]、[N3T2-C- R ]、[N3T2-G- S ] and [N3T2-G- R ].
[0069] In some embodiments, this disclosure provides modified siRNAs that are RNA duplexes comprising a sense strand and an antisense strand, wherein the sense strand comprises one or more lipophilic moieties L1 or L2, the lipophilic moieties L1 or L2 being conjugated to the siRNA via phosphodiester bonds or thiophosphate bonds, and having a structure conforming to Formula 2 below.
[0070] In some embodiments, this disclosure provides modified antisense oligonucleotides (ASOs) comprising one or more lipophilic moieties L1 or L2, said lipophilic moieties L1 or L2 being conjugated to the ASO via phosphodiester bonds or thiophosphate bonds, having a structure conforming to Formula 2: in X = O or S; a = 0 - 4, for example, 0 - 2; b = 0 - 4, for example, 0 - 1; c = 0-4; d=0-4; The condition is that b and d are not both 0; and the band represents the sense strand or antisense oligonucleotide (ASO) of siRNA.
[0071] In some implementations, the sense strand or antisense oligonucleotide (ASO) of siRNA It meets one of the following conditions: Equation 2a: in, R2, R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0072] in, R2, R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0073] In some implementations, the sense strand or antisense oligonucleotide (ASO) of siRNA It meets one of the following conditions: in, R2, R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15; Equation 2d: in, R2, R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0074] In some implementations, the sense strand or antisense oligonucleotide (ASO) of siRNA It meets one of the following conditions: in, R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15; Equation 2f: in, R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0075] In some implementations, the sense strand or antisense oligonucleotide (ASO) of siRNA It meets one of the following conditions: in, R2, R3, R4, R5, R6, R7, R8, R9, R 10 and R 11 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15; Formula 2h: in, R3, R4, R5, R6, R7, R8, R9, R 10 and R 11 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, -CH2O-, -OCH2-, or -SS-; Z can be O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; q = 1 - 10, for example, 1 - 2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15; The condition is that the O with a wavy line on L1 or L2 is part of a phosphodiester bond or thiophosphate bond linked to the sense strand or antisense oligonucleotide (ASO) of siRNA.
[0076] In some implementations, the modifying parts can be combined, as illustrated by the following structure: in X = O or S; and the band represents the sense strand or antisense oligonucleotide (ASO) of the siRNA.
[0077] In some implementations, the selected nucleotide is linked to the 2'-O lipid conjugate moiety or adamantyl group on the sense strand or antisense oligonucleotide (ASO) of the siRNA: Equation 2i: R7, R8 and R9 are each independently H, a halogen or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; Y' is O, S, CH2, NH, -NHCO-, -CONH-, -CH2O-, or -SS-; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0078] In some implementations, the selected nucleotide is linked to the 5'O-lipid conjugate moiety or adamantyl group on the sense strand or antisense oligonucleotide (ASO) of the siRNA: B is a modified or unmodified nucleobase; and the band represents the sense strand or antisense oligonucleotide (ASO) of the siRNA.
[0079] R3, R4, R5, R6, R7, R8 and R9 are each independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, -CH2O-, -OCH2-, or -SS-; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0080] In some implementations, the sense strand or antisense oligonucleotide (ASO) of siRNA It meets one of the following conditions: in, Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0081] In some implementations, the sense strand or antisense oligonucleotide (ASO) of siRNA It meets one of the following conditions: in, Y' is O, S, CH2, NH, -NHCO-, -CONH-; q = 1 - 20; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0082] In some implementations, the sense strand or antisense oligonucleotide (ASO) of siRNA It meets one of the following conditions: For example, equation 2n2: in, Y' is O, S, CH2, NH, -NHCO-, -CONH-; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0083] In some implementations, the sense strand or antisense oligonucleotide (ASO) of siRNA It meets one of the following conditions: in, Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; q = 1 - 10; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0084] In some implementations, exemplary structures include: in, Y is O, S, NH or CH2; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0085] In some implementations, the sense strand or antisense oligonucleotide (ASO) of siRNA It meets one of the following conditions: Equation 2q: in, Y is O, S, NH or CH2; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0086] In some implementations, the sense strand or antisense oligonucleotide (ASO) of siRNA It meets one of the following conditions: Equation 2r: Equation 2s2: in, Y is O, S, NH or CH2; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0087] In some implementations, the sense strand or antisense oligonucleotide (ASO) of siRNA It meets one of the following conditions: Equation 2t3: in, R 12 and R 13 Each is independently selected from H, halogens, and C1-C6 alkyl groups optionally substituted with one or more halogens and / or hydroxyl groups; "Y" can be O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; r = 1-10, for example 1-3; s = 1-10, for example 1-3; t=1-10; u=0-3; m = 0-5; n = 1 - 30; o=1-5.
[0088] In some implementations, the sense strand or antisense oligonucleotide (ASO) of siRNA It meets one of the following conditions: in, X = O or S; and the band represents the sense strand or antisense oligonucleotide (ASO) of the siRNA.
[0089] In some embodiments, compound A contains one or more of the following modifications to the sense chain and / or antisense chain: a. Any of the aforementioned compounds, wherein the sense nucleotide sequence and the antisense nucleotide sequence have a length of 18-23 nucleotides, wherein the sequence is offset by 1, 2 or 3 nucleotides and / or one strand is 1, 2 or 3 nucleotides longer than the other strand, such that there is a protrusion at one or both ends.
[0090] b. Any of the aforementioned compounds, wherein the sense strand is 19 nucleotides long and the antisense strand is 21 nucleotides long, or the sense strand is 20 nucleotides long and the antisense strand is 22 nucleotides long, or the sense strand is 21 nucleotides long and the antisense strand is 23 nucleotides long, such that the siRNA duplex has a two-nucleotide overhang, for example, wherein the overhang extends beyond the 5' end of the sense sequence, for example, as... Figure 1 What is depicted.
[0091] c. Any one or both sequences of the aforementioned compounds have a phosphorylated 5' end.
[0092] d. Any of the preceding compounds, wherein the siRNA duplex comprises a protrusion extending beyond the 5' end of the sense sequence by at least one nucleotide, optionally wherein the protrusion comprises two nucleotides.
[0093] e. Any of the preceding compounds, wherein the siRNA duplex comprises one or both sequences modified with a phosphonate ester at the 5' end.
[0094] f. Any of the preceding compounds, wherein the siRNA duplex comprises one or both sequences modified by off-target modifications (e.g., UNA and / or GNA), optionally wherein the modification is present between nucleotides 2-8 of the antisense sequence in the 5' to 3' direction.
[0095] g. Any of the foregoing compounds, wherein the siRNA duplex comprises one or two sequences modified by one or more lipophilic moieties, optionally wherein the one or more lipophilic moieties are conjugated to one or more internal positions in the duplex region of the RNAi agent, for example, wherein the one or more lipophilic moieties are selected from alkyl groups, such as C 12-22 alkyl.
[0096] h. Any of the foregoing compounds, wherein the siRNA duplex comprises one or two sequences modified with one or more lipophilic moieties, and wherein the lipophilic moieties are conjugated to the RNAi agent with or without a linker or vector; for example, wherein the one or more lipophilic moieties are selected from alkyl groups, such as C 12-22 alkyl.
[0097] i. Any of the foregoing compounds, wherein one or both ends of the sense strand of the siRNA duplex are modified with one or more lipophilic moieties, the lipophilic moieties being conjugated to the siRNA with or without a linker or vector; for example, wherein the one or more lipophilic moieties are selected from alkyl groups, such as C 12-22 alkyl.
[0098] j. Any of the preceding compounds, wherein the siRNA duplex comprises one or more sequences having one or more thiophosphate bonds between nucleotides.
[0099] k. Any of the preceding compounds, wherein the RNAi agent comprises one or more sequences modified with one or more non-natural and / or modified nucleotides (e.g., 2'-deoxy-2'-fluorine and / or 2'-O-methylribose modification).
[0100] 1. Any of the aforementioned compounds, wherein the RNAi agent is encapsulated within a delivery vector, such as lipid nanoparticles or a modified viral capsid.
[0101] m. Any of the aforementioned compounds, used as a drug, for example for reducing the expression of a protein product of a target gene in a disease or condition characterized by overexpression, overactivity, or overaccumulation of a protein product of a target gene.
[0102] For example, in one embodiment, this disclosure provides any of the aforementioned compounds that are RNAi agents that inhibit LRRK2, VEGFA, or ANGPT2, such as compounds selected from Compound 1 and any of the following compounds, wherein the sense strand or antisense strand comprises one or more lipophilic moieties L1 or L2 that are conjugated to the 3' end of the sense strand of the siRNA via a phosphodiester bond or a thiophosphate bond (e.g., via a ribosyl moieties linked to a phosphodiester bond or a thiophosphate bond), such as those described in the foregoing scope.
[0103] Therefore, in one embodiment, this disclosure provides a compound (compound 1) that is a double-stranded siRNA duplex (containing a sense sequence and a complementary antisense sequence) or an antisense oligonucleotide (ASO), wherein a) The compound contains a substance corresponding to LRRK2 One or more sequences of a gene region, for example, wherein the compound effectively and significantly reduces LRRK2 mRNA in cells, for example, as determined by cell-based assays (e.g., in assays substantially as described in Example 3), for example, at concentrations of 10 nM or lower; or b) The compound contains a substance corresponding to VEGFA One or more sequences of a gene region, for example, wherein the compound effectively and significantly reduces VEGFA mRNA in cells, for example, as determined by cell-based assays, at concentrations of 10 nM or lower; or c) The compound contains a substance corresponding to ANGPT2 One or more sequences of a gene region, wherein the compound effectively and significantly reduces ANGPT2 mRNA in cells, for example, as determined by cell-based assays, at concentrations of 10 nM or lower.
[0104] For example, in a specific implementation, this disclosure provides: 1.1. Compound 1, wherein the compound provides at least 70% mRNA knockdown activity at 10 nM in a cell-based assay.
[0105] 1.2. Any of the foregoing compounds, wherein the compound provides at least 70% mRNA knockdown activity at 1 nM in a cell-based assay.
[0106] 1.3. Any of the foregoing compounds, wherein the compound provides at least 70% mRNA knockdown activity at 0.1 nM in a cell-based assay.
[0107] 1.4. Any of the foregoing compounds, wherein the compound provides at least 40% mRNA knockdown activity at 0.01 nM.
[0108] 1.5. Any of the foregoing compounds, wherein the RNAi agent comprises... LRRK2 Genes have complementary sequences.
[0109] 1.6. Any of the foregoing compounds, wherein the RNAi agent comprises the following: LRRK2 A gene has a complementary sequence, and that sequence has one or more mutations associated with a disease, symptom, or pathological condition.
[0110] 1.7. Any of the foregoing compounds, wherein the sense strand or antisense strand comprises a sequence selected from any one of SEQ ID NO. 1-403, such as SEQ ID NO. 1-200; such as the double strands shown in Table 1; such as the double strands shown in Table 1, except N3T130025-01.
[0111] 1.8. Any of the foregoing compounds, wherein the sense or antisense strand comprises a sequence selected from any of the sequences listed in Tables 1, 2a, 2b, 4, 5, 7, 9, 13, 16, 18, 20, 22, 24, 26, 29, 33.
[0112] 1.9. Any of the aforementioned compounds contains a sense or antisense sequence selected from the sequences listed in Table 5.
[0113] 1.10. Any of the aforementioned compounds is selected from the double strands listed in Table 5.
[0114] 1.11. Any of the foregoing compounds, wherein the antisense strand comprises a sequence complementary to a sequence comprising one of the following nucleotide sites of LRRK2 mRNA (numbered based on the gene sequence disclosed in NCBI reference sequence ID NG_011709.2; NCBI gene ID: 120892), or a sequence three or fewer nucleotides away from said site: 169, 377, 864, 868, 1807, 2279, 2429, 3255, 3347, 3731, 3739, 3803, 3804, 3818, 4324, 4597, 5226, 5386, 5387, or 6839; for example, 377, 868, 1807, 3255, 3739, 3818, 4324, 5226, 5386, 5387, or 4324; for example, 868 or 3255.
[0115] 1.12. Any of the preceding compounds, wherein the antisense strand comprises a sequence complementary to or capable of hybridizing with a sequence on the LRRK2 mRNA within the hotspots identified in Table 2a.
[0116] 1.13. Any of the preceding compounds, wherein the sense and antisense nucleotide sequences have a length of 18-23 nucleotides, wherein the sequence is offset by 1, 2 or 3 nucleotides and / or one strand is 1, 2 or 3 nucleotides longer than the other strand, such that there is a protrusion at one or both ends.
[0117] 1.14. Any of the aforementioned compounds, wherein the sense strand is 19 nucleotides long and the antisense strand is 21 nucleotides long, or the sense strand is 20 nucleotides long and the antisense strand is 22 nucleotides long, or the sense strand is 21 nucleotides long and the antisense strand is 23 nucleotides long, such that the siRNA duplex has two nucleotide overhangs, for example, wherein the overhangs extend beyond the 5' end of the sense sequence, for example, as... Figure 1 What is depicted.
[0118] 1.15. Any one or both sequences of the aforementioned compounds have a phosphorylated 5' end.
[0119] 1.16. Any of the preceding compounds, wherein the siRNA duplex comprises a protrusion extending beyond the 5' end of the sense sequence by at least one nucleotide, optionally wherein the protrusion comprises two nucleotides.
[0120] 1.17. Any of the preceding compounds, wherein the RNAi agent comprises one or both sequences modified with a phosphonate ester at the 5' end.
[0121] 1.18. Any of the preceding compounds, wherein the RNAi agent comprises one or two sequences modified with off-target modifications (e.g., UNA and / or GNA), optionally wherein the modification is present between the 2nd to 8th nucleotides of the antisense sequence in the 5' to 3' direction.
[0122] 1.19. Any of the preceding compounds, wherein the RNAi agent comprises one or two sequences modified with one or more lipophilic moieties, optionally wherein the one or more lipophilic moieties are conjugated to one or more internal sites in the double-stranded region of the siRNA duplex.
[0123] 1.20. Any of the preceding compounds, wherein the RNAi agent comprises one or two sequences modified with one or more lipophilic moieties, and wherein the lipophilic moieties are conjugated to the siRNA with or without a linker or vector.
[0124] 1.21. Any of the preceding compounds, wherein one or both ends of the sense strand of the RNAi agent are modified with one or more lipophilic moieties, the lipophilic moieties being conjugated to the siRNA with or without a linker or vector.
[0125] 1.22. Any of the preceding compounds, wherein one or both ends of the sense strand of the siRNA duplex are modified with one or more lipophilic portions, the lipophilic portions being conjugated to the siRNA with or without a linker or vector, as shown in compound A and any of the following compounds.
[0126] 1.23. Any of the preceding compounds, wherein the RNAi agent comprises one or more sequences having one or more phosphate thioester bonds between nucleotides.
[0127] 1.24. Any of the preceding compounds, wherein the RNAi agent comprises one or more sequences modified by one or more non-natural and / or modified nucleotides (e.g., 2'-deoxy-2'-fluorine and / or 2'-O-methylribose modification).
[0128] 1.25. Any of the preceding compounds, wherein the RNAi agent comprises one or more sequences modified by one or more modifications described in any of paragraphs
[0053] -
[0085] .
[0129] 1.26. Any of the preceding compounds, wherein the RNAi agent is encapsulated within a delivery vector, such as lipid nanoparticles or a modified viral capsid.
[0130] 1.27. Any one of the aforementioned compounds, used as a medicine.
[0131] 1.28. Any one of the foregoing compounds, wherein said compound comprises a substance corresponding to... LRRK2 One or more sequences in a gene region that are used for treatment LRRK2 Related diseases, symptoms, or pathological conditions, such as inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), susceptibility to bacterial infections (e.g., Hansen's disease / leprosy), and / or Parkinson's disease (PD).
[0132] 1.29. Any one of the preceding compounds, wherein said compound comprises a substance corresponding to... LRRK2 One or more sequences of a gene region that are used to treat diseases, symptoms, or pathological conditions associated with elevated Lrrk2 activity, such as Crohn's disease (CD), inflammatory bowel disease (IBD), ulcerative colitis (UC), and / or Parkinson's disease (PD).
[0133] 1.30. Any one of the foregoing compounds, wherein said compound comprises a substance corresponding to... LRRK2 One or more sequences of a gene region used for treatment and LRRK2 Mutation-related diseases.
[0134] 1.31. Any one of the foregoing compounds, wherein said compound comprises a substance corresponding to... LRRK2 One or more sequences of a gene region for the treatment of conditions associated with Lrrk2 activity (e.g., enhanced Lrrk2 kinase and / or GTPase activity).
[0135] 1.32. Any one of the foregoing compounds, wherein said compound comprises a substance corresponding to... LRRK2 One or more sequences in a gene region that are used to treat Parkinson's disease or Parkinson's syndrome.
[0136] 1.33. Any one of the foregoing compounds, wherein said compound comprises a substance corresponding to... LRRK2 One or more sequences of a gene region for treating conditions associated with LRRK2 mutations, such as those selected from Parkinson's disease-related mutations, for example at one or more of positions 1371, 1437, 1441, 1699, 2019, and / or 2020, such as those selected from I1371V, N1437H, N1437D, R1441C, R1441G, R1441H, R1441S, Y1699C, G2019S, and I2020T; for example, G2019S, I2020T, R1441C, R1441G, and R1441H.
[0137] 1.34. Any one of the foregoing compounds, wherein said compound comprises a substance corresponding to... LRRK2 One or more sequences of a gene region, which are used in any of Method 2 and subsequent methods.
[0138] 1.35. Any one of the foregoing compounds, wherein said compound comprises a compound corresponding to... VEGFA One or more sequences of the gene region or the ANGPT2 gene region, wherein the antisense sequence may hybridize with sequences selected from SEQ ID: 201-220, 261-268, 272-285, 356-393 and 394-403; for example, wherein the antisense sequence comprises sequences selected from Tables 9-12 and 18-34.
[0139] 1.36. Any one of the foregoing compounds, wherein said compound comprises a compound corresponding to... VEGFA One or more sequences of the gene region or the ANGPT2 gene region, which are used in any of Method 2A and subsequent methods.
[0140] 1.37. Any of the preceding compounds, wherein the antisense sequence comprises one or more seed region modifications (nucleotides 2-8), said modifications comprising one or more of the following nucleotides: Equation 1a: in X = O, S, NH, -CONH- or -NHCO-; and B is a modified or unmodified nucleobase; R1, R2, R3 and R4 are independently H, halogen, OR5 or alkyl; and R5 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar; For example, a double-stranded siRNA containing a sense sequence and a complementary antisense sequence, wherein the antisense sequence comprises one or more nucleoside analogs of formula 1a or formula 1b, for example, wherein the antisense sequence comprises one or more nucleoside analogs selected from N3T12-027-01 and N3T12-031-01.
[0141] 1.41 Any of the preceding compounds, wherein the antisense sequence comprises one or more seed region modifications (nucleotides 2-8), said modifications comprising one or more nucleosides listed in Table B.
[0142] Table B 1.42 Any of the preceding compounds, which is a double-stranded siRNA duplex comprising a sense sequence and a complementary antisense sequence, wherein the antisense sequence comprises a nucleoside analog of formula A at the 5' end of formula A: Where B is a modified or unmodified nucleobase, and the dashed line indicates a link to the terminal phosphate ester of the oligonucleotide sequence; For example, 1.43 Any of the preceding compounds, wherein the modified siRNA is an RNA duplex comprising a sense strand and an antisense strand, wherein the sense strand comprises one or more lipophilic moieties L1 or L2, the lipophilic moieties L1 or L2 being conjugated to the siRNA via a phosphodiester bond or a thiophosphate bond, and its structure conforms to Formula 2: in X = O or S; a = 0 - 4; b = 0 - 4; c = 0-4; d=0-4; The condition is that b and d are not both 0; and the band represents a meaningful chain.
[0143] 1.44 Any of the preceding compounds, wherein the sense chain is... It meets one of the following conditions: in, R2, R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15; For example, equation 2b2: in, R2, R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0144] 1.41 Any of the preceding compounds, wherein the sense chain is... It meets one of the following conditions: Equation 2c: in, R2, R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15; in, R2, R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0145] 1.42 Any of the aforementioned compounds, wherein the sense chain is... It meets one of the following conditions: For example, equation 2e4: in, R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0146] R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; q = 0 - 10; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0147] 1.43 Any of the foregoing compounds, wherein the sense chain is... It meets one of the following conditions: For example, equation 2g1: in, R2, R3, R4, R5, R6, R7, R8, R9, R 10 and R 11 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15; Formula 2h: in, R3, R4, R5, R6, R7, R8, R9, R 10and R 11 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, -CH2O-, -OCH2-, or -SS-; Z can be O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15; The condition is that the O with a wavy line on L1 or L2 is part of a phosphodiester bond or a thiophosphate bond connected to a sense chain. in X = O or S; and the band represents a meaningful chain.
[0148] 1.44 Any of the preceding compounds, wherein the selected nucleotide is linked to a 2'-O lipid conjugate portion or an adamantyl group on the sense chain, and its structure conforms to one of the following formulas: in, R7, R8 and R9 are each independently H, a halogen or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; Y' is O, S, CH2, NH, -NHCO-, -CONH-, -CH2O-, or -SS-; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0149] 1.45 Any of the preceding compounds, wherein the selected nucleotide is linked to a 5'O-lipid conjugate portion or an adamantyl group on the sense chain, and its structure conforms to one of the following formulas: For example, equation 2j1: Wherein B is a modified or unmodified nucleobase; and the band represents a sense chain; R3, R4, R5, R6, R7, R8 and R9 are each independently H, a halogen or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups. X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, -CH2O-, -OCH2-, or -SS-; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0150] 1.46 Any of the preceding compounds, wherein the sense chain is... It meets one of the following conditions: in, Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0151] 1.47 Any of the preceding compounds, wherein the sense chain is... It meets one of the following conditions: For example, equation 2n2: Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; q = 1 - 10; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0152] For example: in X = O or S; and the banded structure represents a meaningful chain. Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; q = 0 - 10; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0153] 1.50 Any one of the aforementioned compounds, wherein the sense chain is... It meets one of the following conditions: Equation 2p: in, Y is O, S, NH or CH2; p=0-10, q = 0 - 10; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0154] 1.51 Any of the preceding compounds, wherein the sense chain is... It meets one of the following conditions: in, Y is O, S, NH or CH2; p=0-10, q = 0 - 10; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0155] 1.52 Any of the aforementioned compounds, wherein the sense chain is... It meets one of the following conditions: in, Y is O, S, NH or CH2; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0156] 1.53 Any of the aforementioned compounds, wherein the sense chain is... It meets one of the following conditions: Equation 2s: in, Y is O, S, NH or CH2; p = 0-10, for example 0-2; q = 0-10, for example 1-2; n = 0-10; m = 1-30, for example 11-21, for example 13-17; for example 15.
[0157] 1.54 Any of the preceding compounds, wherein one or both ends of the sense strand of the siRNA duplex are modified with one or more lipophilic moieties, said lipophilic moieties comprising one or more of the following structures: Equation 2t1: in, R 12 and R 13 Each is independently selected from H, halogens, and C1-C6 alkyl groups optionally substituted with one or more halogens and / or hydroxyl groups; "Y" can be O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; r = 1-10, for example 1-3; s = 1-10, for example 1-3; t=1-10; u=0-3; m = 0-5; n = 1 - 30; o=1-5.
[0158] 1.55 Any of the preceding compounds, wherein one or both ends of the sense strand of the siRNA duplex are modified with one or more lipophilic moieties, the lipophilic moieties comprising one or more of the following structures: Equation 2u: in, R 12 and R 13 Each is independently selected from H, halogens, and C1-C6 alkyl groups optionally substituted with one or more halogens and / or hydroxyl groups; "Y" can be O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; Y”' is O, S, CH2, NH, -NHCO-, -CONH- or -SS-; r = 1-10, for example 1-3; s = 1-10, for example 1-3; t=1-10; u=0-3; m = 0-5; n = 1 - 30; o=1-5.
[0159] 1.56 Any of the preceding compounds, wherein one or both ends of the sense strand of the siRNA duplex are modified with one or more lipophilic moieties, said lipophilic moieties comprising one or more of the following structures: in, X = O or S; and the band represents the sense strand or antisense oligonucleotide (ASO) of the siRNA.
[0160] 1.57 Any of the preceding compounds, wherein one or both ends of the sense strand of the siRNA duplex are modified with one or more lipophilic moieties, said lipophilic moieties comprising one or more of the following structures: 1.58 Any of the aforementioned compounds, used in any of method 2 and thereafter, method 2A and thereafter, method 4 and thereafter, and / or method 6 and thereafter.
[0161] This disclosure also provides pharmaceutical compositions comprising any one of compound 1 and subsequent compounds, compound 3 and subsequent compounds, and / or compound 5 and subsequent compounds, in combination or in conjunction with a pharmaceutically acceptable diluent or carrier, for example, wherein the compositions are formulated for administration via intravascular, subcutaneous, intramuscular, intraperitoneal, intracerebral, intraventricular, or intrathecal injection, for example, comprising a delivery medium, such as lipid nanoparticles or viral capsid formulations, for example, for any one of method 2 and subsequent methods, method 2A and subsequent methods, method 4 and subsequent methods, and / or method 6 and subsequent methods.
[0162] This disclosure also provides a method (method 2) for treating a disease or condition characterized by excessive activity or overexpression of Lrrk2 (including excessive activity or overexpression of an aberrant form of Lrrk2), said method comprising administering to a patient in need an effective amount of a substance containing a substance corresponding to Lrrk2. LRRK2 RNAi agents of one or more sequences of a gene, such as compounds selected from compound 1 and any of the following compounds.
[0163] For example, in a specific implementation, this disclosure provides: 2.1. Method 2, wherein the patient is a human being.
[0164] 2.2. Any of the foregoing methods includes the use or application of any one of compound 1 and subsequent compounds, compound 3 and subsequent compounds, and / or compound 5 and subsequent compounds.
[0165] 2.3. Any of the aforementioned methods, wherein the patient has been diagnosed with LRRK2 - Related diseases, symptoms, or pathological conditions, such as inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), susceptibility to bacterial infections (e.g., Hansen's disease / leprosy), and / or Parkinson's disease (PD).
[0166] 2.4. Any of the foregoing methods, wherein the disease or condition is selected from inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), susceptibility to bacterial infections (such as Hansen's disease / leprosy) and / or Parkinson's disease (PD).
[0167] 2.5. Any of the foregoing methods, wherein the disease or condition is selected from Crohn's disease (CD), inflammatory bowel disease (IBD), ulcerative colitis (UC), and Parkinson's disease (PD).
[0168] 2.6. Any of the foregoing methods, wherein the disease or symptom is related to LRRK2 It is related to mutations.
[0169] 2.7. Any of the foregoing methods, wherein the disease or condition is related to Lrrk2 activity (e.g., enhanced Lrrk2 kinase and / or GTPase activity).
[0170] 2.8. Any of the foregoing methods, wherein the disease or condition is Parkinson's disease or Parkinson's syndrome.
[0171] 2.9. Any of the foregoing methods, wherein the disease or condition is associated with an LRRK2 mutation, such as a mutation selected from those associated with Parkinson's disease, such as at one or more of positions 1371, 1437, 1441, 1699, 2019 and / or 2020, such as those selected from I1371V, N1437H, N1437D, R1441C, R1441G, R1441H, R1441S, Y1699C, G2019S and I2020T; for example, G2019S, I2020T, R1441C, R1441G and R1441H.
[0172] 2.10. Any of the foregoing methods, wherein the disease or condition has symptoms associated with Parkinson's disease, such as one or more selected from loss of motor function, tremor, loss of balance and coordination, rigidity, bradykinesia, ataxia, speech changes, protein aggregate formation, cognitive decline, neuropathy and / or neuronal death.
[0173] 2.11. Any of the foregoing methods, wherein the compound is administered by intravascular, subcutaneous, intramuscular, intraperitoneal, intracerebral, intraventricular, or intrathecal injection.
[0174] 2.12. Any of the foregoing methods, wherein the compound is administered at a dose of about 0.01 mg / kg to about 50 mg / kg.
[0175] 2.13. Any of the foregoing methods, wherein the compound is delivered to the patient's cerebrospinal fluid in an effective amount via intracerebral, intraventricular, or intrathecal injection.
[0176] 2.14. Any of the foregoing methods, wherein the compound is delivered to the patient’s cerebrospinal fluid in an effective amount by intracerebral, intraventricular or intrathecal injection; for example, wherein the compound is delivered in an amount that is effective in the cerebrospinal fluid at a concentration of at least 0.01 nM, such as at least 0.1 nM, such as at least 1 nM.
