Cyclic RNA analogs, preparation and uses thereof

Abstract

The present invention relates to a new class of nucleic acids having a cyclic topology and containing at least one non-natural inter-nucleotide linkage. The main object of the disclosed invention is an analogue of circular RNA (circRNA) obtained by synthesizing 5 '-modified precursors (precursor circRNA) and subsequently cyclizing them via a chemical reaction.

Description

Invention Overview

[0002] This invention relates to a novel class of nucleic acids having a circular topology and containing at least one non-natural nucleotide linker. The primary objective of the disclosed invention is to provide analogues of circular RNA (circRNA) obtained by synthesizing 5'-modified precursors (precursor circRNA) and subsequently circulating them via a chemical reaction. Circulation occurs due to the presence of two chemically reactive functional groups, one at the 5' end of the RNA and the other at the 3' end. The 5' functional group is incorporated co-transcribedly, while the 3' reactive group is incorporated post-transcribedly. The invention covers RNAs of varying lengths (from 2 nt to 20,000 nt), including messenger RNA (RNA encoding proteins). Protein-encoding circRNAs according to the invention are translated more efficiently than unmodified circRNAs having the same sequence. Methods for preparing circRNA analogues, methods for preparing corresponding precursor circRNAs, methods for preparing proteins or peptides, and the application of the disclosed circRNA analogues in the context of gene therapy and vaccination are also disclosed. Technical Field

[0003] This invention relates to RNA molecules, methods for producing circular RNA molecules, methods for producing proteins or peptides in vitro, in cells or in living organisms, and methods for treating or preventing diseases. Background Technology

[0004] Despite its inherent fragility, RNA is one of the most effective substances in the context of therapeutic gene delivery. 1 The efficacy of therapeutic messenger RNA (mRNA) stems from advanced delivery methods and the chemical modification of the mRNA itself. In serum and cytosol, mRNA is primarily targeted by exonucleases (such as decapping complexes, deadenylases, and exosomes). 2 Circularization is one of the most protective modifications of mRNA because it prevents exonuclease digestion. 3

[0005] Currently known RNA cyclization methods are based on chemical reactions. 4,5 Enzyme-catalyzed reactions 6-9 And reactions catalyzed by catalytic sequences embedded in circRNA precursors (pre-circRNAs). 10-13 .

[0006] The reported chemical reaction-based cyclization method relies on short RNA sequences (such as 3' phosphorylated RNA or 3'-amino RNA) chemically synthesized via a phosphoramidite method, which undergo condensation induced by cyanogen bromide (BrCN) or 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC).4,5 Phosphoramide solid-phase synthesis of nucleic acids is a robust method for producing modified and unmodified oligonucleotides; however, it is impractical for producing long (>100 nt) RNA sequences. Therefore, circRNAs obtained using these methods encode relatively short sequences and have limited use in the context of RNAs encoding typically much longer proteins or peptides.

[0007] In addition, RNA cyclization can be performed using ligases, particularly T4 RNA ligase I and T4 RNA ligase II. 6,7,14 Both enzymes require a 5' monophosphorylated precursor, which is first adenylated and then linked to the 3' OH of the ribose at the 3' end of different or the same RNA strand. 15 Both enzymes can achieve intramolecular ligation (circularization) of RNA (if reacting with the 3' end of the same RNA strand); however, they have been found to be highly dependent on the length and sequence of the target RNA. 11,12,14,16 This is harmful because it is difficult to predict or improve the performance of such enzymes.

[0008] Litke et al. have demonstrated a Twister-optimized persistent RNA overexpression (Tornado) system for RNA circularization. 8 Tornado-expressed transcripts contain target RNA flanked by the Twister ribozyme, which spontaneously undergoes autocatalytic cleavage. This leaves the 5'-hydroxyl and 2',3'-cyclic phosphate ends, which are then ligated by the RNA ligase RtcB.

[0009] The catalytic nucleic acid activity-based methods reported to date require sequence design and development, and therefore cannot be used for any given sequence of precursor circRNA. Furthermore, the ability of precursor circRNA to undergo circization may be hindered by the presence of chemical modifications, such as natural and synthetic nucleosides and nucleobases. 12

[0010] WO / 2021 / 113777 discloses circular RNA and transfer mediators, as well as related compositions and processing methods. Pharmaceutical compositions comprising such circular RNA and precursor RNA and materials that can be used to generate said precursor or circular RNA have also been disclosed in the cited documents.

[0011] WO / 2019 / 236673 describes a vector for the preparation of circular RNA, which allows the generation of translatable or biologically active circular RNA in eukaryotic cells.

[0012] EP 4008336 discloses recombinant nucleic acid molecules for transcribing circular RNA, recombinant expression vectors, precirculated RNA, circular RNA, recombinant host cells, pharmaceutical compositions, and methods for protein preparation. The transcription product of the recombinant nucleic acid molecules is circular RNA containing specific IRES elements.

[0013] US Patent 20150079630 discloses circular RNA and its production method, which includes the use of T4 DNA ligase.

[0014] None of the previously reported methods provide analogues of circular RNA (circRNA), which are obtained by synthesizing 5'-modified precursors (precursor circRNA) and then circulating them via a chemical reaction in the absence of proteases or catalytic nucleic acid sequences. Summary of the Invention

[0015] This disclosure provides novel circRNA analogs that can be prepared from precursor circRNA via a chemical reaction (chemical cyclization of RNA), regardless of the circRNA sequence, length, or size. The proposed chemical cyclization of RNA is compatible with the presence of other chemical modifications to the RNA body, such as natural and synthetic nucleosides and nucleobases or fluorescent tags.

[0016] This disclosure provides a circRNA analog prepared by an in vitro transcription reaction followed by a subsequent chemical cyclization reaction, wherein the cyclization is obtained in the absence of a protease or catalytic nucleic acid sequence.

[0017] This disclosure provides a circRNA analog containing a synthetic linear or branched linker and possibly an internal ribosome entry site sequence.

[0018] This disclosure provides a circRNA analog according to Formula 1:

[0019]

[0020] in:

[0021] n is any integer from 1 to 20000;

[0022] X and each X n It can be OH, BH3, NH2, or SH independently;

[0023] Y and each Y n It can be either O or S independently;

[0024] Z and each Z n It can be O, S, or NH independently;

[0025] W and each Wn It can be O, S, or NH independently;

[0026] R and each R n It can be H, OH, alkyl, O-alkyl, or halogen independently;

[0027] B, B' and each B n Nucleoside bases that are either natural, modified, or non-natural;

[0028] L is a linear or branch header.

[0029] In some implementations, connector L is a single-key connector or a connector according to one of Formulas 2-7:

[0030] .

[0031] In some implementations, the connector L includes a detectable tag or mark.

[0032] This disclosure provides a method for synthesizing a circRNA analog as defined above, characterized in that the circRNA analog precursor (Formula 8) is provided.

[0033]

[0034] in:

[0035] n = 1-20000;

[0036] X and each X n It can be OH, BH3, NH2, or SH independently;

[0037] Y and each Y n It can be either O or S independently;

[0038] Z and each Z n It can be O, S, or NH independently;

[0039] W and each W n It