[0177] This disclosure also provides a method (method 2A) for treating a disease or condition characterized by or dependent on angiogenesis or lymphangiogenesis, comprising administering to a patient in need an effective amount of a compound or antisense oligonucleotide (ASO) that is a double-stranded siRNA duplex comprising a sense sequence and a complementary antisense sequence, wherein the compound comprises a sequence corresponding to a sense sequence and a complementary antisense sequence. VEGFA or ANGPT2 One or more sequences in a gene region, wherein the siRNA duplex or ASO effectively and significantly reduces VEGFA or ANGPT2 mRNA in cells.
[0178] For example, in a specific implementation, this disclosure provides: 2A.1. Method 2A, wherein the patient is a person.
[0179] 2A.2. Any of the foregoing methods includes the use or application of any one of compound 1 and subsequent compounds, compound 3 and subsequent compounds, and / or compound 5 and subsequent compounds.
[0180] 2A.3. Any of the foregoing methods, wherein the compound comprises a lipophilic moiety modification, an off-target modification, or a modification as described in any of the foregoing embodiments, for example, wherein the antisense sequence is capable of hybridizing with sequences selected from SEQ ID: 201-220, 261-268, 272-285, 356-393, and 394-403; for example, wherein the antisense sequence comprises sequences selected from Tables 9-12 and 18-34.
[0181] 2A.4. Any of the foregoing methods, wherein the RNAi agent effectively and significantly reduces angiogenesis or lymphangiogenesis.
[0182] 2A.5. Any of the foregoing methods, wherein the disease or condition is cancer or neovascularization of the eye.
[0183] 2A.6. Any of the foregoing methods, wherein the disease or condition is selected from metastatic colorectal cancer, cervical cancer, endometrial cancer, non-small cell lung cancer, glioblastoma, metastatic hepatocellular carcinoma, metastatic renal cell carcinoma, ovarian cancer, primary peritoneal cancer, and fallopian tube cancer.
[0184] 2A.7. Any of the foregoing methods, wherein the disease or condition is selected from neovascular (wet) age-related macular degeneration (AMD), macular edema following retinal vein occlusion, diabetic macular edema, diabetic retinopathy, and myopic choroidal neovascularization.
[0185] 2A.8. Any of the foregoing methods, wherein the disease or condition is characterized by overactivation or overexpression of Vegf-A and / or Angpt-2 (including overactivation or overexpression of aberrant forms of Vegf-A and / or Angpt-2).
[0186] This disclosure also provides the use of any of Compound 1 and subsequent compounds in the manufacture or preparation of a medicament for use in any of Method 2 and subsequent methods, Method 2A and subsequent methods, Method 4 and subsequent methods, and / or Method 6 and subsequent methods.
[0187] In another embodiment, this disclosure therefore provides an RNAi agent that comprises a lipophilic moiety, such as a lipid moiety, such as an alkyl or alkenyl group, at one or both ends of the sense strand or at any location within the sense strand. 12-22 Alkyl or alkenyl (compound 3); for example, a double-stranded siRNA duplex containing a sense sequence and a complementary antisense sequence, wherein the duplex contains a lipophilic moiety, such as a lipid moiety, such as an alkyl or alkenyl group, such as C 12-22 Alkyl or alkenyl groups.
[0188] For example, in a specific implementation, this disclosure provides: 3.1. Compound 3, wherein the lipophilic portion, such as the lipid portion, effectively increases the targeting of the compound to the central nervous system.
[0189] 3.2. Any of the aforementioned compounds, comprising one or more of compound 1 and subsequent compounds and / or a portion of compound 5 and subsequent compounds.
[0190] 3.3. Any of the aforementioned compounds, wherein the compound provides at least 70% mRNA knockdown activity at 10 nM in a cell-based assay.
[0191] 3.4. Any of the aforementioned compounds, wherein the compound provides at least 70% mRNA knockdown activity at 1 nM in a cell-based assay.
[0192] 3.5. Any of the aforementioned compounds, wherein the compound provides at least 70% mRNA knockdown activity at 0.1 nM in a cell-based assay.
[0193] 3.6. Any of the aforementioned compounds, wherein the compound provides at least 70% mRNA knockdown activity at 0.01 nM in a cell-based assay.
[0194] 3.7. Any of the aforementioned compounds, wherein the siRNA duplex or ASO comprises a sequence complementary to a disease-related gene.
[0195] 3.8. Any of the aforementioned compounds, wherein the siRNA duplex or ASO comprises a sequence complementary to a gene associated with a central nervous system disease (e.g., Parkinson's disease).
[0196] 3.9. Any of the aforementioned compounds, wherein the RNAi agent comprises, LRRK2 Complementary sequences, for example a. Any of the aforementioned compounds, wherein the sense or antisense strand comprises a sequence selected from any one of SEQ ID NO. 1-403; for example, the duplexes shown in Tables 1-34, such as Tables 1, 4, 5, 7, 13, 20, 22, 26 and / or 30; for example, the duplexes shown in Table 1, except N3T130025-01.
[0197] b. Any of the aforementioned compounds, wherein the meaningful sequence comprises a sequence selected from SEQ ID NO: 1, 3, 45, 51, 67, 69, 109, 113, 191 and 193.
[0198] c. Any of the aforementioned compounds, wherein the antisense sequence comprises a sequence selected from SEQ ID NO: 2, 4, 46, 52, 68, 70, 110, 114, 192 and 194.
[0199] d. Any of the aforementioned compounds, used for the treatment of LRRK2 Related diseases, symptoms, or pathological conditions, such as inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), susceptibility to bacterial infections (e.g., Hansen's disease / leprosy), and / or Parkinson's disease (PD).
[0200] e. Any of the foregoing compounds used to treat diseases, symptoms, or pathological conditions associated with elevated Lrrk2 activity, such as Crohn's disease (CD), inflammatory bowel disease (IBD), ulcerative colitis (UC), and / or Parkinson's disease (PD).
[0201] f. Any of the aforementioned compounds, used for the treatment of and LRRK2 Mutation-related diseases.
[0202] g. Any of the aforementioned compounds, used to treat conditions associated with Lrrk2 activity (e.g., enhanced Lrrk2 kinase and / or GTPase activity).
[0203] h. Any of the aforementioned compounds, used to treat Parkinson's disease or Parkinson's syndrome.
[0204] i. Any of the foregoing compounds for treating a condition associated with an LRRK2 mutation, said LRRK2 mutation being selected, for example, from mutations associated with Parkinson's disease, for example at one or more of positions 1371, 1437, 1441, 1699, 2019 and / or 2020, for example selected from I1371V, N1437H, N1437D, R1441C, R1441G, R1441H, R1441S, Y1699C, G2019S and I2020T; for example, G2019S, I2020T, R1441C, R1441G and R1441H.
[0205] j. Any of the aforementioned compounds, used in method 2 and any of the subsequent methods.
[0206] k. Any of the aforementioned compounds, used in method 4 and any of the subsequent methods.
[0207] 1. Any of the aforementioned compounds, used in method 6 and any of the subsequent methods.
[0208] 3.10. Any of the foregoing compounds, wherein the RNAi agent comprises one or more sequences corresponding to a region of the VEGFA gene or the ANGPT2 gene, for example, any of the foregoing compounds, wherein the RNAi agent comprises one or more antisense sequences that can hybridize with one or more sequences selected from SEQ ID: 201-220, 261-268, 272-285, 356-393 and 394-403; for example, wherein the antisense sequence comprises sequences selected from Tables 9-12 and 18-34; for example, for any of Method 2A and subsequent methods.
[0209] 3.11. Any of the aforementioned compounds, wherein the sense and antisense nucleotide sequences have a length of 18-23 nucleotides, wherein the sequence is offset by 1, 2 or 3 nucleotides and / or one strand is 1, 2 or 3 nucleotides longer than the other strand, such that there are protrusions at one or both ends.
[0210] 3.12. Any of the aforementioned compounds, which is a siRNA duplex, wherein the sense and antisense nucleotide sequences have a length of 15-30 nucleotides, and wherein the sequences have blunt ends at one or both ends of the siRNA duplex.
[0211] 3.13. Any of the aforementioned compounds, wherein the sense strand is 19 nucleotides long and the antisense strand is 21 nucleotides long, or the sense strand is 20 nucleotides long and the antisense strand is 22 nucleotides long, or the sense strand is 21 nucleotides long and the antisense strand is 23 nucleotides long, such that the siRNA duplex has two nucleotide overhangs, for example, wherein the overhangs extend beyond the 5' end of the sense sequence, for example, as... Figure 1 What is depicted.
[0212] 3.14. Any one or both sequences of the aforementioned compounds have a phosphorylated 5' end.
[0213] 3.15. Any of the preceding compounds, wherein the siRNA duplex comprises a protruding end of at least one nucleotide extending beyond the 5' end of the sense sequence, optionally wherein the protruding end comprises two nucleotides.
[0214] 3.16. Any of the preceding compounds, wherein the siRNA duplex comprises one or both sequences modified with a phosphonate ester at the 5' end.
[0215] 3.17. Any of the preceding compounds, wherein the siRNA duplex comprises one or both sequences modified by off-target modification (e.g., UNA and / or GNA), optionally wherein the modification is present between nucleotides 2-8 of the antisense sequence in the 5' to 3' direction.
[0216] 3.18. Any of the preceding compounds, wherein the RNAi agent comprises one or two sequences modified with one or more lipophilic moieties, optionally wherein the one or more lipophilic moieties are conjugated to one or more internal sites in the double-stranded region of the siRNA duplex.
[0217] 3.19. Any of the preceding compounds, wherein the siRNA duplex comprises one or two sequences modified with one or more lipophilic moieties, and wherein the one or more lipophilic moieties are conjugated to the siRNA with or without a linker or vector.
[0218] 3.20. Any of the preceding compounds, wherein one or both ends of the sense strand of the RNAi agent are modified with one or more lipophilic moieties, the lipophilic moieties being conjugated to the siRNA with or without a linker or vector.
[0219] 3.21. Any of the preceding compounds, wherein one or both ends of the sense strand of the siRNA duplex are modified with one or more lipophilic portions, the lipophilic portions being conjugated to the siRNA with or without a linker or vector, as shown in compound A and any of the following compounds.
[0220] 3.22. Any of the preceding compounds, wherein the siRNA duplex comprises one or more sequences having one or more thiophosphate bonds between nucleotides.
[0221] 3.23. Any of the preceding compounds, wherein the siRNA duplex comprises one or more sequences modified by one or more non-natural and / or modified nucleotides (e.g., 2'-deoxy-2'-fluorine and / or 2'-O-methylribose modification).
[0222] 3.24. Any of the preceding compounds, wherein the siRNA duplex comprises one or more sequences modified by one or more modifications described in any of paragraphs
[0053] -
[0085] .
[0223] 3.25. Any of the preceding compounds, wherein the construct comprises one or more sequence modifications selected from the group consisting of: phosphorylated 5' end, 3' end overhang, phosphonic 5' end, UNA and / or GNA motif, lipophilic motif, thiophosphate bond, modified nucleotide (such as 2'-deoxy-2'-fluoro and / or 2'-O-methylribose), and combinations thereof.
[0224] 3.26. Any of the preceding compounds is a modified siRNA duplex comprising a sense strand and an antisense strand, wherein the sense strand comprises one or more lipophilic moieties L1, the lipophilic moieties L1 being conjugated to one or both ends of the sense strand of the siRNA via a phosphodiester bond or a thiophosphate bond (e.g., via a ribosyl moieties linked to a phosphodiester bond or a thiophosphate bond), as shown, for example, as in compound A and any of the following compounds.
[0225] 3.27. Any of the preceding compounds, wherein the RNAi agent is encapsulated within a delivery vector, such as lipid nanoparticles or a modified viral capsid.
[0226] 3.28. Any one of the aforementioned compounds, used as a medicine.
[0227] 3.29. Any of the preceding compounds comprises one or more of the following: formula 2i (e.g., formula 2i1 and 2i2), formula 2j (e.g., formula 2j1 and 2j2), formula 2k (e.g., formula 2k1 and 2k2), formula 2l (e.g., 2l1 and 2l2), formula 2m (e.g., formula 2m1 and 2m2), formula 2n (e.g., 2n1 and 2n2), formula 2o (e.g., 2o1 and 2o2), formula 2p (e.g., 2p', 2p”, 2p1, 2p2, and 2p3), formula 2q (e.g., 2q', 2q”, 2q1, 2q2, and 2q3), formula 2r (e.g., formula 2r1, 2r2, and 2r3), formula 2s1 (e.g., 2s1, 2s2, and 2s3), formula 2t (e.g., 2t1, 2t2, and 2t3), and / or formula 2u (e.g., 2u1, 2u2, and 2u3).
[0228] 3.30. Any one of the foregoing compounds, comprising one or more of the following structures: in, X = O or S; and the band represents the sense strand or antisense oligonucleotide (ASO) of the siRNA.
[0229] This disclosure further provides a method (method 4) for delivering an RNAi agent containing a lipophilic moiety (e.g., a compound of compound 3) to a patient in need of such delivery.
[0230] For example, in a specific implementation, this disclosure provides: 4.1. Method 4, wherein the patient is a human being.
[0231] 4.2. Any of the foregoing methods includes delivering compound 1 and subsequent compounds, and / or compound 3 and subsequent compounds, and / or compound 5 and subsequent compounds.
[0232] 4.3. Any of the foregoing methods, wherein the patient has been diagnosed with LRRK2 Related diseases, symptoms, or pathological conditions, such as inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), susceptibility to bacterial infections (e.g., Hansen's disease / leprosy), and / or Parkinson's disease (PD), for example, the siRNA or ASO contained in the siRNA or ASO containing a corresponding siRNA or ASO. LRRK2 One or more sequences in a region of a gene.
[0233] 4.4. Any of the foregoing methods, wherein the disease or condition is selected from inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), susceptibility to bacterial infections (such as Hansen's disease / leprosy) and / or Parkinson's disease (PD).
[0234] 4.5. Any of the foregoing methods, wherein the disease or condition is selected from Crohn's disease (CD), inflammatory bowel disease (IBD), ulcerative colitis (UC), and Parkinson's disease (PD).
[0235] 4.6. Any of the foregoing methods, wherein the disease or symptom is related to LRRK2 It is related to mutations.
[0236] 4.7. Any of the foregoing methods, wherein the disease or condition is related to Lrrk2 activity (e.g., enhanced Lrrk2 kinase and / or GTPase activity).
[0237] 4.8. Any of the foregoing methods, wherein the disease or condition is Parkinson's disease or Parkinson's syndrome.
[0238] 4.9. Any of the foregoing methods, wherein the disease or condition is associated with an LRRK2 mutation, such as a mutation selected from those associated with Parkinson's disease, such as at one or more of positions 1371, 1437, 1441, 1699, 2019 and / or 2020, such as those selected from I1371V, N1437H, N1437D, R1441C, R1441G, R1441H, R1441S, Y1699C, G2019S and I2020T; for example, G2019S, I2020T, R1441C, R1441G and R1441H.
[0239] 4.10. Any of the foregoing methods, wherein the disease or condition has symptoms associated with Parkinson's disease, such as one or more selected from loss of motor function, tremor, loss of balance and coordination, rigidity, bradykinesia, ataxia, speech changes, protein aggregate formation, cognitive decline, neuropathy and / or neuronal death.
[0240] 4.11. Any of the foregoing methods, wherein the compound is administered by intravascular, subcutaneous, intramuscular, intraperitoneal, intracerebral, intraventricular, or intrathecal injection.
[0241] 4.12. Any of the foregoing methods, wherein the compound is administered at a dose of about 0.01 mg / kg to about 50 mg / kg.
[0242] 4.13. Any of the foregoing methods, wherein the compound is delivered to the patient's cerebrospinal fluid in an effective amount via intracerebral, intraventricular, or intrathecal injection.
[0243] 4.14. Any of the foregoing methods, wherein the compound is delivered to the patient’s cerebrospinal fluid in an effective amount by intracerebral, intraventricular or intrathecal injection; for example, wherein the compound is delivered in an amount that is effective in the cerebrospinal fluid at a concentration of at least 0.01 nM, such as at least 0.1 nM, such as at least 1 nM.
[0244] 4.15. Any of the foregoing methods, wherein the compound is a double-stranded siRNA duplex or an antisense oligonucleotide (ASO), the double-stranded siRNA duplex comprising a sense sequence and a complementary antisense sequence, wherein the sequence corresponds to a VEGFA or ANGPT2 gene region, wherein the RNAi agent effectively and significantly reduces VEGFA or ANGPT2 mRNA in cells [e.g., according to any one of Compound 1 and thereafter, Compound 3 and thereafter, Compound 5 and thereafter described above]; for example, a compound comprising a lipophilic moiety modification, an off-target modification, or a modification as described in any of the foregoing embodiments; for example, wherein the antisense sequence is hybridizable to sequences selected from SEQ ID: 201-220, 261-268, 272-285, 356-393, and 394-403; for example, wherein the antisense sequence comprises sequences selected from Tables 9-12 and 18-34.
[0245] 4.16. Any of the foregoing methods that are methods for reducing VEGFA and / or ANGPT2 gene expression in cells, comprising introducing a double-stranded siRNA duplex or an antisense oligonucleotide (ASO) into the cells, the double-stranded siRNA duplex comprising a sense sequence and a complementary antisense sequence, wherein the sequence corresponds to a VEGFA or ANGPT2 gene region, wherein the siRNA duplex or ASO effectively and significantly reduces VEGFA or ANGPT2 mRNA in the cells; for example, methods for inhibiting angiogenesis or treating diseases or conditions associated with VEGFA and / or ANGPT2 gene expression, comprising administering an effective amount of an RNAi agent or a pharmaceutical composition thereof; for example, wherein the disease or condition is cancer or ocular neovascularization, for example, wherein the disease or condition is selected from metastatic colorectal cancer, cervical cancer, endometrial cancer, non-small cell lung cancer, glioblastoma, metastatic hepatocellular carcinoma, metastatic renal cell carcinoma, ovarian cancer, primary peritoneal cancer, and fallopian tube cancer, or wherein the disease or condition is selected from neovascular (wet) age-related cancers. The method comprises administering to a patient in need an effective amount of an RNAi agent or pharmaceutical composition thereof containing one or more sequences corresponding to the VEGFA or ANGPT2 gene regions. The disease or condition is characterized by excessive activity or overexpression of Vegf-A and / or Angpt-2 (including aberrant forms of excessive activity or overexpression of Vegf-A and / or Angpt-2).
[0246] This disclosure also provides the use of any of compound 3 and subsequent compounds in the manufacture or preparation of a medicament for use in any of method 2 and subsequent methods, method 2A and subsequent methods, method 4 and subsequent methods, and / or method 6 and subsequent methods.
[0247] In another embodiment, this disclosure therefore provides small interfering ribonucleic acid (siRNA) or antisense oligonucleotide (ASO) that contains one or more off-target modifications, such as modifications that effectively reduce off-target effects (compound 5), at one or both ends of the sense strand or antisense strand or at any position of the sense strand or antisense strand.
[0248] For example, in a specific implementation, this disclosure provides: 5.1. Compound 5, wherein off-target modifications effectively reduce off-target effects or related symptoms, such as the side effects of siRNA therapeutics.
[0249] 5.2. Any of the aforementioned compounds, comprising one or more portions of compound 1 and subsequent compounds and / or compound 3 and subsequent compounds.
[0250] 5.3. Any of the aforementioned compounds, wherein the compound provides at least 70% mRNA knockdown activity at 10 nM in a cell-based assay.
[0251] 5.4. Any of the aforementioned compounds, wherein the compound provides at least 70% mRNA knockdown activity at 1 nM in a cell-based assay.
[0252] 5.5. Any of the aforementioned compounds, wherein the compound provides at least 70% mRNA knockdown activity at 0.1 nM in a cell-based assay.
[0253] 5.6. Any of the aforementioned compounds, wherein the compound provides at least 70% mRNA knockdown activity at 0.01 nM in a cell-based assay.
[0254] 5.7. Any of the aforementioned compounds, which is a double-stranded siRNA containing a sequence complementary to a disease-related gene, such as a central nervous system disease, like Parkinson's disease, and the disease-related gene being, for example... LRRK2 .
[0255] 5.8. Any of the aforementioned compounds is a double-stranded siRNA containing a sense sequence and a complementary antisense sequence, wherein the double-stranded siRNA contains off-target modifications, such as modifications that effectively reduce off-target effects, at one or both ends of the sense strand or antisense strand or at any position in the sense strand or antisense strand.
[0256] 5.9. Any of the aforementioned compounds, which is a siRNA duplex, wherein the sense and antisense nucleotide sequences have a length of 15-30 nucleotides, and wherein the sequences have blunt ends at one or both ends of the siRNA duplex.
[0257] 5.10. Any of the foregoing compounds wherein the sense or antisense strand comprises a sequence selected from any one of SEQ ID NO. 1-403; for example, the duplexes shown in Tables 1-34, such as the duplexes shown in Tables 1, 4, 5, 7, 13, 20, 22, 26 and / or 30; for example, the duplexes shown in Table 1, except N3T130025-01.
[0258] 5.11. Any of the aforementioned compounds, wherein the sense or antisense strand comprises a sequence selected from any one of SEQ ID NO. 261-273 or 314-403.
[0259] 5.12. Any of the aforementioned compounds, wherein the meaningful sequence comprises a sequence selected from SEQ ID NO: 1, 3, 45, 51, 67, 69, 109, 113, 191 and 193.
[0260] 5.13. Any of the aforementioned compounds, wherein the antisense sequence comprises a sequence selected from SEQ ID NO: 2, 4, 46, 52, 68, 70, 110, 114, 192 and 194.
[0261] 5.14. Any of the aforementioned compounds, wherein the sense and antisense nucleotide sequences have a length of 18-23 nucleotides, wherein the sequence is offset by 1, 2 or 3 nucleotides and / or one strand is 1, 2 or 3 nucleotides longer than the other strand, such that there is a protrusion at one or both ends.
[0262] 5.15. Any of the aforementioned compounds, wherein the sense strand is 19 nucleotides long and the antisense strand is 21 nucleotides long, or the sense strand is 20 nucleotides long and the antisense strand is 22 nucleotides long, or the sense strand is 21 nucleotides long and the antisense strand is 23 nucleotides long, such that the siRNA duplex has two nucleotide overhangs, for example, wherein the overhangs extend beyond the 5' end of the sense sequence, for example, as... Figure 1 What is depicted.
[0263] 5.16. Any one or both sequences of the aforementioned compounds have a phosphorylated 5' end.
[0264] 5.17. Any of the preceding compounds, wherein the siRNA duplex comprises a protrusion extending beyond the 5' end of the sense sequence by at least one nucleotide, optionally wherein the protrusion comprises two nucleotides.
[0265] 5.18. Any of the preceding compounds, wherein the siRNA duplex comprises one or both sequences modified with a phosphonate ester at the 5' end.
[0266] 5.19. Any of the preceding compounds, wherein the siRNA duplex comprises one or both sequences modified with off-target modifications such as UNA and / or GNA, optionally wherein the modification is present between nucleotides 2-8 of the antisense sequence in the 5' to 3' direction, for example, wherein the modification is present between nucleotides 5-7 of the antisense sequence in the 5' to 3' direction, for example, wherein the modification is present at nucleotide 5 of the antisense sequence in the 5' to 3' direction, for example, wherein the modification is present at nucleotide 7 of the antisense sequence in the 5' to 3' direction.
[0267] 5.20. Any of the preceding compounds, wherein the siRNA duplex comprises one or two sequences modified by one or more lipophilic moieties, optionally wherein the one or more lipophilic moieties are conjugated to one or more internal sites in the double-stranded region of the siRNA duplex.
[0268] 5.21. Any of the preceding compounds, wherein the siRNA duplex comprises one or two sequences modified with one or more lipophilic moieties, and wherein the lipophilic moieties are conjugated to the siRNA with or without a linker or vector.
[0269] 5.22. Any of the preceding compounds, wherein the siRNA duplex comprises one or two sequences modified by one or more off-target modifications, and wherein the off-target modifications are conjugated to the siRNA with or without a linker or vector.
[0270] 5.23. Any of the preceding compounds, wherein one or both ends of the sense strand and / or antisense strand of the siRNA duplex are modified with one or more lipophilic moieties, the lipophilic moieties being conjugated to the siRNA with or without a linker or vector.
[0271] 5.24. Any of the preceding compounds, wherein one or both ends of the sense strand and / or antisense strand of the siRNA duplex are modified with one or more off-target modifications, the off-target modifications being conjugated to the siRNA with or without a linker or vector.
[0272] 5.25. Any of the preceding compounds, wherein one or both ends of the sense strand and / or antisense strand of the siRNA duplex are modified with one or more lipophilic moieties, which are conjugated to the siRNA with or without a linker or vector, as shown in compound A and any of the following compounds.
[0273] 5.26. Any of the preceding compounds, wherein one or both ends of the sense strand and / or antisense strand of the siRNA duplex are modified with one or more off-target modifications, the off-target modifications being conjugated to the siRNA with or without a linker or vector, as shown in compound A and any of the following compounds.
[0274] 5.27. Any of the preceding compounds, wherein the siRNA duplex comprises one or more sequences having one or more thiophosphate bonds between nucleotides.
[0275] 5.28. Any of the preceding compounds, wherein the siRNA duplex comprises one or more sequences modified by one or more non-natural and / or modified nucleotides (e.g., 2'-deoxy-2'-fluorine and / or 2'-O-methylribose modification).
[0276] 5.29. Any of the preceding compounds, wherein the siRNA duplex comprises one or more sequences modified by one or more modifications described in any of paragraphs
[0053] -
[0085] .
[0277] 5.30. Any of the preceding compounds, wherein the RNAi agent is encapsulated within a delivery vector, such as lipid nanoparticles or a modified viral capsid.
[0278] 5.31. Any one of the aforementioned compounds, used as a drug.
[0279] 5.32. Any one of the aforementioned compounds, used for the treatment of LRRK2 Related diseases, symptoms, or pathological conditions, such as inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), susceptibility to bacterial infections (e.g., Hansen's disease / leprosy), and / or Parkinson's disease (PD).
[0280] 5.33. Any of the preceding compounds, used to treat diseases, symptoms or pathological conditions associated with elevated Lrrk2 activity, such as Crohn's disease (CD), inflammatory bowel disease (IBD), ulcerative colitis (UC) and / or Parkinson's disease (PD).
[0281] 5.34. Any one of the aforementioned compounds, used for the treatment of and LRRK2 Mutation-related diseases.
[0282] 5.35. Any of the foregoing compounds, used to treat conditions associated with Lrrk2 activity (e.g., enhanced Lrrk2 kinase and / or GTPase activity).
[0283] 5.36. Any of the aforementioned compounds, used to treat Parkinson's disease or Parkinson's syndrome.
[0284] 5.37. Any of the foregoing compounds, used to treat a condition associated with an LRRK2 mutation, said LRRK2 mutation being selected, for example, from mutations associated with Parkinson's disease, for example at one or more of positions 1371, 1437, 1441, 1699, 2019 and / or 2020, for example selected from I1371V, N1437H, N1437D, R1441C, R1441G, R1441H, R1441S, Y1699C, G2019S and I2020T; for example, G2019S, I2020T, R1441C, R1441G and R1441H.
[0285] 5.38. Any of the aforementioned compounds, used in method 2 and any of the subsequent methods.
[0286] 5.39. Any of the aforementioned compounds, used in method 4 and any of the subsequent methods.
[0287] 5.40. Any of the aforementioned compounds, used in method 6 and any of the subsequent methods.
[0288] 5.41. Any of the aforementioned compounds, comprising one or more portions of Tables 20, 22, 24, 26, 28, 30 and / or 32.
[0289] 5.42. Any of the foregoing compounds, wherein the RNAi agent comprises one or more sequences corresponding to the VEGFA gene or ANGPT2 gene region, such as any of the foregoing compounds, wherein the RNAi agent comprises one or more antisense sequences that can hybridize with one or more sequences selected from SEQ ID: 201-220, 261-268, 272-285, 356-393 and 394-403; for example, wherein the antisense sequence comprises sequences selected from Tables 9-12 and 18-34; for example, for any of Method 2A and subsequent methods.
[0290] This disclosure also provides a method (method 6) for delivering to patients in need a small interfering RNA (siRNA) or antisense oligonucleotide (ASO) containing off-target modifications (e.g., the compound of compound 5).
[0291] For example, in a specific implementation, this disclosure provides: 6.1. Method 6, wherein the patient is a human being.
[0292] 6.2. Any of the foregoing methods comprising delivering compound 1 and subsequent compounds, and / or compound 3 and subsequent compounds, and / or compound 5 and subsequent compounds.
[0293] 6.3. Any of the foregoing methods, wherein the patient has been diagnosed with LRRK2 - Related diseases, symptoms, or pathological conditions, such as inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), susceptibility to bacterial infections (e.g., Hansen's disease / leprosy), and / or Parkinson's disease (PD).
[0294] 6.4. Any of the foregoing methods, wherein the disease or condition is selected from inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), susceptibility to bacterial infections (such as Hansen's disease / leprosy) and / or Parkinson's disease (PD).
[0295] 6.5. Any of the foregoing methods, wherein the disease or condition is selected from Crohn's disease (CD), inflammatory bowel disease (IBD), ulcerative colitis (UC), and Parkinson's disease (PD).
[0296] 6.6. Any of the foregoing methods, wherein the disease or symptom is related to LRRK2 It is related to mutations.
[0297] 6.7. Any of the foregoing methods, wherein the disease or condition is related to Lrrk2 activity (e.g., enhanced Lrrk2 kinase and / or GTPase activity).
[0298] 6.8. Any of the foregoing methods, wherein the disease or condition is Parkinson's disease or Parkinson's syndrome.
[0299] 6.9. Any of the foregoing methods, wherein the disease or condition is associated with an LRRK2 mutation, such as a mutation selected from those associated with Parkinson's disease, such as at one or more of positions 1371, 1437, 1441, 1699, 2019 and / or 2020, such as those selected from I1371V, N1437H, N1437D, R1441C, R1441G, R1441H, R1441S, Y1699C, G2019S and I2020T; for example, G2019S, I2020T, R1441C, R1441G and R1441H.
[0300] 6.10. Any of the foregoing methods, wherein the disease or condition has symptoms associated with Parkinson's disease, such as one or more selected from loss of motor function, tremor, loss of balance and coordination, rigidity, bradykinesia, ataxia, speech changes, protein aggregate formation, cognitive decline, neuropathy and / or neuronal death.
[0301] 6.11. Any of the foregoing methods, wherein the compound is administered by intravascular, subcutaneous, intramuscular, intraperitoneal, intracerebral, intraventricular, or intrathecal injection.
[0302] 6.12. Any of the foregoing methods, wherein the compound is administered at a dose of about 0.01 mg / kg to about 50 mg / kg.
[0303] 6.13. Any of the foregoing methods, wherein the compound is delivered to the patient's cerebrospinal fluid in an effective amount via intracerebral, intraventricular, or intrathecal injection.
[0304] 6.14. Any of the foregoing methods, wherein the compound is delivered to the patient’s cerebrospinal fluid in an effective amount by intracerebral, intraventricular or intrathecal injection; for example, wherein the compound is delivered in an amount that is effective in the cerebrospinal fluid at a concentration of at least 0.01 nM, such as at least 0.1 nM, such as at least 1 nM.
[0305] 6.15. Any of the foregoing methods, wherein the compound is a double-stranded siRNA duplex comprising a sense sequence and a complementary antisense sequence, or an antisense oligonucleotide (ASO), wherein the sequence corresponds to a region of the VEGFA or ANGPT2 gene, wherein the siRNA duplex or ASO effectively and significantly reduces VEGFA or ANGPT2 mRNA in cells [e.g., according to any one of Compound 1 and subsequent compounds, Compound 3 and subsequent compounds, Compound 5 and subsequent compounds described above]; for example, a compound comprising a lipophilic moiety modification, an off-target modification, or a modification as described in any of the preceding claims; for example, wherein the antisense sequence is hybridizable to sequences selected from SEQ ID: 201-220, 261-268, 272-285, 356-393, and 394-403; for example, wherein the antisense sequence comprises sequences selected from Tables 9-12 and 18-34.
[0306] 6.16. Any of the aforementioned methods that reduce the levels of [certain substances] in cells. VEGFA and / or ANGPT2 Methods of gene expression, including the introduction of a double-stranded siRNA duplex or an antisense oligonucleotide (ASO) into the cells, the double-stranded siRNA duplex comprising a sense sequence and a complementary antisense sequence, wherein the sequence corresponds to a region of the VEGFA or ANGPT2 gene, wherein the RNAi agent effectively and significantly reduces VEGFA or ANGPT2 mRNA in the cells; for example, methods of inhibiting angiogenesis or treating diseases or conditions associated with VEGFA and / or ANGPT2 gene expression, comprising administering an effective amount of an RNAi agent or a pharmaceutical composition thereof; for example, wherein the disease or condition is cancer or ocular neovascularization, for example, wherein the disease or condition is selected from metastatic colorectal cancer, cervical cancer, endometrial cancer, non-small cell lung cancer, glioblastoma, metastatic hepatocellular carcinoma, metastatic renal cell carcinoma, ovarian cancer, primary peritoneal cancer, and fallopian tube cancer, or wherein the disease or condition is selected from neovascular (wet) age-related cancers. The method comprises administering to a patient in need an effective amount of an RNAi agent or a pharmaceutical composition thereof containing one or more sequences corresponding to a region of the VEGFA or ANGPT2 gene. The disease or condition is characterized by excessive activity or overexpression of Vegf-A and / or Angpt-2 (including abnormal forms of excessive activity or overexpression of Vegf-A and / or Angpt-2).
[0307] This disclosure also provides for the use of compound 5 and any of the following compounds in the manufacture or preparation of a medicament for use in any of method 2 and thereafter, method 4 and thereafter, and / or method 6 and thereafter.
[0308] This disclosure further provides compounds as described above and methods of using them, wherein the RNAi agent comprises a sequence capable of targeting LRRK2, VEGFA, or ANGPT2, for example, comprising a sequence derived from... LRRK2 , VEGFA or ANGPT2 The mRNA produced by the gene contains a sequence complementary to the target sequence, such as sequences selected from SEQ ID NO: 201-220, 261-268, 272-285, and 356-403, or sequences selected from Tables 9-12 or 18-34. In some embodiments, the modifications described above for siRNA or ASO targeting LRRK2 can alternatively be applied to siRNA or ASO targeting VEGFA or ANGPT2. In some embodiments, the RNAi agent contains one or more modifications as described above, such as any one of modifications that can improve the stability, delivery, and / or efficacy of the siRNA duplex or ASO, such as any one or more of the lipophilic moiety and / or off-target modifications described above, while targeting VEGFA or ANGPT2. In some implementations, such RNAi agents targeting VEGFA or ANGPT2 can be used in methods for treating diseases or conditions that can be suppressed by inhibiting angiogenesis mediated by Vegf-A and / or Angpt-2, for example, for treating cancer, ocular neovascularization, and other pathological conditions characterized by or dependent on angiogenesis.
[0309] Example Example 1. Design and synthesis of siRNA duplexes and antisense oligonucleotides (ASO) Bioinformatics A siRNA targeting human LRRK2 transcript mRNA (NCBI reference sequence ID NG_011709.2; NCBI gene ID: 120892) was designed. The human LRRK2 mRNA (NM_198578.4) is 9239 bases in length. A detailed list of unmodified LRRK2 sense and antisense nucleotides is shown in Table 1.
[0310] Synthesis of siRNA duplexes with or without chemical modification Using uridine (U), 4- N - Acetylcytidine (C Ac ), 6-N-benzoyl adenosine (A Bz ), 2-N-isobutyrylguanosine (G iBuCommercially available monomers of 5'-O-DMT-2'-O-(tert-butyl-dimethylsilyl)-3'-O-(2-cyanoethyl-N,N-diisopropyl)phosphamide, 5'-O-DMT-2'-O-methyl-3'-O-(2-cyanoethyl-N,N-diisopropyl)phosphamide, and 5'-O-DMT-2'-fluoro-2'-deoxy-3'-O-(2-cyanoethyl-N,N-diisopropyl)phosphamide, along with their respective dedicated solid-phase supports, were used to synthesize unmodified LRRK2 siRNA on an oligonucleotide synthesizer according to standard solid-phase synthesis and deprotection protocols. Optionally, dedicated off-target phosphoridamide monomers were used, and solid-phase synthesis and deprotection were performed according to standard protocols. To ensure high data fidelity, all single strands were purified to >90% purity using high-performance liquid chromatography (HPLC). The purity and identification of the oligonucleotides were confirmed by reversed-phase HPLC and liquid chromatography-mass spectrometry (LC-MS), respectively. For annealing, equimolar amounts of each single strand were dissolved in water and heated to 90 °C for 10 minutes. The mixture was then gradually cooled to room temperature and lyophilized.
[0311] Synthesis of antisense oligonucleotides (ASO) The synthesis of antisense oligonucleotides (ASOs) was performed on an automated oligonucleotide synthesizer on appropriate controlled-pore glass (CPG) solid supports. All reactions were carried out on solid supports packed in columns. The antisense oligonucleotides (ASOs) comprised patterns of 2'-O-methoxyethyl nucleotides and 2'-deoxy nucleotides. All antisense oligonucleotides were purified by HPLC to a purity >90%. The purity and identification of the oligonucleotides were confirmed by RP-HPLC and LC-MS, respectively. The ASOs were then lyophilized.
[0312] Table 1. Unmodified human LRRK2 siRNA duplexes *The range refers to the location shown in NM_198578.4.
[0313] Example 2. Synthesis of monomers. Scheme 1. Synthesis of N3T12-012-01. N3T12-012-01-1: NMI (25 mg, 0.295 mmol) and TEA (82 mg, 0.805 mmol) were added to a solution of N3T12-01-01-5 (200 mg, 0.268 mmol) in DCM (2 mL) and N,N-dimethylformamide (2 mL). Finally, tetrahydrofuran-2,5-dione (54 mg, 0.537 mmol) was added. The reaction mixture was stirred at room temperature for 16 hours. The reaction was quenched with water and extracted with DCM (200 mL) under ice bath cooling. The organic layer was washed with water and brine, dried over Na2SO4 and concentrated to give a residue, which was purified by silica gel column chromatography (SiO2, DCM:MeOH=94:6) to give N3T12-012-01-1 (143 mg, 0.169 mmol, 63.03% yield) as a colorless oil. LCMS: m / z 868.7 [(M+Na) + ]. 1 HNMR (400 MHz, DMSO-d6) δ 7.81–7.75 (m, 2H), 7.43–7.35 (m, 4H), 7.25–7.14 (m,5H), 6.88 (d, J =8.9 Hz, 4H), 5.07–4.94 (m, 1H), 3.74 (s, 6H), 3.21–2.87 (m,6H), 2.58–2.55 (m, 4H), 2.06–1.91 (m, 4H), 1.41–1.16 (m, 32H), 0.85 (t, J =6.7Hz, 3H). N3T12-012-01-2: To a solution of N3T12-012-01-1 (143 mg, 0.169 mmol) containing N,N-dimethylformamide (3 mL) and ACN (6 mL), CPG (500 mg, 0.090 mmol) and DIPEA (19.39 mg, 0.150 mmol) were added, followed by HBTU (42.67 mg, 0.112 mmol). The reaction was carried out on a shaker at 25 °C at 220 rpm. The reaction mixture was stirred for 16 hours, and the filter cake was filtered, washed three times with 30 mL of DCM, three times with 30 mL of acetonitrile, and three times with n-hexane. The filter cake was dried using a vacuum oil pump for 2 hours to obtain N3T12-012-01-2.
[0314] N3T12-012-01: N3T12-012-01-2 (463 mg, 0.069 mmol) was added to a solution of Ac2O (70.44 mg, 0.690 mmol) and pyridine (109.16 mg, 1.380 mmol), 4-(dimethylamino)pyridine (2.53 mg, 0.021 mmol), and NMI (1.70 mg, 0.021 mmol) in ACN (9 mL). The reaction was carried out on a shaker at 25 °C at 220 rpm. The reaction was stirred at room temperature under a nitrogen atmosphere for 16 hours. The filter cake was filtered and washed three times with acetonitrile, 30 mL each time. The filter cake was dried with a vacuum oil pump for 2 hours to obtain N3T12-012-01 (383 mg, 20.567 μmol, 54.57% yield, loading = 53.7 μmol / g).
[0315] Scheme 2. Synthesis of N3T12-027-01: N3T12-027-01-R3-4: To a pyridine (200 mL) solution of N3T12-027-01-R3-3 (10.0 g, 54.879 mmol), 4-methylbenzoyl chloride (12.7 g, 82.318 mmol) and DMAP (6.7 g, 54.879 mmol) were added. The resulting mixture was stirred at 80 °C for 5 h. Then, water (50 mL) was added to quench the reaction, and the mixture was evaporated to dryness under reduced pressure. The residue was dissolved in DCM (200 mL) and washed with saturated sodium bicarbonate solution (100 mL × 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (PE / EA=15 / 1) to give N3T12-027-01-R3-4 (17.2 g, 41.100 mmol, 74.89%) as a colorless oil. LCMS: m / z 441.3[(M+Na) + ]. N3T12-027-01-7: Pd / C (1.2 g, palladium (5%) on activated carbon (wetted with ca. 55% water)) was added to a methanol (80 mL) solution of N3T12-027-01-R3-4 (12.0 g, 28.675 mmol). The mixture was stirred at room temperature for 16 h under H2 atmosphere. After the reaction was complete, the solid was filtered off, and the solvent was evaporated to dryness under reduced pressure to give N3T12-027-01-7 (10 g, crude product), a colorless oil. The crude product was used in the next step without further purification. LCMS: m / z 351.3 [(M+Na)+ ]. N3T12-027-01-R3-2: Ethyl[di(propyl-2-yl)]amine (11.8 g, 91.363 mmol) and methyl bromide acetate (9.3 g, 60.909 mmol) were added to a 100 mL solution of N3T12-027-01-7 in DCM. The mixture was stirred at room temperature for 36 hours. After the reaction was complete, the solvent was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (PE / EA = 90:10) to give N3T12-027-01-R3-2 (4.1 g, 10.239 mmol, 33.63%, for both steps) as a colorless oil. LCMS: m / z 423.3 [(M+Na) + ]. N3T12-027-01-8: (1E)-N-(trimethylsilyl)-1-[(trimethylsilyl)oxy]ethyleneimine (6.7 g, 32.965 mmol) was added to an anhydrous ACN suspension of N3T12-027-01-R3-2 (1.2 g, 10.713 mmol). The mixture was heated at 50 °C for 20 min. After cooling to room temperature, an anhydrous ACN solution of 3-(acetoxymethoxy)propane-1,2-dimethylbis(4-methylbenzoate) (3.3 g, 8.241 mmol) along with TMSOTf (6.41 g, 28.844 mmol) was added to the above reaction mixture at 0 °C. The solution was stirred for 5 min, then heated to 75 °C for 4 h. After the reaction was complete, the solvent was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (DCM / EA = 7:3) to give N3T12-027-01-8 (3.4 g, 7.514 mmol, 91.18%) as a colorless oil. LCMS: m / z 453.4 [(M+H)] + ]. N3T12-027-01-9: NH3 (15 mL, 7 M MeOH solution) was added to N3T12-027-01-8 (3.4 g, 7.514 mmol) in a sealed tube. The resulting mixture was stirred overnight at 50 °C. After the reaction was complete, the solvent was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (DCM / MeOH = 95:5) to give N3T12-027-01-9 (1.1 g, 5.088 mmol, 67.71%) as a white solid. LCMS: m / z 217.2 [(M+H) + ]. N3T12-027-01-10: To a solution of N3T12-027-01-9 (1.1 g, 5.088 mmol) in pyridine (50 mL), 10 mL of a THF solution of 4,4'-dimethoxytriphenylmethyl chloride (DMTrCl) (2.3 g, 6.615 mmol) was added. The resulting mixture was stirred overnight at room temperature. Then, water (10 mL) was added to quench the reaction, and the mixture was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (DCM:EA=5:5) to give N3T12-027-01-10 (1.3 g, 2.507 mmol, 49.27%) as a yellow oil. LCMS: m / z 541.4 [(M+Na)] + ]. N3T12-027-01: To a solution of N3T12-027-01-10 (1.3 g, 2.507 mmol) and di(propan-2-yl)ammonium 1,2,3,4-tetrazol-1-oxide (0.64 g, 3.760 mmol) in DCM (6 mL), a solution of 3-{[2,6-dimethyl-3,5-di(propan-2-yl)-3,5-diaza-4-phosphaheptan-4-yl]oxy}propionitrile (1.51 g, 5.014 mmol) in DCM (2 mL) was added. The mixture was stirred overnight in a sealed tube at room temperature. After the reaction was complete, the mixture was poured into a saturated sodium bicarbonate solution (100 mL). The solution was then extracted with DCM (100 x 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by reversed-phase column chromatography (0-65% ACN purified aqueous solution) to give N3T12-027-01 (1.3 g, 1.809 mmol, 72.14%) as a pale yellow solid. LCMS (TM hydrolysis product): m / z 658.4 [(M+Na)] + ]. 1 H NMR (400 MHz, DMSO-d6) δ 11.34 (s, 1H), 7.65 (dd, J =11.0, 7.8 Hz, 1H),7.41–7.35 (m, 2H), 7.32–7.19 (m, 7H), 6.88 (dt, J =8.8, 4.8 Hz, 4H), 5.59 (dd, J =9.2, 7.8 Hz, 1H), 5.08 (d, J=13.2 Hz, 2H), 4.06–3.94(m, 1H), 3.81–3.72 (m,7H), 3.71–3.60 (m, 3H), 3.59–3.43 (m, 2H), 3.12–2.91 (m, 2H), 2.75 (t, J =5.8Hz, 1H), 2.63 (dd, J =9.2, 3.4 Hz, 1H), 1.17–1.06 (m, 9H), 0.98 (d, J =6.6 Hz, 3H). 31 P NMR (400 MHz, DMSO-d6) δ 148.60 (s), 148.17 (s). Option 3. N3T12-027-01- R The synthesis of. N3T12-027-01-R-1: BSA (4.06 g, 19.979 mmol) was added to a solution of 1,2,3,4-tetrahydropyrimidine-2,4-dione (0.84 g, 7.492 mmol) in ACN (30 mL) at room temperature under a N2 atmosphere. The reaction was stirred at 75 °C for 30 min. Then, N3T12-031-01-R-4 (2.5 g, 6.243 mmol) and TMSOTf (3.75 g, 16.857 mmol) were added at 0 °C. The reaction was stirred at 75 °C for 3 h. The reaction was quenched with NaHCO3 (aqueous solution, 30 mL), and the mixture was extracted with DCM (3 x 50 mL). The combined organic layers were dried with Na2SO4, and the solvent was removed under vacuum. The residue was purified by rapid column chromatography (eluting with PE solution of 0%-100% EA) to give N3T12-027-01-R-1 (2.25 g, 4.973 mmol, 79.65%) as a white solid. LCMS: m / z 453.4 [(M+H) + ]. 1 H NMR (400 MHz, DMSO-d6) δ 11.35 (s, 1H), 7.80 (dd, J =14.0, 8.2 Hz, 4H), 7.71 (d, J =7.8 Hz, 1H), 7.30 (dd, J =8.0, 3.2 Hz, 4H), 5.57 (d, J=7.8 Hz, 1H), 5.51–5.43 (m, 1H), 5.16(s, 2H), 4.58 (dd, J =11.8, 3.6 Hz, 1H), 4.47 (dd, J =11.8, 6.4 Hz, 1H), 3.91 (d, J =5.0 Hz, 2H), 2.36 (d, J =2.2 Hz, 6H). N3T12-027-01-R-2: N3T12-027-01-R-1 (2.25 g, 4.973 mmol) was dissolved in ammonia (30 mL, 210 mmol) (7 M MeOH solution, 30 mL). The reaction was stirred at 50 °C for 48 hours. The solvent was removed under vacuum, and the residue was purified by rapid column chromatography (eluting with 0%–20% MeOH in DCM solution) to give N3T12-027-01-R-2 (0.980 g, 4.533 mmol, 91.16%) as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ11.32 (s, 1H), 7.69 (d, J =7.8 Hz, 1H), 5.61 (d, J =7.8 Hz, 1H), 5.13–5.03 (m,2H), 4.74 (d, J =5.0 Hz, 1H), 4.53 (t, J =5.6 Hz, 1H), 3.56–3.47 (m, 2H), 3.39 -3.35 (m, 1H), 3.29 (t, J =5.4 Hz, 2H). N3T12-027-01-R-3: 1-[chloro(4-methoxyphenyl)phenylmethyl]-4-methoxybenzene (1997 mg, 5.893 mmol) was slowly added to a solution of N3T12-027-01-R-2 (980 mg, 4.533 mmol) in pyridine (15 mL) at 0 °C. The reaction was stirred at room temperature under a nitrogen atmosphere for 3 hours. The reaction was quenched with H2O (20 mL), and the mixture was extracted with DCM (3 x 30 mL). The combined organic layers were dried over Na2SO4, and the solvent was removed under vacuum. The residue was purified by rapid column chromatography (eluting with 0%–5% MeOH in DCM) to give N3T12-027-01-R-3 (1.7 g, 3.278 mmol, 72.32%) as a pale yellow solid. LCMS: m / z 541.1 [(M+Na) + ]. 1 H NMR (400 MHz, DMSO-d6) δ 11.35(s, 1H), 7.65 (d, J =7.8 Hz, 1H), 7.40–7.34 (m, 2H), 7.29 (t, J =7.6 Hz, 2H),7.24–7.19 (m, 5H), 6.87 (d, J =8.8 Hz, 4H), 5.59 (d, J =7.8 Hz, 1H), 5.08 (s,2H), 4.95 (d, J =5.4 Hz, 1H), 3.77–3.67 (m, 7H), 3.59 (dd, J =9.8, 4.2 Hz, 1H), 3.49 (dd, J =9.8, 5.8 Hz, 1H), 2.95–2.85 (m, 2H). N3T12-027-01- RAt 0 °C, 3-{[2,6-dimethyl-3,5-di(prop-2-yl)-3,5-diaza-4-phosphat-4-yl]oxy}propionitrile (814 mg, 2.700 mmol) was added to an anhydrous DCM (20 mL) solution of N3T12-027-01-R-3 (700 mg, 1.350 mmol) and diisopropylammonium tetrazolium (347 mg, 2.025 mmol) (700 mg, 1.350 mmol) and bis(2,6-dimethyl-3,5-di(prop-2-yl)-3,5-diaza-4-phosphat-4-yl]oxy}propionitrile (814 mg, 2.700 mmol) at room temperature under a nitrogen atmosphere for 16 hours. The mixture was extracted with NaHCO3 (aqueous solution, 30 mL) / DCM (3 x 30 mL), and the combined organic layers were dried over Na2SO4. The solvent was removed under vacuum, and the residue was purified by reversed-phase column chromatography (eluting with 0%-70% ACN in H2O) to give N3T12-027-01-R-3 as a pale yellow solid. R (692 mg, 0.963 mmol, 71.31%). LCMS: m / z 658.0 [(M-DIPA+OH+Na) + ]. 1 H NMR (400 MHz, DMSO-d6) δ 11.37 -11.35 (m, 1H), 7.67 - 7.62 (m, 1H), 7.39 - 7.36 (m, 2H), 7.32 - 7.27 (m, 2H),7.26–7.20 (m, 5H), 6.90–6.82 (m, 4H), 5.65–5.54 (m, 1H), 5.09 - 5.06 (m, 2H), 4.05–3.94 (m, 1H), 3.79–3.72 (m, 7H), 3.71–3.43 (m, 5H), 3.09 - 2.92 (m, 2H),2.78–2.59 (m, 2H), 1.21–1.08 (m, 8H), 0.98 (d, J =6.6Hz, 4H). 31 P NMR (162 MHz, DMSO-d6) δ 148.61, 148.18. Option 4. N3T12-027-01- S The synthesis of. N3T12-027-01-S-1: To a suspension of 1,2,3,4-tetrahydropyrimidine-2,4-dione (1.2 g, 11.038 mmol) in anhydrous ACN (15 mL), (1E)-N-(trimethylsilyl)-1-[(trimethylsilyl)oxy]ethyleneimine (6.9 g, 33.963 mmol) was added. The mixture was heated at 75 °C for 20 min under a nitrogen atmosphere. After cooling to room temperature, a solution of N3T12-031-01-S-4 (3.4 g, 8.491 mmol) in anhydrous ACN (10 mL) along with TMSOTf (6.6 g, 29.718 mmol) was added to the above reaction mixture at 0 °C. The solution was stirred for 5 min and then heated to 75 °C for 3 h. After the reaction was complete, it was quenched with NaHCO3 (aqueous solution, 50 mL), and the mixture was extracted with DCM (3 x 50 mL). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluting with DCM solution of 0%–30% EA) to give N3T12-027-01-S-1 (3.3 g, 7.29 mmol, 85.90%) as a colorless oil. LCMS: m / z 453.1 [(M+H) + ]. N3T12-027-01-S-2: NH3 (20 mL, 7 M MeOH solution) was added to N3T12-027-01-S-1 (3.3 g, 7.404 mmol) in a sealed tube. The resulting mixture was stirred at 50 °C for 48 hours. After the reaction was complete, the solvent was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (0-10% MeOH in DCM solution) to give N3T12-027-01-S-2 (1.1 g, 5.09 mmol, 68.72%) as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ11.32 (s, 1H), 7.70 (d, J =7.8 Hz, 1H), 5.61 (d, J =7.8 Hz, 1H), 5.08 (d, J =1.2Hz, 2H), 4.75 (d, J =5.0 Hz, 1H), 4.54 (t, J =5.6 Hz, 1H), 3.56–3.47 (m, 2H), 3.40–3.35 (m, 1H), 3.29 (t, J =5.4 Hz, 2H). N3T12-027-01-S-3: A solution of N3T12-027-01-S-2 (1.1 g, 5.088 mmol) in anhydrous pyridine (40 mL) was added to a solution of DMTrCl in 10 mL of THF (1.9 g, 5.597 mmol). The resulting mixture was stirred at room temperature under a nitrogen atmosphere for 16 hours. Water (10 mL) was then added to quench the reaction, and the mixture was poured into water (50 mL). The solution was then extracted with DCM (50 mL x 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (0–3% MeOH in DCM solution) to give N3T12-027-01-S-3 (1.5 g, 2.89 mmol, 56.85%) as a yellow oil. LCMS: m / z 541.1 [(M+Na)] + ]. N3T12-027-01- S 3-{[2,6-dimethyl-3,5-di(prop-2-yl)ammonium-1,2,3,4-tetrazo-1-oxide (445 mg, 2.603 mmol)}propionitrile (1046 mg, 3.471 mmol) was added to a DCM (20 mL) solution of N3T12-027-01-S-3 (900 mg, 1.736 mmol) and di(prop-2-yl)ammonium-1,2,3,4-tetrazo-1-oxide (445 mg, 2.603 mmol)). The mixture was stirred in a sealed tube under N2 atmosphere for 16 hours at room temperature. After the reaction was complete, the mixture was poured into a saturated sodium bicarbonate solution (100 mL). The solution was then extracted with DCM (100 mL * 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by reversed-phase column chromatography (using a pure aqueous solution of 0-65% ACN) to obtain N3T12-027-01- as a white solid. S (612 mg, 0.851 mmol, 48.96%). LCMS: m / z 719.3 [(M+H) + ]. 1 H NMR (400 MHz, DMSO-d6) δ 11.34 (s, 1H), 7.65 (dd, J =11.0, 7.8 Hz, 1H), 7.41–7.35(m, 2H), 7.32–7.19 (m, 7H), 6.88 (dt, J =8.8, 4.8 Hz, 4H), 5.59 (dd, J =9.2, 7.8Hz, 1H), 5.08 (d, J=13.2 Hz, 2H), 4.06–3.94(m, 1H), 3.81–3.72 (m, 7H), 3.71–3.60 (m, 3H), 3.59–3.43 (m, 2H), 3.12–2.91 (m, 2H), 2.75 (t, J =5.8 Hz, 1H), 2.63 (dd, J =9.2, 3.4 Hz, 1H), 1.17–1.06 (m, 9H), 0.98 (d, J =6.6 Hz, 3H). 31 P NMR (400 MHz, DMSO-d6) δ 148.59, 148.17. Scheme 5. Synthesis of N3T12-031-01. N3T12-031-01-1: To an anhydrous toluene solution of N-(9H-purin-6-yl)benzamide (3.2 g, 13.486 mmol) and N3T12-027-R3-2 (5.4 g, 13.486 mmol), (1E)-N-(trimethylsilyl)-1-[(trimethylsilyl)oxy]ethyleneimine (6.0 g, 29.668 mmol). The mixture was heated at 95 °C for 20 min. After cooling to room temperature (RT), trimethylsilyl trifluoromethanesulfonate (TMSOTf) (4.5 g, 20.228 mmol) was added to the above reaction mixture at 0 °C. The solution was stirred for 5 min, and then heated to 95 °C for 3 h. The solvent was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (DCM:MeOH = 98:2) to obtain a colorless oil, N3T12-031-01-1 (3.9 g, 6.729 mmol, 49.90%). LCMS: m / z 580.4 [(M+H) + ]. N3T12-031-01-2: LiOH (0.7 g, 16.822 mmol) was added to a solution of N3T12-031-01-1 (3.9 g, 6.729 mmol) in THF (15 mL) and H2O (5.00 mL). The mixture was stirred overnight at room temperature in a sealed tube. After the reaction was complete, HCl (4 M dioxane solution) was added to adjust the pH to 7. The solvent was then evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (DCM:MeOH = 95:5) to give N3T12-031-01-2 (1.7 g, 4.951 mmol, 73.59%) as a white solid. LCMS: m / z 344.4 [(M+H) + ]. N3T12-031-01-3: To a solution of N3T12-031-01-2 (1.7 g, 4.951 mmol) in pyridine (30 mL), 10 mL of THF solution of DMTTrCl (1.8 g, 5.446 mmol) was added. The resulting mixture was stirred overnight at room temperature. Then, water (10 mL) was added to quench the reaction, and the mixture was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (DCM:MeOH = 94:4) to give N3T12-031-01-3 (1.2 g, 1.858 mmol, 37.53%) as a white solid. LCMS: m / z 646.5 [(M+H) + ]. N3T12-031-01: To a solution of N3T12-031-03 (1.1 g, 1.704 mmol) and di(propan-2-yl)ammonium 1,2,3,4-tetrazol-1-oxide (0.44 g, 2.555 mmol) in DCM (8 mL), a solution of 3-{[2,6-dimethyl-3,5-di(propan-2-yl)-3,5-diaza-4-phosphaheptan-4-yl]oxy}propionitrile (1.03 g, 3.407 mmol) in DCM (4 mL) was added. The mixture was stirred overnight at room temperature in a sealed tube. After the reaction was complete, the mixture was poured into a saturated sodium bicarbonate solution (100 mL) and extracted with DCM (100 mL × 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by reverse-phase column chromatography (0-65% aqueous solution of ACN) to give N3T12-031-01 as a white solid (1.0 g, 1.182 mmol, 69.39%). LCMS: m / z 846.6 [(M+H)] + ]. 1H NMR (400 MHz, DMSO-d6)δ 11.22 (d, J =8.2 Hz, 1H), 8.74 (d, J =11.2 Hz, 1H), 8.59 (d, J =12.4 Hz, 1H), 8.05 (d, J =7.6 Hz, 2H), 7.65 (t, J =7.2 Hz, 1H), 7.56 (t, J =7.6 Hz, 2H), 7.34–7.24 (m, 4H), 7.22–7.14 (m, 5H), 6.89–6.81(m, 4H), 5.69 (d, J =15.2 Hz, 2H),4.05–3.93 (m, 1H), 3.87–3.75 (m, 1H), 3.75–3.68 (m, 7H), 3.68–3.54(m, 2H),3.54–3.37 (m, 2H), 3.09–2.89 (m, 2H), 2.71 (dd, J =6.4, 5.4 Hz, 1H), 2.61 (dd, J =9.4, 3.6 Hz, 1H), 1.08 (dd, J =11.2, 6.8 Hz, 6H), 0.99 (d, J =6.6 Hz, 3H), 0.93(d, J =6.8 Hz, 3H). 31 P NMR (400 MHz, DMSO-d6) δ 148.65 (s), 148.16 (s). Option 6. N3T12-031-01- R The synthesis of. N3T12-031-01-R-2: To a solution of N3T12-031-01-R-1 (10.0 g, 54.879 mmol) in pyridine (250 mL), 4-methylbenzoyl chloride (25.4 g, 164.637 mmol) and DMAP (6.7 g, 54.879 mmol) were added. The resulting mixture was stirred at 80 °C for 5 hours. Then, water (50 mL) was added to quench the reaction, and the mixture was evaporated to dryness under reduced pressure. The residue was dissolved in DCM (300 mL) and washed with saturated sodium bicarbonate solution (150 mL x 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (PE / EA = 15:1) to obtain N3T12-031-01-R-2 (20.1 g, 48.030 mmol, 87.51%) as a colorless oil. LCMS: m / z 441.3 [(M+Na) + ]. N3T12-031-01-R-3: Pd / C (1.2 g, palladium (5%) on activated carbon (wetted with ca. 55% water)) was added to an 80 mL methanol solution of N3T12-031-01-R-2. The mixture was stirred at room temperature for 16 hours under a H2 atmosphere. After the reaction was complete, the solid was filtered and the solvent was evaporated to dryness under reduced pressure to give N3T12-031-01-R-3 (10 g, crude product), a colorless oil. The crude product was used in the next step without further purification. LCMS: m / z 351.3 [(M+Na) + ]. N3T12-031-01-R-4: Ethyl[di(propyl-2-yl)]amine (11.8 g, 91.363 mmol) and methyl bromide acetate (9.3 g, 60.909 mmol) were added to a DCM (100 mL) solution of N3T12-031-01-R-3 (10.0 g, 30.454 mmol). The mixture was stirred at room temperature for 36 hours. After the reaction was complete, the solvent was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (PE / EA = 90:10) to give N3T12-031-01-R-4 (4.0 g, 9.989 mmol, 32.81%, for both steps) as a colorless oil. LCMS: m / z 423.3 [(M+Na) + ]. N3T12-031-01-R-5: To an anhydrous toluene suspension of N-(9H-purin-6-yl)benzamide (2.39 g, 9.989 mmol) and N3T12-031-01-R-4 (4.0 g, 9.989 mmol), (1E)-N-(trimethylsilyl)-1-[(trimethylsilyl)oxy]ethyleneimine (4.47 g, 21.976 mmol). The mixture was heated to 95 °C for 20 minutes. After cooling to room temperature, TMSOTf (3.33 g, 14.984 mmol) was added to the above reaction mixture at 0 °C. The solution was stirred for 5 minutes and then heated to 95 °C for 2.5 hours. The solvent was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (DCM:MeOH=98:2) to obtain a colorless oil, N3T12-031-01-R-5 (3.5 g, 6.039 mmol, 60.45%). LCMS: m / z 580.4 [(M+H) + ]. N3T12-031-01-R-6: LiOH (0.62 g, 14.665 mmol) was added to a solution of N3T12-031-01-R-5 (3.4 g, 5.866 mmol) in THF (15 mL) and H2O (5 mL). The mixture was stirred overnight in a sealed tube at room temperature. After the reaction was complete, HCl (4 M dioxane solution) was added to adjust the pH to 7. The solvent was then evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (DCM:MeOH = 95:5) to give N3T12-031-01-R-6 (1.6 g, 4.660 mmol, 79.44%) as a white solid. LCMS: m / z 344.2 [(M+H) + ]. N3T12-031-01-R-7: To a solution of N3T12-031-01-R-6 (1.5 g, 3.315 mmol) in pyridine (10 mL), 10 mL of THF solution of DMTTrCl (1.24 g, 3.647 mmol) was added. The resulting mixture was stirred overnight at room temperature. Then, water (10 mL) was added to quench the reaction, and the mixture was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (DCM:MeOH = 94:4) to give N3T12-031-01-R-7 (950 mg, 1.471 mmol, 44.38%) as a white solid. LCMS: m / z 646.5 [(M+H) + Chiral HPLC: ee 99.36%.
[0316] N3T12-031-01- R To a DCM solution (10 mL) of N3T12-031-01-R-7 (910 mg, 1.409 mmol) and di(propan-2-yl)ammonium 1,2,3,4-tetrazol-1-oxide (362.01 mg, 2.114 mmol), a DCM solution (2 mL) of 3-{[2,6-dimethyl-3,5-di(propan-2-yl)-3,5-diaza-4-phosphaheptan-4-yl]oxy}propionitrile (849.54 mg, 2.819 mmol) was added. The mixture was stirred overnight in a sealed tube at room temperature. After the reaction was complete, the mixture was poured into a saturated sodium bicarbonate solution (100 mL). The solution was then extracted with DCM (100 x 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by reversed-phase column chromatography (using a pure aqueous solution of 0-65% ACN) to obtain N3T12-031-01- as a white solid. R (710 mg, 0.839 mmol, 59.56%). LCMS: m / z 846.3 [(M+H) + ]. 1 HNMR (400 MHz, DMSO-d6) δ 11.22 (d, J =8.2 Hz, 1H), 8.74 (d, J =11.2 Hz, 1H), 8.59 (d, J =12.4 Hz, 1H), 8.05 (d, J =7.6 Hz, 2H), 7.65 (t, J =7.2 Hz, 1H), 7.56 (t, J =7.6 Hz, 2H), 7.34–7.24 (m, 4H), 7.22–7.14 (m, 5H), 6.89–6.81(m, 4H), 5.69 (d, J =15.2 Hz, 2H), 4.05–3.93 (m, 1H), 3.87–3.75 (m, 1H), 3.75–3.68 (m, 7H), 3.68–3.54 (m, 2H), 3.54–3.37 (m, 2H), 3.09–2.89 (m, 2H), 2.71 (dd, J =6.4, 5.4Hz, 1H), 2.61 (dd, J =9.4, 3.6 Hz, 1H), 1.08 (dd,J =11.2, 6.8 Hz, 6H), 0.99 (d, J =6.6 Hz, 3H), 0.93 (d, J =6.8 Hz, 3H). 31 P NMR (400 MHz, DMSO-d6) δ 148.65 (s),148.16 (s). Option 7. N3T12-031-01- S The synthesis of. N3T12-031-01-S-2: 4-methylbenzoyl chloride (25.4 g, 164.637 mmol) and DMAP (6.7 g, 54.879 mmol) were added to a solution of (S)-3-(benzyloxy)propane-1,2-diol (10.0 g, 54.879 mmol) in anhydrous pyridine (250 mL). The resulting mixture was stirred at 80 °C for 5 hours. Then, a saturated sodium bicarbonate solution (100 mL) was added to quench the reaction, and the mixture was extracted with DCM (3 x 100 mL). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluting with EA solution of 0%–10% PE) to give N3T12-031-01-S-2 (22.0 g, 52.570 mmol, 95.78%) as a colorless oil. LCMS: m / z 441.2 [(M+Na) + ]. N3T12-031-01-S-3: Pd / C (1.2 g, palladium (10%) on activated carbon (wetted with ca. 55% water)) was added to a methanol (80 mL) solution of N3T12-031-01-S-2 (12.0 g, 28.675 mmol). The mixture was stirred at room temperature for 16 hours under a H2 atmosphere (1 atm). After the reaction was complete, the solid was filtered and the solvent was evaporated to dryness under reduced pressure to give N3T12-031-01-S-3 (10 g, crude product), as a colorless oil. The crude product was used in the next step without further purification. LCMS: m / z 351.2 [(M+Na) + ]. N3T12-031-01-S-4: Ethyl[di(propyl-2-yl)]amine (11.8 g, 91.363 mmol) and methyl bromide acetate (9.3 g, 60.909 mmol) were added to a DCM (100 mL) solution of N3T12-031-01-S-3 (10.0 g, 30.454 mmol). The mixture was stirred at room temperature for 36 hours. After the reaction was complete, the solvent was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluting with PE solution of 0%–10% EA) to give N3T12-031-01-S-4 (4.7 g, 11.737 mmol, 38.54%, for both steps) as a colorless oil. LCMS: m / z 423.1 [(M+Na) + ]. N3T12-031-01-S-5: Add (1E)-N-(trimethylsilyl)-1-[(trimethylsilyl)oxy]ethyleneimine (4.1 g, 20.328 mmol) to an anhydrous toluene suspension of N-(9H-purin-6-yl)benzamide (2.2 g, 9.240 mmol) and N3T12-031-01-S-4 (3.7 g, 9.240 mmol). Heat the mixture to 95 °C for 20 minutes. After cooling to room temperature, add TMSOTf (3.1 g, 13.860 mmol) to the reaction mixture at 0 °C. Stir the solution for 5 minutes, then heat to 95 °C for 3 hours. Evaporate the solvent to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluting with 0%–2% MeOH in DCM solution) to give N3T12-031-01-S-5 (2.7 g, 4.658 mmol, 50.37%) as a colorless oil. LCMS: m / z 580.3 [(M+H) + ]. N3T12-031-01-S-6: LiOH (0.5 g, 11.646 mmol) was added to a solution of N3T12-031-01-S-5 (2.7 g, 4.658 mmol) in THF (15 mL) and H2O (5 mL). The mixture was stirred in a sealed tube at room temperature for 16 hours. After the reaction was complete, HCl (4 M dioxane solution) was added to adjust the pH to 7. The solvent was then evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (0-10% MeOH in DCM solution) to give N3T12-031-01-S-6 (1.3 g, 3.786 mmol, 81.28%) as a white solid. LCMS: m / z 344.2 [(M+H)+ ]. N3T12-031-01-S-7: A solution of N3T12-031-01-S-6 (1.3 g, 3.786 mmol) in anhydrous pyridine (10 mL) was added to a solution of DMTrCl (1.4 g, 4.165 mmol) in 10 mL of THF. The resulting mixture was stirred at room temperature under a nitrogen atmosphere for 16 hours. Water (30 mL) was then added to quench the reaction, and the solution was extracted with DCM (50 mL x 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluting with 0–3% MeOH in DCM) to give N3T12-031-01-S-7 (880 mg, 1.363 mmol, 35.99%) as a white solid. LCMS: m / z 646.5 [(M+H) + ]. N3T12-031-01- S To a DCM solution (10 mL) of N3T12-031-01-S-7 (570 mg, 0.883 mmol) and di(propan-2-yl)ammonium 1,2,3,4-tetrazol-1-oxide (226 mg, 1.324 mmol), a DCM solution (2 mL) of 3-{[2,6-dimethyl-3,5-di(propan-2-yl)-3,5-diaza-4-phosphaheptan-4-yl]oxy}propionitrile (532 mg, 1.765 mmol) was added. The mixture was stirred in a sealed tube under N2 atmosphere for 16 hours at room temperature. After the reaction was complete, the mixture was poured into a saturated sodium bicarbonate solution (50 mL). The solution was then extracted with DCM (50 mL * 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by reversed-phase column chromatography (using a pure aqueous solution of 0-65% ACN) to obtain N3T12-031-01- as a white solid. S (527 mg, 0.623 mmol, 70.57%). LCMS: m / z 846.4[(M+H) + ]. 1 H NMR (400 MHz, d6-DMSO) δ 11.22 (d, J =8.0 Hz, 1H), 8.74 (d, J =11.2Hz, 1H), 8.59 (d, J =12.4 Hz, 1H), 8.05 (d, J =7.6 Hz, 2H), 7.65 (t, J=7.2 Hz, 1H), 7.56 (t, J =7.6 Hz, 2H), 7.34–7.24 (m, 4H), 7.22–7.14 (m, 5H), 6.89–6.81(m, 4H), 5.69 (d, J =15.2 Hz, 2H), 4.05–3.93 (m, 1H), 3.87–3.75 (m, 1H), 3.75–3.68 (m, 7H), 3.68–3.54(m, 2H), 3.54–3.37 (m, 2H), 3.09–2.89 (m, 2H), 2.71(dd, J =6.4, 5.4 Hz, 1H), 2.61 (dd, J =9.4, 3.6 Hz, 1H), 1.08 (dd, J =11.2, 6.8 Hz, 6H), 0.99 (d, J =6.6 Hz, 3H), 0.93 (d, J =6.8 Hz, 3H). 31 P NMR (400 MHz, DMSO-d6) δ148.65, 148.16. Scheme 8. Synthesis of N3T12-047-01. N3T12-047-01-1: BSA (1.39 g, 6.813 mmol) was added to a solution of N-(2-oxo-1H-pyrimidin-4-yl)benzamide (1.00 g, 4.645 mmol) and N3T12-031-01-R-4 (1.24 g, 3.097 mmol) in ACN (15 mL) at room temperature under a N2 atmosphere. The reaction was stirred at 65 °C for 30 min. Then, TMSOTf (1.03 g, 4.645 mmol) was added. The reaction was stirred at 65 °C under a N2 atmosphere for 3 h. The reaction was quenched with NaHCO3 (aqueous solution, 20 mL), and the mixture was extracted with DCM (3 x 30 mL). The combined organic layers were dried with Na2SO4, and the solvent was removed under vacuum. The residue was purified by rapid column chromatography (eluting with 0%–7% MeOH in DCM solution) to give N3T12-047-01-1 (1.5 g, 2.700 mmol, 87.18%) as a white solid. LCMS: m / z 556.3[(M+H) + ]. N3T12-047-01-2: Lithium hydroxide (7.2 mL, 7.200 mmol, 1 M H2O solution) was added to a solution of N3T12-047-01-1 (1.6 g, 2.880 mmol) in tetrahydrofuran (21.6 mL). The reaction mixture was stirred at room temperature for 16 hours. The mixture was adjusted to pH 7 with HCl (4 M dioxane solution), and the solvent was removed under vacuum. The residue was purified by rapid column chromatography (eluting with 0%–15% MeOH in DCM solution) to give N3T12-047-01-2 (0.9 g, 2.818 mmol, 97.87%) as a white solid. LCMS: m / z 320.3 [(M+H) + ]. 1 H NMR (400 MHz, DMSO-d6) δ11.26 (s, 1H), 8.20 (d, J =6.6 Hz, 1H), 8.02–7.97 (m, 2H), 7.62 (t, J =7.4 Hz,1H), 7.53 - 7.49 (m, 2H), 7.30 (s, 1H), 5.25 (s, 2H), 4.86 (d, J =4.8 Hz, 1H), 4.64 (t, J =5.6 Hz, 1H), 3.58 - 3.54 (m, 2H), 3.45–3.42 (m, 1H), 3.30 (t, J= 5.4Hz, 2H). N3T12-047-01-3: 1-[chloro(4-methoxyphenyl)phenylmethyl]-4-methoxybenzene (1.24 g, 3.664 mmol) was slowly added to a solution of N3T12-047-01-2 (0.9 g, 2.818 mmol) in pyridine (15 mL) at 0 °C. The reaction was stirred at room temperature under a nitrogen atmosphere for 16 hours. The reaction was quenched with H2O (30 mL), and the mixture was extracted with DCM (3 x 30 mL). The combined organic layers were dried over Na2SO4, and the solvent was removed under vacuum. The residue was purified by rapid column chromatography (eluting with DCM solution of 0%–7% MeOH) to give N3T12-047-01-3 (1 g, 1.609 mmol, 57.07%) as a pale yellow solid. LCMS: m / z 622.2 [(M+H) + ]. N3T12-047-01: At 0 °C and under a N2 atmosphere, diisopropylammonium tetrazolium (269 mg, 1.568 mmol) and 3-{[2,6-dimethyl-3,5-di(prop-2-yl)-3,5-diaza-4-phosphatehept-4-yl]oxy}propionitrile (630 mg, 2.091 mmol) were added to an anhydrous ACN (10 mL) solution of N3T12-047-01-3 (650 mg, 1.046 mmol). The reaction mixture was stirred at room temperature for 16 hours. The reaction mixture was extracted with NaHCO3 (aqueous solution) / DCM (3 x 20 mL) and the combined organic layers were dried over Na2SO4. The solvent was removed under vacuum, and the residue was purified by reversed-phase column chromatography (eluting with 0%-60% ACN in H2O solution) to give N3T12-047-01 (711 mg, 0.865 mmol, 82.74%) as a white solid. LCMS: m / z 761.2 [(M-DIPA+Na) + ]. 1 H NMR (400 MHz, DMSO-d6) δ 11.29 (s, 1H), 8.11 (dd, J =10.6, 7.8 Hz, 1H), 8.01 (d, J =7.8 Hz, 2H), 7.63 (t, J =7.4 Hz, 1H), 7.52 (t, J =7.6 Hz, 2H), 7.40–7.35 (m, 2H), 7.35–7.16 (m, 8H), 6.91–6.82 (m, 4H), 5.24(d, J =12.2 Hz, 2H), 4.12–3.96 (m, 1H), 3.85–3.62 (m, 10H), 3.58 - 3.43 (m,2H), 3.10 - 2.92 (m, 2H), 2.76 (t, J =5.8 Hz, 1H), 2.64 (t, J =6.2 Hz, 1H), 1.13- 1.09 (m, 9H), 0.98 (d, J =6.7 Hz, 3H). 31 P NMR (162 MHz, DMSO-d6) δ 148.69,148.07. Scheme 9. Synthesis of N3T12-048-01. intA-1: Dry 2-methyl-N-(6-oxo-1,9-dihydropurin-2-yl)propionamide (29.0 g, 131.091 mmol) was suspended in anhydrous DMF (300 mL), then Ac₂O (33.5 g, 327.728 mmol) was added, and the mixture was heated to 100 °C for 1 hour. After the reaction was complete, the clear solution was evaporated to dryness, and the solid residue was suspended in dioxane and stirred overnight. The crystals were filtered and dried to give intA-1 as a white solid (27.1 g, 102.560 mmol, 78.24%). The crude product was used in the next step without further purification. LCMS: m / z 264.1 [(M+H) + ]. intA: An acetyl derivative N-(9-acetyl-6-oxo-6,9-dihydro-1H-purin-2-yl)isobutyramide (27.1 g, 102.940 mmol) was co-evaporated with pyridine (80 mL*3) and suspended in anhydrous pyridine (300 mL). DIPEA (26.6 g, 205.880 mmol) and diphenylcarbamoyl chloride (31.0 g, 133.822 mmol) were added, and the mixture was stirred at room temperature under a nitrogen atmosphere for 1.5 hours. After the reaction was complete, water (20 mL) was added to quench the reaction, and the solution was evaporated after 10 minutes. The residue was boiled with ethanol-water (500 mL, 1:1) for 1 hour. After cooling to room temperature, the crystals were filtered and dried to give product intA (26.3 g, 63.154 mmol, 61.35%) as a white solid. LCMS: m / z 417.1 [(M+H) + ]. N3T12-048-01-1: A suspension of intA (13.85 g, 33.264 mmol) and BSA (16.92 g, 83.161 mmol) in anhydrous toluene (200 mL) was stirred at 65 °C under a nitrogen atmosphere for 30 min. Then, N3T12-031-01-R-4 (11.10 g, 27.720 mmol) and TMSOTf (13.18 g, 58.212 mmol) were added at 65 °C, respectively. The mixture was stirred at 65 °C for another 16 h. After the reaction was complete, the solvent was poured into 250 mL of DCM and washed with saturated sodium bicarbonate (150 mL * 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (0%-30% EA in DCM solution) to give N3T12-048-01-1 (4.18 g, 5.523 mmol, 19.92%) as a pale yellow solid. LCMS: m / z 757.1 [(M+H) + ]. N3T12-048-01-2: N3T12-048-01-1 (4.08 g, 5.391 mmol) in NH3 / MeOH (40 mL, 7 M) was stirred at 60 °C for 48 h. After the reaction was complete, the solvent was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (0%-40% MeOH in DCM solution) to give N3T12-048-01-2 (1.21 g, 4.741 mmol, 87.94%) as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ 10.64 (s, 1H), 7.81 (s, 1H), 6.52(s, 2H), 5.34 (s, 2H), 4.75 (s, 1H), 4.52 (s, 1H), 3.55–3.20 (m, 5H). N3T12-048-01-3: TMSCl (7.73 g, 71.112 mmol) was added dropwise to a solution of N3T12-048-01-2 (1.21 g, 4.741 mmol) in anhydrous pyridine (10 mL). The mixture was stirred at room temperature for 30 min. Then, isobutyric anhydride (3.75 g, 23.704 mmol) was added at room temperature. The mixture was stirred at room temperature for another 1.5 h. After the reaction was complete, 6 mL of 25% ammonia solution was added, and the mixture was stirred at room temperature for 30 min. The mixture was then concentrated under reduced pressure. The crude product was purified by reversed-phase column chromatography (0%-20% ACN in 0.1% FA aqueous solution) to give N3T12-048-01-3 (1.12 g, 3.443 mmol, 72.62%) as a white solid. LCMS: m / z 326.2 [(M+H) + ]. N3T12-048-01-6: Under a nitrogen atmosphere, 2 mL of anhydrous THF solution of DMTTrCl (1.60 g, 4.734 mmol) was added to a solution of N3T12-048-01-3 (1.10 g, 3.381 mmol) in 10 mL of anhydrous pyridine. The mixture was stirred at room temperature for 3 hours. Water (2 mL) was added to quench the reaction, and the mixture was poured into water (50 mL). The solution was then extracted with DCM (50 mL x 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (0%–6% methanol in DCM solution) to give N3T12-048-01-6 (1.20 g, 1.912 mmol, 56.54%) as a pale yellow solid. LCMS: m / z 628.1 [(M+H) + ]. N3T12-048-01: Under a N2 atmosphere, an anhydrous DCM solution of 3-{[2,6-dimethyl-3,5-di(prop-2-yl)-3,5-diaza-4-phosphat-4-yl]oxy}propionitrile (672 mg, 2.230 mmol) in 1 mL of di(prop-2-yl)ammonium 1,2,3,4-tetrazo-1-yl) was added to a solution of N3T12-048-01-6 (700 mg, 1.115 mmol) and di(prop-2-yl)ammonium 1,2,3,4-tetrazo-1-yl) (286 mg, 1.673 mmol) in 10 mL. The mixture was stirred in a sealed tube at room temperature for 16 hours. After the reaction was complete, the mixture was poured into a saturated sodium bicarbonate solution (50 mL). The solution was then extracted with DCM (50 mL x 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by reversed-phase column chromatography (0%-60% aqueous solution of ACN) to give N3T12-048 as a white solid (652 mg, 0.787 mmol, 70.61%). LCMS: m / z 828.3[(M+H) + ]. 1 H NMR (400 MHz, DMSO-d6) δ 12.08 (s, 1H), 11.76 (s, 1H), 8.12 (d, J =12.6 Hz, 1H), 7.33–7.23 (m, 4H), 7.22–7.12 (m, 5H), 6.84 (t, J =8.6 Hz, 4H),5.50–5.41 (m, 2H), 3.97–3.89 (m, 1H), 3.73 (d, J =3.4 Hz, 6H), 3.72–3.57 (m,4H), 3.53–3.36 (m, 2H), 3.06–2.86 (m, 2H), 2.76 (dd, J =13.8, 6.8 Hz, 1H),2.71–2.58 (m, 2H), 1.13–1.04 (m, 12H), 0.96 (dd, J =14.8, 6.7 Hz, 6H). 31 P NMR (162 MHz, DMSO-d6) δ 148.53, 148.16. Scheme 10. Synthesis of N3T12-014a-01. N3T12-014a-01-2: Methyl 3-methoxy-3-oxopropionate (10 g, 75.689 mmol) was added to a DMF (100 mL) solution of sodium hydride (3.33 g, 83.258 mmol, 60% purity) at 0 °C under a nitrogen atmosphere. The mixture was stirred at 0 °C for 2 hours. Then, {[(2-bromoethyl)oxy]methyl}benzene (17.91 g, 83.258 mmol) was added, and the mixture was stirred at 80 °C for 4 hours. After the reaction was complete, the mixture was poured into a saturated ammonium chloride solution (150 mL) to quench the reaction, extracted with DCM (200 mL * 3), dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by column chromatography (PE:EA = 9:1) to obtain a colorless oil, N3T12-014a-01-2 (18 g, 56.330 mmol, 89.29%). LCMS: m / z 267.4 [(M+H) + ]. N3T12-014a-01-3: Pd / C (1.6 g, 10% purity) was added to a MeOH (150 mL) solution of N3T12-014a-01-2 (16 g, 60.085 mmol). The mixture was stirred at room temperature for 16 hours under H2 atmosphere. After the reaction was complete, the solid was filtered and the solvent was evaporated to dryness under reduced pressure (35 °C) to give crude product / intermediate (16 g). The crude product was used in the next step without further purification. LCMS: m / z 145.2 [(M-OCH3) + ]. N3T12-014a-01-4: At 0 °C, 1-[chloro(4-methoxyphenyl)phenylmethyl]-4-methoxybenzene (30.29 g, 89.40 mmol) was added to a solution of N3T12-014a-01-3 (10.5 g, 59.60 mmol) in pyridine (100 mL). The reaction was stirred at room temperature under a nitrogen atmosphere for 16 hours. The reaction was quenched with H2O (50 mL), and the mixture was extracted with DCM (3 x 60 mL). The combined organic layers were dried over Na2SO4, and the solvent was removed under vacuum (evaporated three times with toluene). The residue was purified by rapid column chromatography (eluting with PE solution of 0%–15% EA) to give N3T12-014a-01-4 (19.5 g, 40.749 mmol, 68.37%) as a pale yellow oil. LCMS: m / z 501.5 [(M+H) + ]. N3T12-014a-01-5: At 0 °C, a tetrahydrofuran solution (2.5 M, 44 mL) of LiAlH4 was added to a 200 mL solution of N3T12-014a-01-4 (19.5 g, 36.674 mmol). The reaction was stirred at 0 °C for 2 hours. Sodium sulfate decahydrate was slowly added to the reaction solution until no more bubbles were generated. The reaction mixture was then filtered and concentrated under reduced pressure to obtain a residue, which was purified by silica gel column chromatography (SiO2, DCM:MeOH = 20:1) to give N3T12-014a-01-5 (7.5 g, 17.751 mmol, 48.40% yield) as a colorless oil. LCMS: m / z 445.5 [(M+Na) + ]. 1 H NMR (400 MHz, DMSO) δ 7.39–7.21 (m, 9H), 6.91–6.86 (m, 4H), 4.28 (t, J =5.2 Hz, 2H), 3.73 (s, 6H), 3.30 (t, J =5.3 Hz, 4H), 2.98 (t, J =6.5 Hz, 2H),1.64–1.50 (m, 3H). N3T12-014a-01-6: At 0 °C, DIAD (2.09 g, 10.338 mmol) was slowly added to a tetrahydrofuran (80 mL) solution of N3T12-014a-01-5 (1.55 g, 7.157 mmol) and triphenylphosphine (2.71 g, 10.338 mmol). The reaction mixture was stirred at room temperature for 16 hours. Water (60 mL) was added to the reaction solution, and the mixture was stirred for 10 minutes. Extraction was then performed with EA (80 mL), dried over Na2SO4, and concentrated to give crude N3T12-014a-01-6 (4.8 g, 7.733 mmol, 97.25% yield) as a colorless oil. The crude product was used in the next step without further purification. LCMS: m / z 643.5[(M+Na) + ]. N3T12-014a-01-7: NH3 / MeOH (40 mL) was added to a 10 mL solution of N3T12-014a-01-6 (4.8 g, 7.733 mmol) in tetrahydrofuran. The reaction mixture was stirred at room temperature for 4 hours. The reaction mixture was concentrated under reduced pressure to obtain a residue, which was purified by silica gel column chromatography (SiO2, DCM:MeOH = 96:4) to give N3T12-014a-01-7 (1.8 g, 3.699 mmol, 47.84% yield) as a white solid. LCMS: m / z 539.5 [(M+Na) + ]. N3T12-014a-01: At 0 °C under nitrogen protection, 3-{[2,6-dimethyl-3,5-di(prop-2-yl)-3,5-diaza-4-phosphatehept-4-yl]oxy}propionitrile (2.10 g, 6.969 mmol) was added to an anhydrous DCM (30 mL) solution of diisopropylammonium tetrazolium (0.89 g, 5.227 mmol) and N3T12-014a-01-7 (1.8 g, 3.484 mmol). The reaction mixture was stirred overnight at room temperature. A saturated aqueous solution of Na₂SO₄ (20 mL) was then added to the reaction mixture, followed by extraction with DCM (30 mL). The extract was dried over Na₂SO₄ and concentrated under reduced pressure to obtain a residue. This residue was purified by reversed-phase column chromatography (ACN:H₂O = 60-70%) to give N₃T₁₂-014a-01 as a white solid (1.093 g, 1.525 mmol, 43.76% yield). LCMS: m / z 656.4 [(M hydrolyzed+Na) + ]. 1 H NMR (400 MHz, DMSO-d6) δ 11.25 (s, 1H),7.58–7.46 (m, 1H), 7.38–7.33 (m, 2H), 7.29 (t, J =7.6 Hz, 2H), 7.24–7.19 (m,5H), 6.87 (d, J =8.8 Hz, 4H), 5.54 (t, J =7.6 Hz, 1H), 3.73 (s, 6H), 3.72–3.35(m, 8H), 3.10–2.93 (m, 2H), 2.77–2.66 (m, 2H), 2.19 (s, 1H), 1.67–1.45 (m, 2H), 1.25–0.92 (m, 12H). The aforementioned nucleoside analogues in their protected form can be introduced into the antisense strand of the double-stranded siRNA to reduce off-target effects.
[0317] Example 3. Evaluation of human LRRK2 siRNA in vitro by transfection siRNAs were transfected into human lung epithelial cells A549 in 48-well plates using RNAiMAX (Invitrogen, 13778075). All siRNAs were tested at 10 nM. Seventeen siRNAs were further tested at 1 nM, 0.1 nM, and 0.01 nM.
[0318] Forty-eight hours after transfection, the culture medium was discarded, and the cells were collected for RNA extraction. Total RNA was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit V2 (Vazyme-RC112-01) according to the kit instructions, and then reverse transcribed into cDNA using HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme-R333-01).
[0319] The cDNA of the target gene was quantified by qPCR using specific primers and probes. GAPDH cDNA was used as a housekeeping gene for parallel assays. The expression of the target gene in each test sample was determined by relative quantification (RQ) using the comparative Ct (ΔΔCt) method.
[0320] Table 2. Screening of human LRRK2 siRNA (10 nM) in vitro by transfection For each compound, after transfection into cells, normalization to GAPDH mRNA levels was performed, and the percentage of residual human LRRK2 mRNA in cultured A549 cells relative to the simulated transfection group was determined. The 43 siRNA duplexes exhibited over 70% mRNA knockdown activity at 10 nM (Table 2). The significant differences in potency of siRNAs targeting different sites on the mRNA transcript suggest the existence of "hotspot regions" where mRNA is readily repressed by siRNAs. SiRNAs targeting these hotspot regions may be more effective.
[0321] The top 20 siRNAs (10 nM) selected based on activity in the above assays are listed in Table 2a: Table 2a More preferred siRNAs are listed in Table 2b: Table 2b The range position refers to the start position of the sequence corresponding to a location on the LRRK2 mRNA, where the number is given relative to the LRRK2 genomic DNA (NCBI reference sequence ID NG_011709.2; NCBI gene ID: 120892; NM_198578.4). The ranges corresponding to mRNA regions complementary to the antisense sequences in Table 2a are hotspot regions, where the mRNA is readily repressed by siRNA. Therefore, siRNA targeting mRNA regions overlapping with these hotspot sequences is expected to be effective.
[0322] Based on their efficacy, 17 siRNAs were selected for further study at 1 nM, 0.1 nM, and 0.01 nM (Table 3): Table 3. Dosage screening of human LRRK2 siRNA by transfection into A549 cells Fourteen siRNA duplexes exhibited over 70% mRNA knockdown activity at 1 nM. Ten siRNA duplexes exhibited over 70% mRNA knockdown activity at 0.1 nM (Table 4). Table 4: siRNA constructs with over 70% mRNA knockdown activity at 0.1 nM Both siRNA duplexes (N3T130023-01 and N3T130096-01) exhibited over 40% mRNA knockdown activity at 0.01 nM. The mRNA regions overlapping with the antisense strand sequences in Table 4 are hotspot regions, where the mRNA is susceptible to siRNA repression.
[0323] Example 4. siRNA with a 3' antisense overhang and a 5' antisense blunt end The following are different length variants of naked siRNA (Table 5). These strands have a 3' antisense overhang (i.e., the 5' end of the antisense strand in these duplexes is complementary to the 3' end of the sense strand, so the sequence is blunt at the 3' end of the sense strand, but at the 5' end of the sense strand, the 3' end of the antisense strand protrudes beyond the sense strand, for example, by 2 nucleotides). The sense strand is 21–23 nucleotides long; the sense strand is 19–21 nucleotides long. The 2-nucleotide 3' overhang is maintained in the antisense strand.
[0324] Table 5. Unmodified human LRRK2 siRNA Table 6. Screening of human LRRK2 siRNA in vitro by transfection Human LRRK2 siRNA with a 19-nucleotide sense strand and a 21-nucleotide antisense strand has similar mRNA knockdown activity to the corresponding siRNA with a 21-nucleotide sense strand and a 23-nucleotide antisense strand (Table 6).
[0325] Example 5. Evaluation of human LRRK2 siRNA in vitro by free uptake LRRK2 siRNA (Table 7) was added to human lung epithelial cells A549 in 96-well plates without transfection reagents. All siRNAs were tested at 10 μM and 3 μM. After 72 hours of free uptake, the culture medium was discarded, and cells were collected for RNA extraction. Total RNA was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit V2 (Vazyme-RC112-01) according to the kit instructions, and reverse transcribed into cDNA using HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme-R333-01). The cDNA of the target gene was quantified by qPCR using specific primers and probes. GAPDH cDNA was used as a housekeeping gene for parallel assays. The expression of the target gene in each test sample was determined by relative quantification (RQ) using the comparative Ct (ΔΔCt) method (Table 8).
[0326] Table 7. Human LRRK2 siRNAs available for free uptake in A549 cells Am, Cm, Gm, and Um represent the 2'-O-methyl (2'-OMe) sugar modification of adenosine, cytidine, guanosine, and uridine, respectively; AF, Cf, Gf, and Uf represent the 2'-deoxy-2'-fluoro (2'-F) sugar modification of adenosine, cytidine, guanosine, and uridine, respectively; and s represents the phosphate thioester (PS) bond.
[0327] Table 8. In vitro evaluation of human LRRK2 siRNA in A549 cells by free uptake Human LRRK2 siRNAs N3T130138-01, N3T130146-01, N3T130148-01, and N3T130149-01 exhibited over 50% mRNA knockdown activity at 10 μM. Human LRRK2 siRNAs N3T130138-01, N3T130146-01, and N3T130148-01 also exhibited over 40% mRNA knockdown activity at 3 μM.
[0328] Example 6. Synthesis of lipophilic monomers The lipophilic monomer containing the lipophilic moiety is located at one or more terminal positions on at least one strand of the oligonucleotide. The lipophilic monomer is synthesized to introduce lipophilic ligands as a solid-phase support or phosphoramide at different positions (terminal and / or internal positions) of the siRNA. Various lipids can be conjugated using methods as shown in the following schemes (e.g., schemes 11-20 for general procedures), and the resulting building block phosphoramide can be incorporated into the siRNA.
[0329] Scheme 11. Synthesis of N3T12-006-01. N3T12-006-01-2: A suspension of magnesium chloride (4.5 g, 46.589 mmol) and potassium [(3-methoxy-1,3-dioxopropyl)oxy] (10.5 g, 67.195 mmol) in tetrahydrofuran (200 mL) was combined with a solution of prepared CDI (8.7 g, 53.756 mmol) and 3-{[(benzyloxy)carbonyl]amino}propionic acid (10.0 g, 44.797 mmol) in tetrahydrofuran (150 mL). The mixture was stirred at room temperature for 16 hours. The reaction solution was poured into water (300 mL) and extracted with EA (150 mL × 3). The organic phase was concentrated to dryness. The residue was purified by column chromatography (EA / PE = 0-50%) to give N3T12-006-01-2 (9.8 g, 35.089 mmol, 78.33% yield) as a colorless oil. LCMS: m / z 280.2 [(M+H) + ]. 1 HNMR (400 MHz, CDCl3) δ 7.39–7.29 (m, 5H), 5.20 (s, 1H), 5.13–5.01 (m, 2H), 3.73 (s, 3H), 3.49–3.42 (m, 4H), 2.81 (t, J =5.6 Hz, 2H). N3T12-006-01-3: At 0 °C, LiAlH4 (71.6 mL, 1 M THF solution) was slowly added to a tetrahydrofuran (100 mL) solution of N3T12-006-01-2 (9.8 g, 35.089 mmol) for 30 minutes. The reaction solution was then warmed to room temperature and stirred for 2 h. The reaction solution was poured into an ammonium chloride aqueous solution (300 mL) and extracted with EA (300 mL × 4). The organic phase was concentrated under vacuum. The residue was purified by column chromatography (MeOH / DCM = 0-7%) to give N3T12-006-01-3 (2.0 g, 7.896 mmol, 22.05% yield) as a colorless oil. LCMS: m / z 254.2 [(M+H) + ]. 1 H NMR(400 MHz, DMSO-d6) δ 7.38–7.30 (m, 5H), 7.16–7.14 (m, 1H), 5.00 (s, 2H), 4.37(d, J =5.4 Hz, 1H), 4.31 (t, J=5.2 Hz, 1H), 3.59–3.54 (m, 1H), 3.50–3.45 (m,2H), 3.14–2.99 (m, 2H), 1.57–1.36 (m, 4H). N3T12-006-01-4: 1-[chloro(4-methoxyphenyl)phenylmethyl]-4-methoxybenzene (3.2 g, 9.475 mmol) was added to a solution of N3T12-006-01-3 (2.0 g, 7.896 mmol) at 0 °C for 10 min. The mixture was warmed to room temperature and stirred at this temperature for 3 h. TLC showed that SM was consumed. The reaction solution was poured into water (100 mL), adjusted to pH=4 with citric acid aqueous solution (10%), and extracted with DCM (70 mL × 2). The organic phase was concentrated under vacuum. The residue was purified by column chromatography [(EA + 1% TEA) / PE = 0-45%] to give N3T12-006-01-4 (3.5 g, 6.299 mmol, 79.77% yield) as a pale yellow slurry. 1 H NMR (400 MHz, DMSO-d6) δ 7.39–7.15(m, 15H), 6.88 (d, J =8.8 Hz, 4H), 4.99 (s, 2H), 4.35 (d, J =5.6 Hz, 1H), 3.73(s, 6H), 3.66–3.53 (m, 1H), 3.14–2.97 (m, 4H), 1.68–1.34 (m, 4H). N3T12-006-01-5: Pd / C (0.5 g, 4.499 mmol) was added to a solution of N3T12-006-01-4 (2.5 g, 4.499 mmol) in tetrahydrofuran (25 mL). The reaction solution was stirred at room temperature under H2 for 3 h. TLC showed that SM was consumed. The reaction solution was filtered, and the filtrate was concentrated under vacuum to give N3T12-006-01-5 (1.8 g, 4.270 mmol, 94.91% yield) as a dark oil, which was used for the next step without further purification.
[0330] N3T12-006-01-6: At 0 °C, for 10 minutes, a solution of (1R,3aS,3bS,7S,9aR,9bS,11aR)-9a,11a-dimethyl-1-[(2R)-6-methylhept-2-yl]-2,3,3a,3b,4,6,7,8,9,9a,9b,10,11,11a-tetradecano-1H-cyclopenta[1,2-i]phenanthrene-7-ylchlorocarbamate (2.0 g, 4.484 mmol) in toluene (2 mL) was added to a solution of pyridine (20 mL) of N3T12-006-01-5 (1.8 g, 4.270 mmol). The mixture was stirred at room temperature for 3 hours. TLC showed that SM was consumed and new spots were formed. The reaction solution was poured into water (150 mL), and the pH was adjusted to 4 with 10% citric acid aqueous solution. Extraction was performed with EA (100 mL × 3). The organic phase was concentrated under vacuum. The residue was purified by column chromatography [(EA + 1% TEA) / PE = 0-35%] to give N3T12-006-01-6 (3.0 g, 3.596 mmol, 84.22% yield) as a pale yellow resin. 1 H NMR (400 MHz, DMSO-d6) δ 7.38–7.35 (m, 2H), 7.30 (t, J =7.6 Hz, 2H), 7.24–7.19 (m, 5H), 6.96–6.94 (m, 1H), 6.87 (d, J =8.8 Hz, 4H), 5.30 (s, 1H), 4.33–4.26 (m, 2H), 3.73 (s, 6H), 3.64–3.52 (m, 1H), 3.07–2.92 (m, 4H), 2.31–2.13(m, 2H), 1.98–1.87 (m, 2H), 1.85–1.73 (m, 3H), 1.68–1.57 (m, 2H), 1.56–1.43 (m, 6H), 1.43–1.20 (m, 8H), 1.15–0.92 (m, 12H), 0.90 (d, J =6.5 Hz, 3H), 0.84(dd, J =6.6, 1.8 Hz, 6H), 0.65 (s, 3H). N3T12-006-01-7: To N3T12-006-01-6 (3.0 g, 3.596 mmol), a solution of tetrahydrofuran-2,5-dione (1.1 g, 10.789 mmol), 2-[ethyl(2-hydroxyethyl)amino]ethane-1-ol (1.07 mL, 10.789 mmol), and NMI (295 mg, 3.596 mmol) in DCM (10 mL) was added. The reaction solution was stirred at room temperature for 16 hours. TLC showed that SM was consumed. The reaction solution was concentrated under vacuum, and the residue was purified by column chromatography [(EA + 1% MeOH) / DCM = 0-5%] to give N3T12-006-01-7 (700 mg, 0.749 mmol, 20.83% yield) as a grayish-white solid. 1 H NMR (400 MHz, DMSO-d6) δ 12.20 (s, 1H), 7.39–7.26 (m, 4H), 7.21 (d, J =8.6 Hz, 5H), 6.97 (t, J =5.8 Hz, 1H), 6.88 (d, J =15.2 Hz, 4H), 5.37–5.24 (m, 1H), 5.02–4.92(m, 1H), 4.36–4.23 (m, 1H), 3.73 (s, 6H), 3.02–2.91 (m, 4H), 2.44–2.15 (m, 6H), 0.92–0.83 (m, 9H), 0.65 (s, 3H). N3T12-006-01: In a centrifuge tube, DIPEA (25 mg, 0.194 mmol) and HBTU (55 mg, 0.145 mmol) were added to a solution of N3T12-006-01-7 (90 mg, 0.097 mmol) in a mixture of ACN (6 mL) and DMF (3 mL). CPG (1.0 g, 180 μmol / g) was added to the mixture. The centrifuge tube was placed on a wrist shaker and shaken at 25 °C (200 r / min) for 16 hours. The reaction solution was filtered, and the filter cake was washed with DCM (30 mL × 3), ACN (30 mL × 3), and n-hexane (30 mL × 3), respectively. After drying the filter cake under vacuum, the CPG loading value was measured (CPG loading value = 86.8 μmol / g). In a centrifuge tube, NMI (8 mg), pyridine (80 mg), DMAP (9 mg), and acetic anhydride (50 mg) were added to a mixture of CPG and ACN (5 mL). The centrifuge tube was placed on a wrist shaker and shaken at 25 °C (200 rpm) for 16 hours. The reaction solution was filtered, and the filter cake was washed with ACN (30 mL × 3). The filter cake was dried under vacuum to obtain N3T12-006-01 (457.20 mg) as a white solid.
[0331] Scheme 12. Synthesis of N3T12-010-01. N3T12-010-01-1: NMI (29 mg, 0.348 mmol) and TEA (96 mg, 0.950 mmol) were added to a solution of N3T12-009-01-3 (200 mg, 0.317 mmol) in DCM (4 mL). Finally, tetrahydrofuran-2,5-dione (159 mg, 1.583 mmol) was added. The reaction mixture was stirred at room temperature for 16 hours and concentrated to obtain a residue, which was purified by silica gel column chromatography (SiO2, DCM:MeOH = 93:7) to give N3T12-010-01-1 (375 mg, 0.512 mmol, 64.75% yield) as a yellow solid. LCMS: m / z 754.5 [(M+Na) + ]. 1 H NMR (400 MHz, DMSO) δ 12.24 (s, 1H),7.76 (t, J=6.0 Hz, 1H), 7.54–7.09 (m, 9H), 6.90–6.86 (m, 4H), 5.07–4.93 (m,1H), 3.73 (s, 6H), 3.30–3.27 (m, 1H), 3.18–3.09 (m, 1H), 3.08–3.00 (m, 2H),2.57–2.54 (m, 2H), 2.49–2.42 (m, 2H), 1.96 (t, J =7.4 Hz, 2H), 1.41–1.34 (m,2H), 1.26–1.17 (m, 24H), 0.87–0.83 (m, 3H). N3T12-010-01-2: To a solution of N3T12-010-01-1 (60 mg, 0.082 mmol) containing N,N-dimethylformamide (6 mL) and ACN (12 mL), DIPEA (36 mg, 0.279 mmol) and CPG (600 mg, 0.126 mmol) were added, followed by HBTU (80 mg, 0.211 mmol). The reaction was carried out on a shaker at 25 °C at 220 rpm. The reaction mixture was stirred for 16 hours, and the filter cake was filtered, washed three times with 30 mL of DCM, three times with 30 mL of acetonitrile, and three times with n-hexane. The filter cake was dried using a vacuum oil pump for 2 hours to obtain N3T12-010-01-2 as a white solid.
[0332] N3T12-010-01: N3T12-010-01-2 (500 mg, 0.090 mmol) was added to a solution of Ac2O (94 mg, 0.917 mmol) and pyridine (145 mg, 1.833 mmol), 4-(dimethylamino)pyridine (3.5 mg, 0.028 mmol), and NMI (2.5 mg, 0.028 mmol) in ACN (9 mL). The reaction was carried out on a shaker at 25 °C at 220 rpm. The reactants were stirred at room temperature under a nitrogen atmosphere for 16 hours. The filter cake was filtered and washed three times with acetonitrile, 30 mL each time. The filter cake was dried under a vacuum oil pump for 2 hours to give N3T12-010-01 (512.31 mg, 30.170 μmol, 94.65% yield, loading value = 58.89 μol / g) as a pale yellow solid.
[0333] Scheme 13. Synthesis of N3T12-012-01. N3T12-012-01-1: NMI (25 mg, 0.295 mmol) and TEA (82 mg, 0.805 mmol) were added to a solution of N3T12-01-01-5 (200 mg, 0.268 mmol) in DCM (2 mL) and N,N-dimethylformamide (2 mL). Finally, tetrahydrofuran-2,5-dione (54 mg, 0.537 mmol) was added. The reaction mixture was stirred at room temperature for 16 hours. The reaction was quenched with water and extracted with DCM (200 mL) under ice bath cooling. The organic layer was washed with water and brine, dried over Na2SO4 and concentrated to give a residue, which was purified by silica gel column chromatography (SiO2, DCM:MeOH=94:6) to give N3T12-012-01-1 (143 mg, 0.169 mmol, 63.03% yield) as a colorless oil. LCMS: m / z 868.7 [(M+Na) + ]. 1 HNMR (400 MHz, DMSO-d6) δ 7.81–7.75 (m, 2H), 7.43–7.35 (m, 4H), 7.25–7.14 (m,5H), 6.88 (d, J =8.9 Hz, 4H), 5.07–4.94 (m, 1H), 3.74 (s, 6H), 3.21–2.87 (m,6H), 2.58–2.55 (m, 4H), 2.06–1.91 (m, 4H), 1.41–1.16 (m, 32H), 0.85 (t, J =6.7Hz, 3H). N3T12-012-01-2: To a solution of N3T12-012-01-1 (143 mg, 0.169 mmol) containing N,N-dimethylformamide (3 mL) and ACN (6 mL), CPG (500 mg, 0.090 mmol) and DIPEA (19.39 mg, 0.150 mmol) were added, followed by HBTU (42.67 mg, 0.112 mmol). The reaction was carried out on a shaker at 25 °C at 220 rpm. The reaction mixture was stirred for 16 hours, and the filter cake was filtered, washed three times with 30 mL of DCM, three times with 30 mL of acetonitrile, and three times with n-hexane. The filter cake was dried using a vacuum oil pump for 2 hours to obtain N3T12-012-01-2.
[0334] N3T12-012-01: N3T12-012-01-2 (463 mg, 0.069 mmol) was added to a solution of Ac2O (70.44 mg, 0.690 mmol) and pyridine (109.16 mg, 1.380 mmol), 4-(dimethylamino)pyridine (2.53 mg, 0.021 mmol), and NMI (1.70 mg, 0.021 mmol) in ACN (9 mL). The reaction was carried out on a shaker at 25 °C at 220 rpm. The reactants were stirred at room temperature under a nitrogen atmosphere for 16 hours. The filter cake was filtered and washed three times with acetonitrile, 30 mL each time. The filter cake was dried under a vacuum oil pump for 2 hours to obtain N3T12-012-01 (383 mg, 20.567 μmol, 54.57% yield, loading = 53.7 μmol / g).
[0335] Scheme 14. Synthesis of N3T12-023-01. N3T12-023-01-1: NMI (26 mg, 0.320 mmol) and TEA (88 mg, 0.872 mmol) were added to a DCM (4 mL) solution of N3T12-019-01-R2-6 (200 mg, 0.291 mmol). Finally, tetrahydrofuran-2,5-dione (60.56 mg, 0.605 mmol) was added. The reaction mixture was stirred at room temperature for 16 hours, concentrated, and the residue was purified by silica gel column chromatography (SiO2, DCM:MeOH=93:7) to give N3T12-023-01-1 (123 mg, 0.162 mmol, 53.34% yield) as a yellow oil. 1 H NMR (400 MHz, DMSO-d6) δ 12.20 (s, 1H), 7.46–7.15(m, 9H), 6.89–6.85 (m, 4H), 5.25–5.04 (m, 2H), 4.06 (M, 1H), 3.73 (d, J =2.4Hz, 6H), 3.57–3.44 (m, 2H), 3.29–3.21 (m, 2H), 3.13 (dd, J =9.6, 5.8 Hz, 1H), 3.00 (dd, J =9.6, 5.4 Hz, 1H), 2.49–2.44 (m, 2H), 2.21–1.99 (m, 2H), 1.34 (t, J=6.2 Hz, 2H), 1.30–1.09 (m, 26H), 0.90–0.80 (m, 3H). N3T12-023-01-2: To a solution of N3T12-023-01-1 (123 mg, 0.162 mmol) containing N,N-dimethylformamide (3 mL) and ACN (6 mL), CPG (600 mg, 0.108 mmol) and DIPEA (42 mg, 0.324 mmol) were added, followed by HBTU (92.16 mg, 0.243 mmol). The reaction was carried out on a shaker at 25 °C at 220 rpm. The reaction mixture was stirred for 16 hours, and the filter cake was filtered, washed three times with 30 mL of DCM, three times with 30 mL of acetonitrile, and three times with n-hexane. The filter cake was dried using a vacuum oil pump for 2 hours to obtain N3T12-023-01-2 as a white solid.
[0336] N3T12-023-01: Add N3T12-023-01-2 (600.00 mg, 0.042 mmol) to a solution of Ac2O (43 mg, 0.420 mmol) and pyridine (100 mg, 1.260 mmol), 4-(dimethylamino)pyridine (1.5 mg, 0.013 mmol), and NMI (1.1 mg, 0.013 mmol) in ACN (9 mL). The reaction was carried out on a shaker at 25 °C at 220 rpm. The reaction mixture was stirred at room temperature under a nitrogen atmosphere for 16 hours. The filter cake was filtered and washed three times with acetonitrile, 30 mL each time. The filter cake was dried with a vacuum oil pump for 2 hours to obtain N3T12-023-01 (554.90 mg, 59.019 μmol, 88.56% yield, loading value = 106.36 μmol / g) as a white solid.
[0337] Scheme 15. Synthesis of N3T12-019-01. N3T12-019-01-R2-4: To a solution of N3T12-019-01-R2-3 (5.0 g, 12.859 mmol) in tetrahydrofuran (50 mL), hexadecane-1-ol (5.7 mL, 19.288 mmol), sodium bicarbonate (2.16 g, 25.718 mmol), molecular sieve (5 g), and zinc dibromide (0.87 g, 3.858 mmol) were added. The reaction mixture was stirred at room temperature under a nitrogen atmosphere for 16 hours. The mixture was filtered and the filtrate was concentrated under vacuum. The residue was purified by rapid column chromatography (eluting with PE solution of 0%–15% EA) to give N3T12-019-01-R2-4 (3.7 g, 6.220 mmol, 48.37% yield) as a white solid. 1 HNMR (400 MHz, CD3OD-d4) δ 7.97–7.92 (m, 2H), 7.91–7.86 (m, 2H), 7.31–7.23 (m,4H), 5.58 -5.55 (m, 1H), 5.33 (dd, J =5.4, 2.4 Hz, 1H), 4.55 (dd, J =10.6, 4.6Hz, 1H), 4.49–4.45 (m, 1H), 4.44–4.39 (m, 1H), 3.70 (dt, J =9.4, 6.6 Hz, 1H), 3.38 (dt, J =9.4, 6.6 Hz, 1H), 2.54–2.48 (m, 1H), 2.42–2.34 (m, 7H), 1.54–1.44(m, 2H), 1.27–1.23 (m, 26H), 0.89 (t, J =6.8 Hz, 3H). N3T12-019-01-R2-5: NH3 (15 mL, 7 M MeOH solution) was added to N3T12-019-01-R2-4 (2.8 g, 0.005 mol) in a sealed tube. The resulting mixture was stirred overnight at 50 °C. After the reaction was complete, the solvent was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluting with 0–7% MeOH in DCM solution) to give N3T12-019-01-R2-5 (1.2 g, 3.347 mmol, 71.01% yield) as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ 5.06 (dd, J=5.2, 2.6 Hz, 1H), 4.94 (d, J =4.8 Hz, 1H), 4.56 (t, J =5.6Hz, 1H), 4.14–4.07 (m, 1H), 3.69 (td, J =6.0, 3.6 Hz, 1H), 3.56 (dt, J =9.4, 6.6Hz, 1H), 3.41–3.29 (m, 2H), 3.28–3.20 (m, 1H), 2.01–1.93 (m, 1H), 1.91–1.84(m, 1H), 1.47–1.39 (m, 2H), 1.30–1.18 (m, 26H), 0.85 (t, J =6.8 Hz, 3H). N3T12-019-01-R2-6: To a solution of N3T12-019-01-R2-5 (1.2 g, 0.003 mol) in pyridine (10 mL), 10 mL of THF solution of DMTrCl (1.70 g, 0.005 mol) was added. The resulting mixture was stirred overnight at room temperature. Then, water (10 mL) was added to quench the reaction, and the mixture was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluting with PE solution of 0%-50% EA) to give N3T12-019-01-R2-6 (1.5 g, 2.269 mmol, 67.81% yield) as a yellow oil. 1 H NMR (400 MHz, DMSO-d6) δ 7.42 (d, J =7.4 Hz, 2H), 7.32–7.25(m, 6H), 7.24 –7.18 (m, 1H), 6.87 (d, J =8.2 Hz, 4H), 5.07 (dd, J =5.0, 1.8 Hz, 1H), 5.05 (d, J =5.2 Hz, 1H), 4.12–4.06 (m, 1H), 3.85 (dd, J =10.2, 4.8 Hz, 1H),3.73 (s, 6H), 3.53 (dt, J =9.0, 6.6 Hz, 1H), 3.25 (dt, J =9.2, 6.4 Hz, 1H), 3.04(dd, J=9.6, 4.2 Hz, 1H), 2.98–2.92 (m, 1H), 1.96 (ddd, J =12.6, 6.6, 1.6 Hz,1H), 1.90–1.83 (m, 1H), 1.38–1.10 (m, 28H), 0.84 (t, J =6.8 Hz, 3H). N3T12-019-01: To a solution of N3T12-019-01-R2-6 (1.3 g, 0.002 mol) and di(propane-2-yl)ammonium 1,2,3,4-tetrazol-1-oxide (0.51 g, 0.003 mol) in ACN (4 mL), a solution of 3-{[2,6-dimethyl-3,5-di(propane-2-yl)-3,5-diaza-4-phosphaheptan-4-yl]oxy}propionitrile (1.19 g, 0.004 mol) in ACN (2 mL) was added. The mixture was stirred overnight in a sealed tube at room temperature. After the reaction was complete, the mixture was poured into a saturated sodium bicarbonate solution (100 mL). The solution was then extracted with DCM (100*3). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by reversed-phase column chromatography (100% ACN) to give N3T12-019-01 (1.5 g, 1.742 mmol, 88.56%) as a colorless oil. LCMS (TM hydrolysis product): m / z 800.6 [(M+Na) + ]. 1 H NMR (400MHz, DMSO-d6) δ 7.42 (dd, J =7.0, 5.0 Hz, 2H), 7.32–7.25 (m, 6H), 7.21 (dd, J =8.2, 6.0 Hz, 1H), 6.86 (dd, J =8.8, 3.8 Hz, 4H), 5.16–5.11 (m, 1H), 4.44–4.29(m, 1H), 4.07–3.94 (m, 1H), 3.72 (s, 6H), 3.70 –3.63(m, 1H), 3.62–3.42 (m,4H), 3.31–3.24 (m, 1H), 3.19–3.06 (m, 1H), 3.01–2.95 (m, 1H), 2.73 (t, J =5.8Hz, 1H), 2.63 (t, J=5.8 Hz, 1H), 2.10–2.00 (m, 1H), 1.39–1.31 (m, 2H), 1.40 –1.05 (m, 36H), 0.97 (d, J =6.6 Hz, 3H), 0.84 (t, J =6.8 Hz, 3H). 31 P NMR (162 MHz, DMSO) δ 147.40 (s), 147.04 (s). Scheme 16. Synthesis of N3T12-022-01. N3T12-017-01-2: TMSCl (32.6 g, 0.299 mol) was added to a pyridine (200 mL) solution of N3T12-017-01-1 (20.0 g, 0.075 mol), and the mixture was stirred at room temperature for 1 hour. Then, BzCl (12.7 g, 0.090 mol) was added dropwise. The resulting mixture was stirred at room temperature for 4 hours, and then water (20 mL) was added. After stirring at room temperature for 5 minutes, ammonia (180 mL) was added, and the resulting mixture was stirred at room temperature for 30 minutes, then evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluting with 0–7% MeOH in DCM solution) to give N3T12-017-01-2 as a white solid (21.1 g, 56.820 mmol, 75.93% yield). LCMS: m / z 372.3 [(M+H) + ]. N3T12-017-01-3: 3,5-Dichloro-2,6-dimethyl-3,5-di(propyl-2-yl)-3,5-disilazane-4-oxaheptanane (17.0 g, 0.054 mol) was added dropwise to a solution of N3T12-017-01-2 (10.5 g, 0.027 mol) in pyridine (200 mL). The mixture was stirred overnight at room temperature. After the reaction was complete, water (10 mL) was added to quench the reaction, and the mixture was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluting with PE solution of 0%–40% EA) to give N3T12-017-01-3 (10.0 g, 16.290 mmol, 60.49% yield) as a white solid. LCMS: m / z 614.4 [(M+H) + ]. N3T12-022-01-1: Methanesulfonyl chloride (3.8 g, 0.033 mol) was added to a solution of N3T12-017-01-3 (10.0 g, 16.290 mmol) in pyridine (150 mL). The resulting mixture was stirred overnight at room temperature. Then, water (15 mL) was added to quench the reaction, and the mixture was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluting with PE solution of 0%–30% EA) to give N3T12-022-01-1 (9.4 g, 14.828 mmol, 91.13%) as a white solid. LCMS: m / z 692.4 [(M+H) + ]. N3T12-022-01-3: Hexadecane-1-thiol (5.49 g, 0.021 mol) was added to a solution of NaH (0.85 g, 0.021 mol) in 120 mL of N,N-dimethylformamide (120 mL) at 0 °C under a nitrogen atmosphere. The mixture was stirred at 0 °C for 30 minutes. Then, N3T12-022-01-1 (4.9 g, 0.007 mol) was added, and the mixture was stirred at room temperature for 3 hours. After the reaction was complete, water was added to quench the reaction. The mixture was then poured into brine (200 mL). The solution was extracted with DCM (200 x 3), and the organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by column chromatography (eluting with 0%–5% MeOH in DCM solution) to give N3T12-022-01-3 as a white solid (1.7 g, 2.778 mmol, 39.24% yield). LCMS: m / z 612.5 [(M+H) + ]. N3T12-022-01-4: To a solution of N3T12-022-01-3 (1.7 g, 0.003 mol) in pyridine (20 mL), 10 mL of THF solution of DMTrCl (1.9 g, 0.006 mol) was added. The resulting mixture was stirred overnight at room temperature. Then, water (10 mL) was added to quench the reaction, and the mixture was evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (eluting with PE solution of 0%–50% EA) to give N3T12-022-01-4 (1.1 g, 1.203 mmol, 43.31% yield) as a yellow solid. LCMS: m / z 914.7 [(M+H) + ]. N3T12-022-01: To a DMF (4 mL) solution of N3T12-022-01-4 (1.1 g, 0.001 mol) and di(propane-2-yl)ammonium 1,2,3,4-tetrazol-1-oxide (0.31 g, 0.002 mol), a solution of 3-{[2,6-dimethyl-3,5-di(propane-2-yl)-3,5-diaza-4-phosphaheptan-4-yl]oxy}propionitrile (0.73 g, 0.002 mol) in ACN (2 mL) was added. The mixture was stirred in a sealed tube at room temperature for 16 hours. After the reaction was complete, the mixture was poured into a saturated sodium bicarbonate solution (100 mL). The solution was then extracted with DCM (100 x 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by reversed-phase column chromatography (100% ACN) to give N3T12-022-01 as a white solid (1.3 g, 1.167 mmol, 96.95% yield). LCMS (TM hydrolysis product): m / z 1031.9 [(M+H)] + ]. 1 H NMR (400 MHz, DMSO-d6) δ 11.22 (d, J =6.6 Hz, 1H), 8.65 (d, J =10.0 Hz, 1H), 8.45 (d, J =16.2 Hz, 1H), 8.05 (dd, J =7.4, 2.2 Hz, 2H), 7.68–7.62 (m, 1H), 7.58–7.52 (m, 2H), 7.40(d, J =7.2 Hz, 2H), 7.31–7.16 (m, 7H), 6.83 (dd, J =8.6, 6.8 Hz, 4H), 6.15 (dd, J =8.6, 5.0 Hz, 1H), 5.28–5.09 (m, 1H), 4.68–4.61 (m, 1H), 3.86–3.77 (m, 1H), 3.74–3.63 (m, 7H), 3.51–3.69 (m, 2H), 3.39–3.48 (m, 2H), 2.77 (t, J =6.0 Hz,1H), 2.35–2.54 (m, 3H), 1.32–1.44 (m, 2H), 1.30–1.15 (m, 27H), 1.13 (d, J=6.6Hz, 3H), 1.01–1.10 (m, 6H), 0.84 (t, J =6.8 Hz, 3H), 0.74 (d, J =6.6 Hz, 3H). 31 PNMR (400 MHz, DMSO-d6) δ 150.67 (s), 149.84 (s). Scheme 17. Synthesis of N3T12-018-01. N3T12-018-01-2: Imidazole (1.41 g, 20.76 mmol) and dimethylchloro(2-methylpropyl-2-yl)silane (1.96 g, 12.97 mmol) were added to a pyridine (50 mL) solution of N3T12-018-01-1 (4 g, 10.38 mmol). The reaction mixture was stirred at room temperature under a nitrogen atmosphere for 16 hours. The reaction was quenched with water (50 mL) and extracted with DCM (3 x 50 mL). The combined organic layers were dried over Na2SO4 and the solvent was removed under vacuum. The residue was purified by rapid column chromatography (eluting with 0%–5% MeOH in DCM) to give N3T12-018-01-2 (5.1 g, 10.21 mmol, 98.35% yield) as a white solid. LCMS: m / z 500.4 [(M +H) + ]. 1 H NMR (400 MHz, DMSO-d6) δ 11.22 (s,1H), 8.76 (s, 1H), 8.62 (s, 1H), 8.08–8.01 (m, 2H), 7.69–7.61 (m, 1H), 7.57–7.54 (m, 2H), 6.18 (d, J =4.8 Hz, 1H), 5.37 (s, 1H), 4.47–4.34 (m, 2H), 4.02(q, J =4.0 Hz, 1H), 3.90 (dd, J =11.4, 3.8 Hz, 1H), 3.79 (dd, J =11.4, 4.2 Hz, 1H), 3.39 (s, 3H), 0.87 (s, 9H), 0.05 (s, 6H). N3T12-018-01-3: To a solution of N3T12-018-01-2 (5.1 g, 10.21 mmol) in pyridine (60 mL), 4-(dimethylamino)pyridine (1.87 g, 15.31 mmol) and 1-[chloro(4-methoxyphenyl)phenylmethyl]-4-methoxybenzene (10.38 g, 30.62 mmol) were added. The reaction mixture was stirred at 80 °C under a nitrogen atmosphere for 16 hours. The reaction was quenched with water (50 mL) and extracted with DCM (3 x 50 mL). The combined organic layers were dried over Na2SO4, and the solvent was removed under vacuum to give N3T12-018-01-3 (8.2 g, crude product) as a yellow solid. The crude product was used in the next step without further purification. LCMS: m / z 802.6 [(M +H) + ]. N3T12-018-01-4: TBAF (1 M, 30.67 mL) was added to a tetrahydrofuran (30 mL) solution of N3T12-018-01-3 (8.2 g, 10.22 mmol). The reaction mixture was stirred at room temperature for 2 hours. The solvent was extracted with H2O / DCM (3 x 50 mL), and the combined organic layers were dried over Na2SO4. The solvent was removed under vacuum, and the residue was purified by rapid column chromatography (eluting with 0%–5% MeOH in DCM) to give N3T12-018-01-4 (6.5 g, 9.45 mmol, 92.44% yield) as a pale yellow solid. LCMS: m / z 688.4 [(M +H) + ]. 1 H NMR (400 MHz, DMSO-d6) δ 11.22(s, 1H), 8.75 (s, 1H), 8.69 (s, 1H), 8.07–8.02 (m, 2H), 7.67–7.63 (m, 1H),7.58–7.50 (m, 4H), 7.39–7.31 (m, 6H), 7.26–7.22 (m, 1H), 6.92–6.86 (m, 4H), 6.33 (d, J =5.4 Hz, 1H), 5.06 (t, J =5.2 Hz, 1H), 4.29–4.21 (m, 1H), 3.82 (t, J =5.0 Hz, 1H), 3.73 (d, J =2.8 Hz, 6H), 3.41–3.36 (m, 1H), 3.25–3.18 (m, 4H). N3T12-018-01-5: Potassium iodide (1.57 g, 9.45 mmol) and NaH (0.83 g, 20.79 mmol) were added to a solution of N,N-dimethylformamide (50 mL) containing N3T12-018-01-4 (6.5 g, 9.45 mmol). The reaction mixture was stirred at 0 °C under a N2 atmosphere for 0.5 h. Then, 1-bromohexadecane (3.46 g, 11.34 mmol) was added, and the reaction mixture was stirred at room temperature under a N2 atmosphere for 4 h. The reaction was quenched with NH4Cl (aqueous solution, 50 mL) and extracted with DCM (3 x 50 mL). The combined organic layers were dried over Na2SO4, and the solvent was removed under vacuum. The residue was purified by rapid column chromatography (eluting with 0%-5% MeOH in DCM solution) to give N3T12-018-01-5 as a light yellow solid (3.16 g, 3.46 mmol, 36.65% yield). 1 HNMR (400 MHz, DMSO-d6) δ 11.19 (s, 1H), 8.71 (s, 1H), 8.54 (s, 1H), 8.09–8.02(m, 2H), 7.68–7.61 (m, 1H), 7.57–7.53 (m, 2H), 7.49–7.45 (m, 2H), 7.32–7.28(m, 6H), 7.23–7.19(t, J =7.3 Hz, 1H), 6.86–6.81 (m, 4H), 6.23 (d, J =3.4 Hz, 1H),4.32–4.26 (m, 1H), 3.96–6.93 (m, 1H), 3.69 (d, J =5.2 Hz, 6H), 3.51–3.45 (m,1H), 3.43–3.39 (m, 1H), 3.31–3.29 (m, 1H), 3.26 (s, 3H), 3.21–3.16 (m, 2H), 1.37–1.30 (m, 2H), 1.24–1.11 (m, 26H), 0.84 (t, J =6.8 Hz, 3H). N3T12-018-01-6: DCA (2.4 mL) was added to a DCM (40 mL) solution of N3T12-018-01-5 (3.16 g, 3.46 mmol). The reaction mixture was stirred at 0 °C for 2 h. The reaction was quenched with MeOH (20 mL) and neutralized with NaHCO3 (50 mL aqueous solution). The mixture was extracted with DCM (3 x 50 mL) and the combined organic layers were dried over Na2SO4. The solvent was removed under vacuum, and the residue was purified by rapid column chromatography (eluting with DCM solution of 0%–5% MeOH) to give N3T12-018-01-6 (1.97 g, 3.23 mmol, 93.25% yield) as a pale yellow solid. 1 H NMR (400 MHz, DMSO-d6) δ11.23 (s, 1H), 8.77 (s, 1H), 8.66 (s, 1H), 8.08–8.02 (m, 2H), 7.65 (t, J =7.4Hz, 1H), 7.55 (t, J =7.6 Hz, 2H), 6.18 (d, J =4.8 Hz, 1H), 5.41 (d, J =5.6 Hz, 1H),4.42–4.36 (m, 2H), 4.08 (q, J =4.0 Hz, 1H), 3.67 (dd, J =10.8, 3.6 Hz, 1H), 3.57(dd, J =10.8, 4.6 Hz, 1H), 3.47–3.41 (m, 2H), 3.39 (s, 3H), 1.55–1.47 (m, 2H), 1.27–1.19 (m, 26H), 0.85 (t, J =6.8 Hz, 3H). N3T12-018-01: To a solution of N3T12-018-01-5 (0.99 g, 3.28 mmol) and diisopropylammonium tetrazolium (211 mg, 1.23 mmol) in N,N-dimethylformamide (20 mL), 3-{[2,6-dimethyl-3,5-di(prop-2-yl)-3,5-diaza-4-phosphahepten-4-yl]oxy}propionitrile (0.99 g, 3.28 mmol) was added. The reaction mixture was stirred at 45 °C under a N2 atmosphere for 3 h. The mixture was extracted with NaHCO3 (aqueous solution) / DCM (3 x 50 mL), and the combined organic layers were dried over Na2SO4. The solvent was removed under vacuum, and the residue was purified by preparative HPLC (eluting with 100% ACN) to give N3T12-018-01 as a white solid (1.2 g, 1.48 mmol, 90.34% yield). LCMS: m / z 727.5 [(M-DIPA+OH+H) + ]. 1 H NMR (400 MHz, DMSO-d6) δ 11.24 (s, 1H), 8.76 (s, 1H), 8.67 (d, J =5.8 Hz, 1H), 8.05 (d, J =7.2 Hz, 2H), 7.65 (t, J =7.4 Hz, 1H), 7.55 (t, J =7.6Hz, 2H), 6.20–6.16 (m, 1H), 4.74–4.58 (m, 2H), 4.31–4.19 (m, 1H), 3.88–3.54(m, 6H), 3.48–3.36 (m, 5H), 2.84–2.80 (m, 2H), 1.54–1.46 (m, 2H), 1.27–1.15(m, 38H), 0.85 (t, J =6.8 Hz, 3H). 31 P NMR (162 MHz, DMSO-d6) δ 149.90, 149.16. Scheme 18. Synthesis of N3T12-011-01. N3T12-011-01-2: HATU (16 g, 0.042 mol) and DIPEA (10.9 g, 0.084 mol) were added to a solution of N,N-dimethylformamide (150 mL) containing N3T12-011-01-1 (6.5 g, 0.028 mol). The mixture was stirred at room temperature for 30 min. Then, (S)-3-aminopropane-1,2-diol (3.0 g, 0.033 mol) was added, and the mixture was stirred at room temperature for another 16 h. After the reaction was complete, the solvent was concentrated directly under reduced pressure (via an oil pump). The resulting residue was purified by rapid silica gel column chromatography (eluting with 0%–20% MeOH in DCM solution) to give N3T12-011-01-2 (7.2 g, 23.654 mmol, 84.17% yield) as a brown oil. LCMS: m / z 305.1 [(M+H) + ]. N3T12-011-01-3: N3T12-011-01-2 (7.2 g, 23.654 mmol) was added to a dioxane / HCl solution (2 M, 40 mL). The mixture was stirred at room temperature for 2 hours. After the reaction was complete, the solvent was concentrated under reduced pressure to obtain N3T12-011-01-3 (6.6 g, crude product), which was a yellow oil. The crude product was used directly in the next step without further purification. LCMS: m / z 205.1 [(M+H) + ]. N3T12-011-01-4: Hexadecanoyl chloride (10.6 g, 0.039 mol) was added to a 50 mL solution of pyridine containing N3T12-011-01-3 (6.6 g, 0.032 mol). The mixture was stirred overnight at room temperature. After the reaction was complete, the solvent was concentrated under reduced pressure to obtain N3T12-011-01-4 (15.9 g, crude product), which was a yellow oil. The crude product was used directly in the next step without further purification. LCMS: m / z 443.5 [(M+H) + ]. N3T12-011-01-5: DMTTrCl (4.5 g, 0.013 mol) was added to a pyridine (20 mL) solution of N3T12-011-01-4 (5.0 g, 0.011 mol). The mixture was stirred overnight at room temperature. After the reaction was complete, water (50 mL) was added to quench the reaction. The combined organic layers were then washed with water (150 mL) and brine, dried over Na2SO4, and concentrated to give a residue. This residue was purified by silica gel column chromatography (eluting with 0%–5% MeOH in DCM solution) to give N3T12-011-01-5 (1.6 g, 2.147 mmol, 19.01% yield) as a yellow solid. LCMS: m / z 767.6 [(M+Na)] + ]. N3T12-011-01: To a DMF (6 mL) solution of N3T12-011-01-5 (1.6 g, 2.147 mmol), 3-{[2,6-dimethyl-3,5-di(prop-2-yl)-3,5-diaza-4-phosphahepta-4-yl]oxy}propionitrile (971 mg, 3.221 mmol), 1-methylimidazolium (265 mg, 3.221 mol), and 3H-1,2,3,4-tetraazole (181 mg, 2.577 mmol) were added sequentially. The mixture was stirred in a sealed tube at room temperature for 16 hours. After the reaction was complete, the mixture was poured into a saturated sodium bicarbonate solution (100 mL). The solution was then extracted with DCM (100 x 3). The organic phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness under reduced pressure. The residue was purified by silica gel column chromatography (PE / EA / 0.1% Et3N) and reversed-phase column chromatography (99.9% ACN / 0.1% Et3N) to give N3T12-011-01 (1.5 g, 1.587 mmol, 73.89% yield) as a colorless oil. LCMS (TM hydrolysis product): m / z 884.6 [(M+Na)] + ]. 1 H NMR (400 MHz, DMSO) δ 7.70 (t, J =5.4 Hz, 1H), 7.63 (dt, J =23.8, 5.8 Hz, 1H), 7.43–7.36 (m, 2H), 7.33–7.18 (m, 7H), 6.91–6.82(m, 4H), 4.00 (dd, J=10.4, 5.8 Hz, 1H), 3.83–3.70 (m, 7H), 3.70–3.47 (m, 3H), 3.31 (s, 1H), 3.24–3.06 (m, 2H), 3.03–2.88 (m, 3H), 2.77 (dd, J =9.0, 3.2 Hz, 1H), 2.63 (td, J =5.8, 1.6 Hz, 1H), 2.02 (t, J =7.4 Hz, 2H), 2.00–1.89 (m, 2H), 1.51–1.25 (m, 8H), 1.24–1.10 (m, 33H), 1.01 (d, J =6.6 Hz, 3H), 0.85 (t, J =6.8Hz, 3H). 31 P NMR (400 MHz, DMSO-d6) δ 148.41 (s), 147.91 (s). Scheme 19. Synthesis of N3T12-060-01. N3T12-060-01-1: HATU (2.4 g, 6.364 mmol) and DIPEA (6.3 g, 48.955 mmol) were added to an anhydrous DMF (20 mL) solution of 6-((tert-butoxycarbonyl)amino)hexanoic acid (1.0 g, 4.406 mmol). The mixture was stirred at room temperature for 30 minutes. Then, (… S 1.0 g of 6-amino-N-(2,3-dihydroxypropyl)hexamethylenetetramine (4.895 mmol) was added, and the mixture was stirred at room temperature for another 16 hours. After the reaction was complete, the solvent was concentrated under reduced pressure. The resulting residue was purified by rapid silica gel column chromatography (0%–20% MeOH in DCM solution) to give N3T12-060-01-1 (1.1 g, 2.634 mmol, 53.81%) as a brown oil. LCMS: m / z 418.5 [(M+H) + ]. N3T12-060-01-2: Add N3T12-060-01-1 (1.1 g, 2.634 mmol) to a dioxane / HCl solution (2 M, 10 mL). Stir the mixture at room temperature for 2 hours. After the reaction is complete, concentrate the solvent under reduced pressure. Use N3T12-060-01-2 (1.0 g, crude) for the next step without further purification.
[0338] N3T12-060-01-3: Hexadecanoyl chloride (779 mg, 2.835 mmol) was added to a solution of N3T12-060-01-2 (900 mg, 2.835 mmol) in anhydrous pyridine (10 mL). The mixture was stirred at room temperature for 16 hours. After the reaction was complete, N3T12-060-01-3 (1.6 g, crude product) was used for the next step without further purification. LCMS: m / z 556.6 [(M+H)] + ]. N3T12-060-01-4: DMTrCl (1.3 g, 3.778 mmol) was added to a solution of N3T12-060-01-3 (1.4 g, 2.519 mmol) in anhydrous pyridine (25 mL). The mixture was stirred at room temperature for 16 hours. After the reaction was complete, the solution was diluted with ethyl acetate (EA) (150 mL). The organic layer was washed with water and brine, dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by rapid silica gel column chromatography (0%–4% MeOH in DCM solution) to give N3T12-060-01-4 (125 mg, 0.146 mmol, 5.78%) as a white solid. LCMS: m / z 880.9 [(M+Na)] + ]. N3T12-060-01-5: Tetrahydrofuran-2,5-dione (44 mg, 436.951 μmol), triethylamine (45 mg, 436.951 μmol), and 3-methylimidazole (13 mg, 160.215 μmol) were added to an anhydrous DCM (5 mL) solution of N3T12-060-01-4 (125 mg, 145.650 μmol). The mixture was stirred at room temperature for 16 hours. After the reaction was complete, the solution was diluted with EA (150 mL). The organic layer was washed with water and brine, dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by rapid silica gel column chromatography (0%–7% MeOH in DCM solution) to give N3T12-060-01-5 (79 mg, 0.082 mmol, 56.60%) as a white solid. LCMS: m / z 980.8 [(M+Na) + ]. N3T12-060-01: In a centrifuge tube, DIPEA (31 mg, 237.924 μol) and HBTU (68 mg, 178.443 μol) were added to a solution of N3T12-060-01-5 (79 mg, 79.308 μmol) in a mixture of ACN (9 mL) and N,N-dimethylformamide (3 mL). CPG (350 mg, 63 μmol) was added to the mixture. The centrifuge tube was placed on a wrist shaker and shaken at 25 °C (220 r / min) for 16 hours. The reaction solution was filtered, and the filter cake was washed with dichloromethane (DCM) (30 mL × 3), acetonitrile (CAN) (30 mL × 3), and n-hexane (30 mL × 3), respectively. After drying under vacuum, the filter cake yielded crude N3T12-060-01 (320 mg) as a white solid. The CPG loading value was measured (CPG loading value = 77.21 μmol / g). In centrifuge tubes, 4-(dimethylamino)pyridine (1 mg, 9.900 μmol), pyridine (78 mg, 990.000 μmol), NMI (1 mg, 9.900 μmol), and Ac2O (34 mg, 330.000 μmol) were added to a solution of crude N3T12-060-01 (320 mg, 33 μmol) in 10 mL of ACN. The centrifuge tubes were placed on a wrist shaker and shaken at 25 °C (220 r / min) for 16 hours. The reaction solution was filtered, and the filter cake was washed with ACN (30 mL × 3). The filter cake was dried in a vacuum to obtain N3T12-060-01-2 (287.80 mg) as a white solid. The CPG loading value was measured (CPG loading value = 70.93 μmol / g).
[0339] Scheme 20. Synthesis of N3T12-063-01. N3T12-063-01-1: HATU (1.2 g, 3.166 mmol) and DIPEA (4.7 g, 36.535 mmol) were added to anhydrous DCM (20 mL) and anhydrous DMF (20 mL) solutions of docosanoic acid (996 mg, 2.923 mmol). The mixture was stirred at room temperature for 2 hours. Then, (…) S )-6-amino- N-(2,3-dihydroxypropyl)hexamethylenetetramine (500 mg, 2.436 mmol). The mixture was stirred at room temperature for another 16 hours. After the reaction was complete, the solvent was concentrated under reduced pressure to give N3T12-063-01-1 (1.3 g, crude product), a brown oil. The crude product was used in the next step without further purification.
[0340] N3T12-063-01-2: An 8 mL THF solution of DMTTrCl (1.3 g, 3.701 mmol) was added to a solution of N3T12-063-01-1 (1.3 g, 2.467 mmol) in anhydrous pyridine (15 mL). The mixture was stirred at room temperature for 16 hours. After the reaction was complete, the solution was diluted with EA (150 mL). The organic layer was washed with water and brine, dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by rapid silica gel column chromatography (0%–4% MeOH in DCM solution) to give N3T12-063-01-2 (500 mg, 0.603 mmol, 24.44%) as a pale yellow solid. LCMS: m / z 851.7 [(M+Na)] + ] 1 H NMR (400 MHz, DMSO-d6) δ 7.70 (t, J =5.6 Hz, 1H), 7.66 (t, J =5.6 Hz, 1H), 7.40 (d, J =7.6 Hz, 2H), 7.33–7.17 (m, 7H), 6.90-6.84 (m, 4H), 4.97 (d, J =5.0 Hz, 1H),3.76–3.65 (m, 7H), 3.31–3.22 (m, 1H), 3.02–2.81 (m, 5H), 2.01 (dd, J =14.0, 6.8Hz, 4H), 1.51–1.30 (m, 6H), 1.30–1.13 (d, J =20.5 Hz, 38H), 0.85 (t, J =6.6 Hz, 3H). N3T12-063-01-3: Tetrahydrofuran-2,5-dione (152 mg, 1.520 mmol), triethylamine (154 mg, 1.520 mmol), and 3-methylimidazole (46 mg, 0.557 mmol) were added to an anhydrous DCM (10 mL) solution of N3T12-063-01-2 (420 mg, 0.507 mmol). The mixture was stirred at room temperature for 16 hours. After the reaction was complete, the residue was purified by rapid silica gel column chromatography (0%–7% MeOH in DCM solution) and reversed-phase column chromatography (100% ACN) to give N3T12-063-01-3 (202 mg, 0.217 mmol, 42.92%) as a white solid. LCMS: m / z 952.4 [(M+Na)] + ] 1 HNMR (400 MHz, DMSO-d6) δ 11.42 (s, 1H), 7.79 (t, J =5.8 Hz, 1H), 7.71 (t, J =5.6Hz, 1H), 7.38–7.27 (m, 4H), 7.22 (d, J =8.8 Hz, 5H), 6.88 (d, J =8.8 Hz, 4H), 5.04–4.97 (m, 1H), 3.73 (s, 6H), 3.38–3.29 (m, 1H), 3.16–3.08 (m, 1H), 3.07–3.01 (m, 2H), 3.00–2.94 (m, 2H), 2.60–2.53 (m, 2H), 2.49–2.46 (m, 2H), 1.99(dt, J =21.2, 7.4 Hz, 4H), 1.50–1.42 (m, 2H), 1.41–1.28 (m, 4H), 1.29–1.12 (m,38H), 0.85 (t, J =6.6 Hz, 3H). N3T12-063-01: In a centrifuge tube, add DIPEA (14 mg, 109.761 μol) and HBTU (31 mg, 82.321 μol) to a solution of N3T12-063-01-3 (51 mg, 54.881 μol) in a mixture of ACN (9 mL) and N,N-dimethylformamide (3 mL). Add CPG (250 mg, 36 μmol) to the mixture. Place the centrifuge tube on a wrist shaker and shake at 25 °C (220 r / min) for 16 h. Filter the reaction solution and wash the filter cake with DCM (30 mL × 3), ACN (30 mL × 3), and n-hexane (30 mL × 3), respectively. The filter cake was dried under vacuum to obtain crude N3T12-063-01 (240 mg) as a white solid, and the CPG loading was then measured (CPG loading = 80.31 μol / g). In a centrifuge tube, 4-(dimethylamino)pyridine (4 mg, 29.907 μol), pyridine (237 mg, 2990.700 μol), NMI (3 mg, 29.907 μol), and Ac2O (102 mg, 996.900 μol) were added to a solution of crude N3T12-063-01 (240 mg, 99.69 μmol) in 10 mL of ACN. The centrifuge tube was placed on a wrist shaker and shaken at 25 °C (220 r / min) for 16 hours. The reaction solution was filtered, and the filter cake was washed with ACN (30 mL × 3). The filter cake was dried in a vacuum to obtain CN3T12-063-01 (219.77 mg) as a white solid, and then the CPG loading value was measured (CPG loading value = 70.69 umol / g).
[0341] Example 7. Dose screening of VEGFA siRNA duplexes in HuH7 cells siRNA was transfected into the human hepatocyte-derived cell line HuH7 in 96-well plates using RNAiMAX (Invitrogen, 13778075). All siRNAs were tested at 10 nM and 1 nM (Tables 9-10).
[0342] 24 hours after transfection, the culture medium was discarded, and the cells were collected for RNA extraction. Total RNA was extracted using the RNeasy® 96 kit (QIAGEN-74182) according to the kit instructions, and then reverse transcribed into cDNA using the FastKing RT kit (with gDNase) (Tiangen-KR116-02).
[0343] Quantification of target gene cDNA was performed by qPCR using specific primers and probes. β-actin cDNA was used as a housekeeping gene for parallel assays. 8 μL of PCR mixture and 2 μL of sample cDNA were added to a 384-well PCR plate. PCR was performed according to the following program: 95°C for 10 minutes; then, 95°C for 15 seconds, 60°C for 1 minute, for 40 cycles.
[0344] Table 9: Modified human VEGFA siRNA duplexes conjugated to the lipophilic portion Am, Cm, Gm, and Um represent the 2'-O-methyl (2'-OMe) sugar modification of adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent the 2'-deoxy-2'-fluoro (2'-F) sugar modification of adenosine, cytidine, guanosine, and uridine, respectively; s represents the thiophosphate (PS) bond; and VPUm represents vinyl phosphonate.
[0345] The lipid-modified structures listed in Table 9 include: [C5 cholesterol]: [N3T12-010-01]: [N3T12-012-01]: [N3T12-023-01]: [N3T12-019-01]: [N3T12-022-01]: [N3T12-018-01]: [Ahd]: [N3T12-024-01]: [VPUm]: Table 10: Dose screening of lipid-modified VEGFA siRNA in HuH7 cells The ability of compounds N3T070128-01 and N3T070133-01 in Table 9 to reduce VEGFA mRNA expression in wild-type rats was tested. PBS was used as a control. Six- to eight-week-old brown Norwegian rats (n=3 per group, 6 eyes in total) received a single intravitreal (IVT) injection of 25 μg of each compound in 2 μL solution, or a single IVT injection of 2 μL PBS. Seven days after IVT, the rats were euthanized, their eyes were enucleated, and the retina was dissected for RNA extraction. VEGFA mRNA levels in the rats were measured by real-time quantitative PCR. The mean percentage of expression from the six eyes was calculated and is shown in Table 11. The data indicate that N3T070128-01 significantly reduced VEGFA mRNA expression in the retina seven days after IVT injection.
[0346] Table 11. In vivo activity of lipid-conjugated VEGFA siRNA, 7 days The compounds in Table 9 were tested for their ability to reduce VEGFA expression in wild-type rats. PBS was used as a control. Six- to eight-week-old brown Norwegian rats (n=3 per group, 6 eyes total) received a single intravitreal (IVT) injection of 25 μg of each compound in 2 μL of solution, or a single IVT injection of 2 μL of PBS. Fourteen days post-IVT, the rats were euthanized, their eyes were enucleated, and the retina was dissected for RNA extraction. VEGFA mRNA levels in the rats were measured by real-time quantitative PCR. The mean percentage of expression from the six eyes was calculated and is shown in Table 12. The data indicate that N3T070128-01, N3T070129-01, and N3T070130-01 significantly reduced VEGFA mRNA expression in the retina 14 days post-IVT.
[0347] Table 12. In vivo activity of lipid-conjugated VEGFA siRNA, 14 days Example 8. Dose screening of siRNA duplexes with lipophilic moieties LRRK2 siRNA (Table 13) was added to human lung epithelial cells A549 in 96-well plates without transfection reagents. All siRNAs were tested at 10 μM and 3 μM. After 72 hours of free uptake, the culture medium was discarded, and cells were collected for RNA extraction. Total RNA was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit V2 (Vazyme-RC112-01) according to the kit instructions, and reverse transcribed into cDNA using HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme-R333-01). The cDNA of the target gene was quantified by qPCR using specific primers and probes. GAPDH cDNA was used as a housekeeping gene for parallel assays. The expression of the target gene in each test sample was determined by relative quantification (RQ) using the comparative Ct (ΔΔCt) method (Table 14).
[0348] Table 13: Modified human LRRK2 siRNAs conjugated to the lipophilic moiety The lipid-modified structures listed in Table 10 include: [Uhd]: [N3T12-012-01]: [VPUm]: Table 14: Human LRRK2 siRNA with lipophilic fraction in A549 cells via free uptake The knockdown activity of LRRK2 mRNA was tested by free uptake in A549 cells at 10 μM and 3 μM (Table 14). N3T130138-01 modified with [N3T12-012-01] showed good knockdown activity at both 10 μM and 3 μM.
[0349] Example 9. Dosage screening of ASO in A549 cells LRRK2 ASO (Tables 15-16) was added to human lung epithelial cells A549 in 96-well plates without transfection reagents. All ASOs were tested at 10 μM and 3 μM (Table 17). After 72 hours of free uptake, the culture medium was discarded, and cells were collected for RNA extraction. Total RNA was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit V2 (Vazyme-RC112-01) according to the kit instructions, and reverse transcribed into cDNA using HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme-R333-01). The cDNA of the target gene was quantified by qPCR using specific primers and probes. GAPDH cDNA was used as a housekeeping gene for parallel assays. The expression of the target gene in each test sample was determined by relative quantification (RQ) using the comparative Ct (ΔΔCt) method. The results are listed in Table 17.
[0350] Table 15. Nomenclature of nucleotides in ASO reagents Table 16. Human LRRK2 ASO from freely ingested A549 cells The lipid-modified structures listed in Table 16 include: [N3T12-012-01]: Table 17. In vitro evaluation of human LRRK2 ASO in A549 cells by free uptake N3T131128-01 modified with [N3T12-012-01] exhibits good knockdown activity.
[0351] Example 10. In vitro screening using dual-luciferase reporter gene assay. Modifications were introduced in the seed region (positions 2-8) of the AS strand (starting from the 5' end) to reduce off-target effects (Table 18). Modifications in the seed region of the siRNA guide strand enhanced siRNA specificity, mitigated off-target effects, while still allowing effective full-length target recognition.
[0352] Table 18: Sense and antisense sequences of human VEGFA dsRNA duplexes with off-target modifications In vitro screening in dual-luciferase reporter gene assay 293A cells were grown to near confluence in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Gibco) at 37°C under a 5% CO2 atmosphere. Single-dose experiments were performed at a final duplex concentration of 50 nM. Following the manufacturer's instructions, cells were co-transfected with 100 ng of luciferase reporter plasmid (YEASEN) and 50 nM siRNA in 96-well plates (12,000 cells / well) using 0.4 μL / well Lipofectamine 2000 (Thermo Fisher Scientific, CN2541156), followed by incubation at room temperature for 18 min. Firefly luciferase (transfected control) and Renilla luciferase (fused to the target sequence) were measured 24 hours post-transfection with siRNA and luciferase reporter plasmid. siRNA activity was determined by normalizing the signal from Renilla luciferase (target sequence) in each well relative to the signal from firefly luciferase (control) (Table 19). The specific insertion sequences are as follows: GTCGCATA TAATATTACATAAATAAAA GTCGCATA TAATATTACATAAATAAAA GTCGCATA [SEQ IDNO: 269] The results are listed in Table 19-21.
[0353] Table 19: In vitro dual-luciferase 50 nM screening of off-target modified siRNAs Off-target effects are primarily driven by the binding of RISC-loaded siRNAs to off-target transcripts, mediated by base pairing between the seed region (nucleotides 2-8) of the siRNA guide strand and complementary sites in the mRNA. Thermally unstable modifications to the seed region of the siRNA guide strand enhance siRNA specificity and mitigate off-target effects while still allowing for effective full-length target recognition. Unmodified N3T120021-01 exhibits very strong inhibition of Renal luciferase signaling. When N3T120022-01, N3T120024-01, and N3T120024-01 are co-transfected with a luciferase reporter plasmid, Renal luciferase signaling is significantly enhanced, indicating that modifications of [N3T12-027-01] and [N3T12-031-01] can mitigate off-target effects.
[0354] In order to observe ( S ) / (R To investigate how enantiomers affect Renal luciferase signaling, 14 siRNAs were synthesized, as shown in Table 20.
[0355] HEK-293a cells were grown to near confluence in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Gibco) at 37°C under a 5% CO2 atmosphere. Following the manufacturer's instructions, cells were co-transfected with 10 ng of luciferase reporter plasmid (YEASEN) and siRNA in 96-well plates (8000 cells / well) using 0.4 μL / well Lipofectamine 2000 (Thermo Fisher Scientific), followed by incubation at room temperature for 18 min. Firefly luciferase (transfected control) and Renilla luciferase (fused to the target sequence) were measured 24 h post-transfection (Table 21). siRNA activity was determined by normalizing the Renilla luciferase (target sequence) signal in each well relative to the firefly luciferase (control) signal. The targeted / off-target reporter plasmid contains the following sequence in the 3'-UTR of Renal luciferase. The specific insertion sequence is as follows: HBV Targeting: 5' GTTGACAAGAATCCTCACAAT3' [SEQ ID NO: 270] HBV off-target effect: 5'TGGTCACCTCCGACTCACAAT****TGGTCACCTCCGACTCACAAT****TGGTCACCTCCGACTCACAAT****TGGTCACCTCCGACTCACAAT****TGGTCACCTCCGACTCACAAT3' [SEQ ID NO: 271] VEGFA targeting: 5'TGTGAATGCAGACCAAAGAAA3' [SEQ ID NO: 272] VEGFA off-target: 5'GTGTCCGTACTCACAAAGAAA****GTGTCCGTACTCACAAAGAAA****GTGTCCGTACTCACAAAGAAA****GTGTCCGTACTCACAAAGAAA****GTGTCCGTACTCACAAAGAAA3' [SEQ ID NO: 273] ****: Special nucleotide DNA linker 20240724SS14 from Suzhou Beixin Biomedical Technology Co., Ltd. The results are listed in Table 21.
[0356] Table 20: siRNAs with off-target modifications Table 21. Evaluation of targeted and off-target siRNAs using dual-luciferase reporter assay most( S ) / ( R The enantiomers at concentrations of 50 nM and 10 nM both increased off-target inhibition of René luciferase signaling, while maintaining full-length targeted inhibition at 1 nM.
[0357] Example 11. Evaluation of ANGPT2 siRNA with off-target modifications by transfection in vitro. siRNA (Table 22) was transfected into RMG-I cells in 48-well plates using RNAiMAX (Invitrogen, 13778075). All siRNAs were tested at 1 nM and 0.1 nM (Table 23). Forty-eight hours post-transfection, the culture medium was discarded, and cells were collected for RNA extraction. Total RNA was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit V2 (Vazyme-RC112-01) according to the kit instructions, and reverse transcribed into cDNA using HiScript IV All-in-One Ultra RT SuperMix for qPCR (Vazyme-R433-01). The cDNA of the target gene was quantified by qPCR using specific primers and probes. GAPDH cDNA was used as a housekeeping gene for parallel assays. 14 μL of PCR mixture and 6 μL of sample cDNA (5-fold dilution) were added to a 96-well PCR plate. PCR was performed according to the following program: 2 min at 37°C; 5 min at 95°C; then 40 cycles of 10 s at 95°C and 30 s at 60°C. The results are shown in Table 23.
[0358] Table 22. Human ANGPT2 siRNAs with off-target modifications Am, Cm, Gm, and Um represent the 2'-O-methyl (2'-OMe) sugar modification of adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent the 2'-deoxy-2'-fluoro (2'-F) sugar modification of adenosine, cytidine, guanosine, and uridine, respectively; and s represents the phosphate thioester (PS) bond.
[0359] Table 23. Screening of human ANGPT2 siRNA by transfection in vitro Example 12. Evaluation of human LRRK2 siRNA with off-target modifications by transfection in vitro. In 96-well plates, siRNA (Table 24) was transfected into human lung epithelial cells A549 using RNAiMAX (Invitrogen, 13778075). All siRNAs were tested at 1 nM and 0.1 nM (Table 25). Forty-eight hours post-transfection, the culture medium was discarded, and cells were collected for RNA extraction. Total RNA was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit V2 (Vazyme-RC112-01) according to the kit instructions, and reverse transcribed into cDNA using HiScript III All-in-one RT SuperMixPerfect for qPCR (Vazyme-R333-01). The cDNA of the target gene was quantified by qPCR using specific primers and probes. GAPDH cDNA was used as a housekeeping gene for parallel assays. The expression of target genes in each test sample was determined by relative quantification (RQ) using the comparative Ct (ΔΔCt) method. The results are listed in Table 25.
[0360] Table 24: Human LRRK2 siRNAs with off-target modifications Am, Cm, Gm, and Um represent the 2'-O-methyl (2'-OMe) sugar modification of adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent the 2'-deoxy-2'-fluoro (2'-F) sugar modification of adenosine, cytidine, guanosine, and uridine, respectively; and s represents the phosphate thioester (PS) bond.
[0361] Table 25. Screening of human LRRK2 siRNA in vitro by transfection The 5th position of the antisense chain contains [N3T1-U-]. R ] or has [N3T1-A-] at position 7 of the antisense chain. R Modifications on N3T120059-01 can maintain LRRK2 mRNA knockdown activity.
[0362] Example 13. In vivo study of human VEGFA siRNA and ANGPT2 siRNA in Sprague Dawley rats The compounds N3T070128-03, N3T120055-01, N3T120068-01, and N3T120070-01 in Table 26 were tested for their ability to reduce VEGFA and ANGPT2 expression in Sprague Dawley rats. PBS was used as a control. Six- to eight-week-old Sprague Dawley rats (n=3 per group, six eyes in total) received a single intravitreal (IVT) injection of 10 μg of each compound in 2 μL of solution, or a single IVT injection of 2 μL of PBS. Fourteen days after IVT, the rats were euthanized, their eyes were enucleated, and the retinas were dissected for RNA extraction. VEGFA and ANGPT2 mRNA levels in the rats were measured by real-time quantitative PCR. The mean percentage of expression from the six eyes was calculated and is shown in Tables 27 and 28.
[0363] Table 26: Human VEGFA siRNA and ANGPT2 siRNA used in in vivo studies Table 27. In vivo activity of human VEGFA siRNA, 14 days Table 28. In vivo activity of human ANGPT2 siRNA, 14 days N3T070128-03 and N3T120068-01 with off-target modifications can maintain knockdown activity in vivo.
[0364] Example 14. In vivo study of human LRRK2 siRNA in C57BL / 6J-Tg(LRRK2*G2019S)2AMjff / J mice The ability of human LRRK2 siRNAs N3T130138-01, N3T130146-01, N3T130148-01, and N3T130149-01 in Table 29 to reduce LRRK2 mRNA expression in male C57BL / 6J-Tg(LRRK2*G2019S)2AMjff / J mice (2–3 mice / group) was tested. PBS was used as a control treatment. 10 μL of 300 μg of each siRNA was administered bilaterally (5 μL / ventricle) to the lateral ventricles of the mice. Mice were euthanized on day 14 post-administration. Cortical tissue was collected and stored at -80°C until further analysis.
[0365] Table 29. Human LRRK2 siRNAs used in in vivo studies Am, Cm, Gm, and Um represent the 2'-O-methyl (2'-OMe) sugar modification of adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent the 2'-deoxy-2'-fluoro (2'-F) sugar modification of adenosine, cytidine, guanosine, and uridine, respectively; and s represents the phosphate thioester (PS) bond.
[0366] The level of LRRK2 mRNA was quantified by real-time PCR, and the results are presented in Table 30. Compared with N3T070129-02 (which has the same sequence and C16 lipid conjugation as AD-1807334 in WO2023278607A1, the contents of which are incorporated herein by reference to the fullest extent permitted by law), N3T130138-01, N3T070146-02, and N3T070149-01 exhibited better knockdown activity in vivo.
[0367] Table 30. In vivo activity of human LRRK2 siRNA, 14 days The levels of Lrrk2 protein and phosphorylated Lrrk2 (p-Lrrk2) associated with Parkinson's disease were measured by Western blotting, and the average percentage of expression was calculated (Tables 31 and 32).
[0368] Table 31. In vivo activity of human LRRK2 siRNA, 14 days Table 32. In vivo activity of human LRRK2 siRNA, 14 days N3T130138-01, N3T070146-01, N3T070148-01 and N3T070149-01 exhibit good knockdown activity against Lrrk2 protein in vivo.
[0369] Example 15: RISC Load Modification of the First Position of the Antisense Chain RNA-induced silencing complexes, or RISCs, are ribonucleoprotein complexes that load the antisense strand of a dsRNA duplex. Once loading is complete, the antisense RNA on the RISC recognizes the complementary mRNA, and subsequently, an Argonaute protein in the RISC is activated and cleaves the mRNA, leading to mRNA degradation and gene expression silencing. Modifications to the ends of the antisense strand by nucleosides and analogues (e.g., scheme 21) at the RISC effector protein Argonaute 2 (AGO2) can enhance RNA loading onto the RISC.
[0370] Synthesis of Scheme 21. N3T12-029-01. N3T12-029-01-2: Calcium carbonate (49.73 g, 496.82 mmol) was slowly added to a cold (0°C) aqueous solution (400 mL) containing N3T12-029-01-1 (50 g, 283.90 mmol) over 10 minutes at 0°C (CO2 release was observed). 30% H2O2 (100 mL) was added dropwise to the resulting heterogeneous slurry over 1 hour at 0°C. The reaction mixture was warmed to room temperature and stirred overnight. The mixture was filtered, and the filter cake was washed with water (3 x 50 mL). The filtrate was treated with activated carbon (10 g, 283.90 mmol), and the reaction mixture was stirred at 50°C until no peroxides were detected (approximately 3 hours). The mixture was filtered, and the filter cake was washed with water (3 x 50 mL). The filtrate was treated with MeOH (2 L), and the mixture was stirred at 4°C for 16 h. The mixture was filtered and the filter cake was washed with MeOH (3 x 30 mL) to give N3T12-029-01-2 (25 g, 142.72 mmol, 50.27%) as a white solid. 1 H NMR (400 MHz, D2O) δ ppm 3.98 (d, J =2.2Hz, 1H), 3.90 (ddd, J =7.4, 5.0, 2.2 Hz, 1H), 3.61 (dd, J =11.4, 5.0 Hz, 1H), 3.54 (dd, J =11.4, 7.6 Hz, 1H). N3T12-029-01-3: Oxalic acid (3.13 g, 34.81 mmol) and pTSA-H2O (0.13 g, 0.70 mmol) were added to an anhydrous acetonitrile (100 mL) solution of N3T12-029-01-2 (10.8 g, 34.81 mmol). The reaction mixture was stirred at 90 °C under a nitrogen atmosphere for 3 h. The mixture was filtered, and the filter cake was washed with acetonitrile (3 x 50 mL). The filtrate was concentrated under vacuum to obtain N3T12-029-01-3 (3.9 g, 33.03 mmol, 47.45%) as a colorless slurry. 1 H NMR (400 MHz, MeOD) δ4.42 (dd, J =8.8, 6.6 Hz, 1H), 4.29 (dd, J =14.0, 7.0 Hz, 1H), 4.20 (d, J=7.2 Hz, 1H), 3.94 (dd, J =8.8, 7.2 Hz, 1H). N3T12-029-01-4: Dichloromethyl(2-methylpropyl-2-yl)silane (5.97 g, 39.63 mmol) was added dropwise to a solution of N3T12-029-01-3 (3.9 g, 33.03 mmol) and imidazole (4.50 g, 66.05 mmol) in ACN (50 mL) at 0 °C under a N2 atmosphere. The reaction mixture was slowly heated to room temperature and stirred overnight. The reaction was quenched with H2O (20 mL), and the mixture was extracted with H2O / DCM (3 x 50 mL). The combined organic layers were dried over Na2SO4, and the solvent was removed under vacuum. The residue was purified by rapid column chromatography (eluting with PE solution of 0%–20% EA) to give N3T12-029-01-4 (3.3 g, 14.20 mmol, 43.01%) as a white solid. 1 H NMR (400 MHz, DMSO) δ 5.82 (d, J =5.2 Hz, 1H), 4.34 - 4.30 (dd, J =8.0, 6.4 Hz, 2H), 4.17 (ddd, J =13.8, 7.2, 5.2 Hz, 1H),3.87 (dd, J =8.6, 7.4 Hz, 1H), 0.89 (s, 9H), 0.12 (s, 6H). N3T12-029-01-5: Benzoyl chloride (2.60 g, 18.46 mmol) was added to a pyridine (35 mL) solution of N3T12-029-01-4 (3.3 g, 14.20 mmol) at 0 °C. The reaction mixture was stirred at room temperature under a nitrogen atmosphere for 16 hours. The reaction was quenched with H2O (30 mL), and the mixture was extracted with DCM (3 x 50 mL). The combined organic layers were dried over Na2SO4, and the solvent was removed under vacuum (co-evaporated three times with toluene). The residue was purified by rapid column chromatography (eluting with PE solution of 0%–10% EA) to give N3T12-029-01-5 (4.65 g, 13.82 mmol, 97.31%) as a colorless oil. 1 H NMR (400MHz, DMSO) δ ppm 8.03–7.97 (m, 2H), 7.74–7.68 (m, 1H), 7.60–7.54 (m, 2H),5.49 (q, J=7.0 Hz, 1H), 4.98 (d, J =7.0 Hz, 1H), 4.68 (dd, J =9.2, 7.2 Hz, 1H), 4.23 (dd, J =9.2, 7.0 Hz, 1H), 0.87 (s, 9H), 0.15 (s, 3H), 0.12 (s, 3H).LCMS: m / z 337.4 [(M +H) + ]. N3T12-029-01-6: DIBAL-H (15.20 mL, 1 M) was added to a tetrahydrofuran (40 mL) solution of N3T12-029-01-5 (4.65 g, 13.82 mmol) under a N2 atmosphere at -78 °C for 20 min. The reaction mixture was stirred at -78 °C for 5 h. The reaction was quenched at -78 °C with MeOH (10 mL, added over 10 min) and stirred at this temperature for 20 min. The mixture was then extracted with H2O / DCM (3 x 40 mL), and the combined organic layers were dried over Na2SO4. The combined organic matter was concentrated under vacuum, and the residue was purified by rapid column chromatography (eluting with PE solution of 0%–15% EA) to give N3T12-029-01-6 (3.87 g, 11.43 mmol, 82.73%) as a white solid. 1 H NMR (400 MHz, DMSO) δ ppm 8.01–7.94 (m, 2H), 7.72–7.64 (m, 1H), 7.59–7.50 (m, 2H), 6.54 -6.28 (m, 1H), 5.25–5.02 (m, 2H), 4.34 - 4.15 (m, 1H), 4.16 (t, J =1.6 Hz, 1H),3.95- 3.62 (m 1H), 0.90–0.82 (m, 9H), 0.13–0.06 (m, 6H).LCMS: m / z 321.4 [(M-OH) + ]. N3T12-029-01-7: Imidazole (1.71 g, 25.15 mmol) and dimethylchloro(2-methylpropyl-2-yl)silane (2.58 g, 17.15 mmol) were added to a solution of N3T12-029-01-6 (3.87 g, 11.43 mmol) in 40 mL of ACN at 0 °C under a N2 atmosphere. The reaction mixture was stirred at room temperature for 16 hours. The reaction was quenched with H2O (30 mL) and extracted with H2O / DCM (3 x 50 mL). The combined organic layers were dried over Na2SO4 and the solvent was removed under vacuum to give N3T12-029-01-7 (5 g, crude product) as a colorless oil. The crude product was used in the next step without further purification. LCMS: m / z 321.4 [(M-OTBDMS) + ]. N3T12-029-01-8: N3T12-029-01-7 (5 g, 11.04 mmol) was dissolved in ammonia-saturated MeOH (50 mL, 350.00 mmol, 7 M). The reaction mixture was stirred at room temperature for 48 hours. The solvent was removed under vacuum, and the residue was purified by rapid column chromatography (eluting with PE solution of 0%–15% EA) to give N3T12-029-01-8 (3.3 g, 9.47 mmol, 85.71%) as a colorless oil (two isomers). 1 H NMR (400 MHz, DMSO) δ ppm 5.10 (d, J =4.8 Hz, 1H), 5.00 (d, J =1.4 Hz, 1H), 3.96 (dd, J =8.6, 6.0 Hz, 1H), 3.91 - 3.86(m, 2H), 3.62 (dd, J =8.4, 5.6 Hz, 1H), 0.87 (s, 18H), 0.07 (dd, J =4.4, 2.0 Hz, 12H). 1 H NMR (400 MHz, DMSO) δ ppm 5.13 (t, J =4.8 Hz, 2H), 4.07–4.01 (m, 1H), 4.06–4.01 (m, 1H), 3.81 (dd, J =5.2, 3.8 Hz, 1H), 3.41 (dd, J =8.4, 4.4 Hz, 1H), 0.87 (d, J=3.8 Hz, 18H), 0.08–0.05 (m, 12H). N3T12-029-01-9: LiHMDS (19.56 mL, 1 M) was added to a tetrahydrofuran (15 mL) solution of N3T12-029-01-8 (3.1 g, 8.89 mmol) at -78 °C. The reaction mixture was stirred at this temperature under a nitrogen atmosphere for 1 hour. Then, (diethoxyphosphoryl)methyltrifluoromethanesulfonate (6.67 g, 22.23 mmol) was added dropwise, and the reaction was slowly heated to 0 °C. The reaction mixture was stirred at 0 °C for 2 hours. The solvent was quenched with H2O (30 mL) and extracted with H2O / DCM (3 x 50 mL). The combined organic layers were dried over Na2SO4 and the solvent was removed under vacuum. The residue was purified by rapid column chromatography (eluting with PE solution of 0%-60% EA) to obtain N3T12-029-01-9 (3.35 g, 6.72 mmol, 75.54%) as a colorless oil. 1 H NMR (400 MHz, DMSO) δ ppm 5.15–5.02 (m, 1H), 4.12–3.88 (m,7H), 3.84 (dd, J =9.0, 6.2 Hz, 2H), 3.80–3.58 (m, 1H), 1.23 (t, J =7.0 Hz, 6H), 0.87–0.86 (m, 18H), 0.13–0.02 (m, 12H). 31 P NMR (162 MHz, DMSO) δ ppm 20.78,20.53. N3T12-029-01-10: TFA (9 mL) was added to a 3 mL aqueous solution of N3T12-029-01-9 (1.85 g, 3.71 mmol) at 0 °C. The reaction mixture was stirred at room temperature for 2 hours. TLC showed that the reaction was complete. The reaction mixture was concentrated under vacuum, and the residue was purified by rapid column chromatography (eluting with 0%–10% MeOH in DCM solution) to give N3T12-029-01-10 (798 mg, 2.95 mmol, 79.80%) as a colorless oil. 1 H NMR (400 MHz, DMSO) δppm 6.18–6.14 (t, J=7.8 Hz, 1H), 5.46–5.07 (m, 1H), 5.05–4.89 (m, 1H), 4.12–3.88 (m, 6H), 3.88–3.69 (m, 4H), 1.23 (t, J =7.0 Hz, 6H). 31 P NMR (162 MHz, DMSO) δ ppm 21.07, 21.04. N3T12-029-01-11: Benzoyl chloride (1.25 g, 8.86 mmol) was added to a pyridine (10 mL) solution of N3T12-029-01-10 (798 mg, 2.95 mmol) at 0 °C. The reaction was heated to room temperature and stirred for 16 hours under a N2 atmosphere. The reaction was quenched with H2O (20 mL), and the mixture was extracted with H2O / DCM (3 x 20 mL). The combined organic layers were dried over Na2SO4, and the solvent was removed under vacuum (evaporated three times with toluene). The residue was purified by rapid column chromatography (eluting with PE solution of 0%-95% EA) to give N3T12-029-01-11 (950 mg, 1.99 mmol, 67.24%) as a colorless oil. LCMS: m / z 501.3 [(M+Na) + ]. N3T12-029-01-12: N,O-bis(trimethylsilyl)acetamide (940 mg, 4.62 mmol) was added to a solution of 1,2,3,4-tetrahydropyrimidine-2,4-dione (235 mg, 2.10 mmol). The reaction mixture was stirred at 65 °C under a nitrogen atmosphere for 10 min. Then, the reaction mixture was cooled to 0 °C, and N3T12-029-01-11 (670 mg, 1.40 mmol) and SnCl4 (1.46 g, 5.60 mmol) were added dropwise under an ice bath. The reaction mixture was stirred at room temperature for 4 h. The reaction was quenched with H2O (3 mL), and the solvent was removed under vacuum (evaporated three times with THF). The residue was purified by rapid column chromatography (eluting with 0%-7% MeOH in DCM solution) to give N3T12-029-01-12 as a white solid (650 mg, 1.39 mmol, 99.09%). 1 H NMR (400 MHz, DMSO) δ ppm 11.42 (s, 1H), 8.03 (d, J =7.4 Hz, 2H), 7.72 (t, J=7.4 Hz, 1H), 7.65–7.54 (m, 3H), 6.03 (d, J =1.4 Hz, 1H), 5.62 (dd, J =8.0, 2.0Hz, 1H), 5.43 (s, 1H), 4.40–4.34 (m, 2H), 4.16 (dd, J =10.8, 4.2 Hz, 1H), 4.09–4.00 (m, 6H), 1.23 (t, J =7.0 Hz, 6H). 31 P NMR (162 MHz, DMSO) δ ppm 20.54.LCMS: m / z 469.3 [(M+H) + ]. N3T12-029-01-13: N3T12-029-01-12 (650 mg, 1.39 mmol) was dissolved in ammonia-saturated MeOH (5 mL, 35.00 mmol, 7 M). The reaction mixture was stirred at room temperature for 16 hours. The solvent was removed under vacuum, and the residue was purified by rapid column chromatography (eluting with 0%–10% MeOH in DCM solution) to give N3T12-029-01-13 (467 mg, 1.28 mmol, 92.38%) as a white solid. 1 H NMR (400 MHz, DMSO) δ ppm 11.32 (s, 1H),7.53 (d, J =8.0 Hz, 1H), 5.94 (d, J =4.0 Hz, 1H), 5.66 (d, J =1.0 Hz, 1H), 5.51(dd, J =8.0, 2.0 Hz, 1H), 4.27 (d, J =10.2 Hz, 1H), 4.16 (s, 1H), 4.07–3.97 (m,6H), 3.95–3.83 (m, 2H), 1.22 (td, J =7.0, 1.2 Hz, 6H). LCMS: m / z 365.1 [(M+H) + ]. N3T12-029-01: At 0 °C and under a N2 atmosphere, diisopropylammonium tetrazolium (329 mg, 1.92 mmol) and 3-{[2,6-dimethyl-3,5-di(prop-2-yl)-3,5-diaza-4-phosphatehept-4-yl]oxy}propionitrile (773 mg, 2.56 mmol) were added to an anhydrous DCM (10 mL) solution of N3T12-029-01-13 (467 mg, 1.28 mmol). The reaction mixture was stirred at room temperature for 16 hours. The reaction mixture was extracted with NaHCO3 (aqueous solution) / DCM (3 x 20 mL) and the combined organic layers were dried over Na2SO4. The solvent was removed under vacuum, and the residue was purified by reverse-phase column chromatography (eluting with 0%–60% ACN in H₂O solution) to give N₃T₁₂-029-01 as a colorless slurry (585 mg, 1.04 mmol, 80.84%) (an additional 150 mg was obtained from a small-scale reaction). LCMS: m / z 565.2[(M+H) + ]. 1 H NMR (400 MHz, DMSO) δ ppm 11.36 (s, 1H),7.55 (dd, J =8.0, 1.6 Hz, 1H), 5.77 (d, J =19.6 Hz, 1H), 5.54 (dd, J =8.0, 1.8 Hz,1H), 4.45–4.32 (m, 2H), 4.21–4.12 (m, 1H), 4.06–3.93 (m, 6H), 3.91–3.71 (m,3H), 3.64–3.52 (m, 2H), 2.81–2.75 (m, 2H), 1.23–1.19 (m, 6H), 1.16–1.12 (m,12H). 31 P NMR (162 MHz, DMSO) δ ppm 150.04, 149.54, 20.52, 20.48. The effects of incorporating N3T12-029-01 or another nucleotide analog VPU at the 5'-end of the antisense strand were evaluated.
[0371] Table 33. VEGFA siRNAs with RISC loading modification at position 1 of the antisense strand.
[0372] Dose screening was performed on VEGFA dsRNA duplexes with RISC loading modification at position 1 of the antisense strand in HuH7. select In 96-well plates, siRNA (Table 33) was transfected into the human hepatocyte-derived cell line HuH7 using RNAiMAX (Invitrogen, 13778075). All siRNAs were tested at 10 nM and 1 nM (Table 34). 24 hours post-transfection, the culture medium was discarded, and cells were collected for RNA extraction. Total RNA was extracted using the RNeasy® 96 kit (QIAGEN-74182) according to the kit instructions and reverse transcribed into cDNA using the FastKing RT kit (with gDNase) (Tiangen-KR116-02). The cDNA of the target gene was quantified by qPCR using specific primers and probes. β-actin cDNA was used as a housekeeping gene for parallel assays. 8 μL of PCR mixture and 2 μL of sample cDNA were added to a 384-well PCR plate. PCR was performed as follows: 10 minutes at 95°C; then 15 seconds at 95°C and 1 minute at 60°C, for 40 cycles.
[0373] Table 34. Dosage screening of VEGFA siRNAs with RISC loading modification at position 1 of the antisense strand in HuH7 cells. The guide strand of the siRNA duplex may carry a 5'-phosphate or other analogue to bind to the effector protein Argonaute 2 (AGO2) of the RNA-induced silencing complex. N3T120038-01 and N3T070162-01 are unmodified and exhibit good VEGFA mRNA repression. N3T120034-01, N3T120035-01, N3T120036-01, and N3T120037-01 show relatively high knockdown efficacy at 10 nM and 1 nM.
Claims
1. An RNAi agent comprising a sense sequence and a complementary antisense sequence, or comprising an antisense oligonucleotide (ASO), wherein the siRNA duplex or ASO: a) comprises one or more sequences corresponding to the LRRK2 gene region; or b) comprises one or more sequences corresponding to the VEGFA gene region; or c) comprises one or more sequences corresponding to the ANGPT2 gene region [e.g., any one of compound 1 and thereafter, compound 3 and thereafter, and / or compound 5 and thereafter described above].
2. An RNAi agent comprising a sense sequence and a complementary antisense sequence, or comprising an antisense oligonucleotide (ASO), wherein the siRNA duplex or ASO comprises a lipophilic moiety, such as a lipid moiety, such as an alkyl or alkenyl group, such as C 12-22 Alkyl or alkenyl [for example, any one of compound 1 and thereafter, compound 3 and thereafter, and / or compound 5 and thereafter described above].
3. An RNAi agent comprising a sense sequence and a complementary antisense sequence, or comprising an antisense oligonucleotide (ASO), wherein the siRNA duplex or ASO contains off-target modifications, such as modifications that effectively reduce off-target effects, such as modifications at one or both ends of the sense or antisense strand or at any position in the sense or antisense strand, such as according to any one of compound 1 and subsequent compounds, compound 3 and subsequent compounds, and / or compound 5 and subsequent compounds.
4. The RNAi agent as claimed in any of the preceding claims, wherein the siRNA or ASO comprises a lipophilic moiety, such as a lipid conjugate; for example, according to the general formula or structure of any one of compound A, compound 1 and subsequent compounds, compound 3 and subsequent compounds, and / or compound 5 and subsequent compounds; for example, wherein the sense strand comprises one or more lipophilic moieties L1, which are conjugated to the siRNA or ASO at one or both ends of the sense strand via a phosphodiester bond or a thiophosphate bond (e.g., via a ribosyl moiety linked to a phosphodiester bond or a thiophosphate bond), for example, according to any one of compound A and subsequent compounds and / or compound 3 and subsequent compounds.
5. The RNAi agent as claimed in any of the preceding claims, wherein the siRNA or ASO comprises off-target modifications; for example, according to the general formula or structure of any one of compound A, compound 1 and subsequent compounds, compound 3 and subsequent compounds, and / or compound 5 and subsequent compounds.
6. The siRNA duplex as claimed in any of the preceding claims, wherein the nucleotide sequences of the sense strand and the antisense strand are 15-30 nucleotides in length, wherein the sequence offset is 1, 2, 3 or more nucleotides and / or one strand is 1, 2, 3 or more nucleotides longer than the other strand, such that there are overhangs at one or both ends; for example, wherein the sense strand is 19 nucleotides long and the antisense strand is 21 nucleotides long, or the sense strand is 20 nucleotides long and the antisense strand is 22 nucleotides long, or the sense strand is 21 nucleotides long and the antisense strand is 23 nucleotides long, such that the siRNA duplex has two nucleotide overhangs, for example, wherein the overhangs extend beyond the 5' end of the sense sequence.
7. The siRNA duplex as claimed in any of the preceding claims, wherein the nucleotide sequences of the sense strand and the antisense strand are 15-30 nucleotides in length, wherein the sequences have blunt ends at one or both ends of the siRNA duplex.
8. The siRNA double strand or ASO as described in any of the preceding claims, wherein the antisense sequence can hybridize with a sequence selected from the hotspot regions in Table 2a.
9. The siRNA duplex as claimed in any of the preceding claims, wherein the sense sequence comprises a sequence selected from Tables 1-34.
10. Any of the preceding compounds, comprising a sense sequence or antisense sequence selected from the sequences listed in Table 5.
11. Any of the aforementioned compounds is selected from the double strands listed in Table 5.
12. The RNAi agent as claimed in any of the preceding claims, wherein the siRNA duplex or ASO comprises one or more sequence modifications selected from the group consisting of: Phosphorylated 5' end, 3' overhang, phosphonated 5' end, UNA and / or GNA motif, lipophilic motif, thiophosphate bond, modified nucleotide (such as 2'-deoxy-2'-fluorine and / or 2'-O-methylribose), and combinations thereof; optionally, said modification is present between nucleotides 2-8 in the antisense sequence from 5' to 3', for example, said modification is present between nucleotides 5-7, for example, said modification is present at nucleotide 5, for example, said modification is present at nucleotide 7.
13. The RNAi agent as claimed in any of the preceding claims, which effectively and significantly improves the delivery of the RNAi agent to selected treatment sites, such as the central nervous system, in patients in need.
14. The RNAi agent as claimed in any of the preceding claims, which effectively and significantly reduces off-target effects, such as side effects or symptoms, after administration of siRNA or ASO to a patient in need.
15. The siRNA double strand or ASO as described in any of the preceding claims, which effectively and significantly reduces LRRK2 mRNA in cells.
16. The siRNA duplex as claimed in any of the preceding claims, wherein the seed region nucleotides (nucleotides 2-8) on the AS may comprise one or more of the following nucleotides: Equation 1a: For example, equation 1a1: For example, equation 1a2: Formula 1b: For example, equation 1b1: For example, Equation 1c: For example, equation 1c1: in X = O, S, NH, -CONH- or -NHCO-; and B is a modified or unmodified nucleobase, R1, R2, R3, and R4 are independently H, halogen, OR5, or alkyl; and R5 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar.
17. The siRNA duplex as claimed in any of the preceding claims, wherein the modified siRNA is an RNA duplex comprising a sense strand and an antisense strand, wherein the sense strand comprises one or more lipophilic moieties L1 or L2, the lipophilic moieties L1 or L2 being conjugated to the siRNA via a phosphodiester bond or a thiophosphate bond, and its structure conforms to Formula 2: in X = O or S; a=0-4; b=0-4; c=0-4; d=0-4; The condition is that b and d are not both 0; and the band represents a meaningful chain.
18. The siRNA duplex according to claim 17, wherein the sense strand... It meets one of the following conditions: Equation 2a: For example, equation 2a1: For example, equation 2a2: For example, equation 2a3: For example, equation 2a4: in, R2, R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p=0-10, preferably 0-2; q=0-10, preferably 1-2; n=0-10; m=1-30; Equation 2b: For example, equation 2b1: For example, equation 2b2: For example, equation 2b3: For example, equation 2b4: in, R2, R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p=0-10, preferably 0-2; q=0-10, preferably 1-2; n=0-10; m=1-30。 19. The siRNA duplex as claimed in any of the preceding claims, wherein the sense strand is... It meets one of the following conditions: Equation 2c: For example, equation 2c1: For example, equation 2c2: For example, equation 2c3: For example, equation 2c4: in, R2, R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p=0-10, preferably 0-2; q=0-10, preferably 1-2; n=0-10; m=1-30; Equation 2d: For example, equation 2d1: For example, equation 2d2: For example, equation 2d3: For example, equation 2d4: in, R2, R3, R4, R5, R6, R7, R8, R9, R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p=0-10, preferably 0-2; q = 1-10, preferably 1-2; n=0-10; m=1-30。 20. The siRNA duplex as claimed in any of the preceding claims, wherein the sense strand... It meets one of the following conditions: Equation 2e: Where a=0, b=1, c=0, and d=0 For example, equation 2e1: For example, equation 2e2: For example, equation 2e3: For example, equation 2e4: in, R3, R4, R5, R6, R7, R8, R9 and R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p=0-10, preferably 0-2; n=0-10; m=1-30; Equation 2f: For example, equation 2f1: For example, equation 2f2: For example, equation 2f3: For example, equation 2f4: in, R3, R4, R5, R6, R7, R8, R9 and R 10 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p=0-10, preferably 0-2; q=0-10; n=0-10; m=1-30。 21. The siRNA duplex as claimed in any of the preceding claims, wherein the sense strand... It meets one of the following conditions: Formula 2g: For example, equation 2g1: For example, equation 2g2: For example, equation 2g3: For example, equation 2g4: in, R2, R3, R4, R5, R6, R7, R8, R9, R 10 and R 11 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p=0-10, preferably 0-2; q=0-10, preferably 1-2; n=0-10; m=1-30; Formula 2h: For example, equation 2h1: For example, equation 2h2: For example, equation 2h3: For example, equation 2h4: in, R3, R4, R5, R6, R7, R8, R9, R 10 and R 11 Each is independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, -CH2O-, -OCH2-, or -SS-; Z can be O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; p=0-10, preferably 0-2; q = 1-10, preferably 1-2; n=0-10; m=1-30; The condition is that the O with a wavy line on L1 or L2 is part of a phosphodiester bond or a thiophosphate bond connected to a sense chain. For example, in X = O or S; and the band represents a meaningful chain.
22. The siRNA duplex as claimed in any of the preceding claims, wherein the selected nucleotide is linked to a 2'-O lipid conjugate portion or an adamantyl group on the sense strand, and its structure conforms to one of the following formulas: Equation 2i: ; For example: For example, equation 2i1: For example, equation 2i2: in, R7, R8 and R9 are each independently H, a halogen or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; Y' is O, S, CH2, NH, -NHCO-, -CONH-, -CH2O-, or -SS-; n=0-10; m=1-30。 23. The siRNA duplex as claimed in any of the preceding claims, wherein the selected nucleotide is linked to a 5'O-lipid conjugate portion or an adamantyl group on the sense strand, and its structure conforms to one of the following formulas: Equation 2j: For example, equation 2j1: For example, equation 2j2: Equation 2k: For example, equation 2k1: For example, equation 2k2: For example: Where B is a modified or unmodified nucleobase; and the band represents a sense chain. R3, R4, R5, R6, R7, R8 and R9 are each independently H, a halogen, or a C1-C6 alkyl group optionally substituted with one or more halogens and / or hydroxyl groups; X' is O, S, or NH; Y is O, S, NH or CH2; Y' is O, S, CH2, NH, -NHCO-, -CONH-, -CH2O-, -OCH2-, or -SS-; n=0-10; m=1-30。 24. The siRNA duplex as claimed in any of the preceding claims, wherein the sense strand... It meets one of the following conditions: Equation 2l: For example, equation 2l1: For example, equation 2l2: in, Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; n=0-10; m=1-30。 25. The siRNA duplex as claimed in any of the preceding claims, wherein the sense strand is... It meets one of the following conditions: Formula 2m: For example, equation 2m1: For example, equation 2m2: in, Y' is O, S, CH2, NH, -NHCO-, -CONH-; q=1-20; n=0-10; m=1-30。 26. The siRNA duplex as claimed in any of the preceding claims, wherein the sense strand... It meets one of the following conditions: Equation 2n: For example, equation 2n1: For example, equation 2n2: in, Y' is O, S, CH2, NH, -NHCO-, -CONH-; n=0-10; m=1-30。 27. The siRNA duplex as claimed in any of the preceding claims, wherein the sense strand... It meets one of the following conditions: Equation 2o: For example, equation 2o1: For example, equation 2o2: For example: in X = O or S; and the banded structure represents a meaningful chain. in, Y' is O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; q=0-10; n=0-10; m=1-30。 28. The siRNA duplex as claimed in any of the preceding claims, wherein the sense strand... It meets one of the following conditions: Equation 2p: Equation 2p': Formula 2p”: For example, equation 2p1: For example, equation 2p2: For example, equation 2p3: in, Y is O, S, NH or CH2; p=0-10, q=0-10; n=0-10; m=1-30。 29. The siRNA duplex as claimed in any of the preceding claims, wherein the sense strand... It meets one of the following conditions: Equation 2q: Equation 2q': Equation 2q”: For example, equation 2q1: For example, equation 2q2: For example, equation 2q3: in, Y is O, S, NH or CH2; p=0-10, q=0-10; n=0-10; m=1-30。 30. The siRNA duplex as claimed in any of the preceding claims, wherein the sense strand... It meets one of the following conditions: Equation 2r: For example, equation 2r1: For example, equation 2r2: For example, equation 2r3: in, Y is O, S, NH or CH2; p=0-10, q=0-10; n=0-10; m=1-30。 31. The siRNA duplex as claimed in any of the preceding claims, wherein the sense strand... It meets one of the following conditions: Equation 2s: Equation 2s1: Equation 2s2: Equation 2s3: in, Y is O, S, NH or CH2; p=0-10, q=0-10; n=0-10; m=1-30。 32. The siRNA duplex as claimed in any of the preceding claims, wherein the sense strand of the siRNA duplex is modified at one or both ends by one or more lipophilic moieties, said lipophilic moieties comprising one or more of the following formulas: Equation 2t: Equation 2t1: Equation 2t2: Equation 2t3: in, R 12 and R 13 Each is independently selected from H, halogens, and C1-C6 alkyl groups optionally substituted with one or more halogens and / or hydroxyl groups; "Y" can be O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; r = 1-10, preferably 1-3; s=1-10, preferably 1-3; t=1-10; u=0-3; m=0-5; n=1-30; o=1-5。 33. The siRNA duplex as claimed in any of the preceding claims, wherein the sense strand of the siRNA duplex is modified at one or both ends by one or more lipophilic moieties, said lipophilic moieties comprising one or more of the following formulas: Equation 2u: Equation 2u1: Equation 2u2: Equation 2u3: in, R 12 and R 13 Each is independently selected from H, halogens, and C1-C6 alkyl groups optionally substituted with one or more halogens and / or hydroxyl groups; "Y" can be O, S, CH2, NH, -NHCO-, -CONH-, or -SS-; Y”' is O, S, CH2, NH, -NHCO-, -CONH- or -SS-; r = 1-10, preferably 1-3; s=1-10, preferably 1-3; t=1-10; u=0-3; m=0-5; n=1-30; o=1-5。 34. The siRNA duplex as claimed in any of the preceding claims, wherein the sense strand of the siRNA duplex is modified at one or both ends by one or more portions, said portions comprising one or more of the following structures: in, X = O or S; and the band represents the sense strand or antisense oligonucleotide (ASO) of the siRNA.
35. The siRNA duplex as claimed in any of the preceding claims, wherein the sense strand of the siRNA duplex is modified at one or both ends by one or more portions, said portions comprising: 。 36. A pharmaceutical composition comprising an RNAi agent as described in any of the preceding claims, in combination or in conjunction with a pharmaceutically acceptable diluent or carrier.
37. A method of treating a disease or condition selected from inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), susceptibility to bacterial infections such as Hansen's disease / leprosy and / or Parkinson's disease (PD), the method comprising administering to a patient in need an effective amount of an RNAi agent according to any one of claims 1-35 or a pharmaceutical composition according to claim 36.
38. A method for reducing LRRK2 gene expression in cells, the method comprising introducing an RNAi agent as described in any of the preceding claims into the cells.
39. A method for treating a disease or condition associated with LRRK2 gene expression, the method comprising administering to a patient in need an effective amount of an RNAi agent according to any one of claims 1-35 or a pharmaceutical composition according to claim 36.
40. A method for treating a disease or condition characterized by excessive activity or overexpression of Lrrk2 (including excessive activity or overexpression of an aberrant form of Lrrk2), the method comprising administering to a patient in need an effective amount of an RNAi agent according to any one of claims 1-35 or a pharmaceutical composition according to claim 36.
41. The method of any one of claims 38-40, wherein the disease or condition is associated with a mutation in LRRK2.
42. The method of any one of claims 37-41, wherein the disease or condition is selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), susceptibility to bacterial infections such as Hansen's disease / leprosy, and Parkinson's disease (PD).
43. The method of claim 42, wherein the disease or condition is Parkinson's disease.
44. The method of any one of claims 37-43, wherein the disease or condition is associated with a mutation in LRRK2 at one or more sites at positions 1371, 1437, 1441, 1699, 2019, and / or 2020, the mutation being selected, for example, from I1371V, N1437H, N1437D, R1441C, R1441G, R1441H, R1441S, Y1699C, G2019S, and I2020T.
45. A method for reducing the off-target effects of an siRNA therapeutic agent, the method comprising administering to a patient in need an siRNA duplex according to any one of claims 1-35 or a pharmaceutical composition according to claim 36; for example, optionally, further, the method according to any one of claims 37-44.
46. The RNAi agent according to any one of claims 1-35, used as a pharmaceutical composition, for example, for any one of methods 37-44.
47. Use of the RNAi agent as claimed in any one of claims 1-35 in the manufacture of, for example, a medicament for any one of methods 37-44.
48. The RNAi agent as claimed in any of the preceding claims, wherein the terminal position of the oligomeric compound, preferably the 5′-end of the AS chain, may include the following nucleosides: n = 1-4.
49. The method of any one of claims 37-44, wherein the RNAi agent is administered to the subject at a dose of about 0.01 mg / kg to about 50 mg / kg.
50. The method of any one of claims 37-44, wherein the RNAi agent is administered intrathecally to the subject.
51. The method of any one of claims 37-44, further comprising administering one or more additional therapeutic agents to the subject.
52. An RNAi agent comprising a sense sequence and a complementary antisense sequence, or comprising an antisense oligonucleotide (ASO), wherein the sequence corresponds to a VEGFA or ANGPT2 gene region, wherein the siRNA duplex or ASO effectively and significantly reduces VEGFA or ANGPT2 mRNA in cells [e.g., according to any one of compound 1 and subsequent compounds, compound 3 and subsequent compounds, compound 5 and subsequent compounds described above].
53. The RNAi agent of claim 52, comprising a lipophilic moiety modification, an off-target modification, or a modification as described in any of the preceding claims.
54. The RNAi agent of claim 52 or 53, wherein the antisense sequence is capable of hybridizing with sequences selected from SEQ ID: 201-220, 261-268, 272-285, 356-393 and 394-403.
55. The RNAi agent according to any one of claims 52-54, wherein the antisense sequence comprises a sequence selected from the sequences listed in Tables 9-12 and 18-34.
56. A method for reducing the expression of VEGFA and / or ANGPT2 genes in cells, the method comprising introducing an RNAi agent according to any one of claims 52-55 into the cells.
57. A method for treating a disease or condition related to angiogenesis or lymphangiogenesis, the method comprising administering an effective amount of an RNAi agent or a pharmaceutical composition thereof according to any one of claims 52-55; for example, wherein the disease or condition is cancer or ocular neovascularization, for example, wherein the disease or condition is selected from metastatic colorectal cancer, cervical cancer, endometrial cancer, non-small cell lung cancer, glioblastoma, metastatic hepatocellular carcinoma, metastatic renal cell carcinoma, ovarian cancer, primary peritoneal cancer and fallopian tube cancer, or wherein the disease or condition is selected from neovascular (wet) age-related macular degeneration (AMD), macular edema after retinal vein occlusion, diabetic macular edema, diabetic retinopathy and myopic choroidal neovascularization.
58. A method for treating a disease or condition characterized by overactivity, overexpression, or mutation (including abnormal forms of overactivity or overexpression of Vegf-A and / or Angpt-2), the method comprising administering to a patient in need an effective amount of an RNAi agent or a pharmaceutical composition thereof according to any one of claims 52-55.
59. A method of modifying an RNAi agent according to any one of the preceding claims, the method comprising conjugating one or more modifications according to any one of the preceding claims to the RNAi agent, for example, wherein the one or more modifications are present within a nucleotide sequence, and / or wherein the one or more modifications are directly or indirectly (e.g., via a linker) linked to the nucleotide sequence.
60. A kit comprising a dsRNA agent as described in any one of claims 1-35, 52-55, or a pharmaceutical composition as described in any of the preceding claims.
61. A vial containing a dsRNA agent as described in any one of claims 1-35, 52-55, or a pharmaceutical composition as described in any of the preceding claims.
Citation Information
Patent Citations
Modified RNA agents with reduced off-target effect
WO2018098328A1
Leucine-rich repeat kinase 2 (LRRK2) irna agent compositions and methods of use thereof
WO2023278607A1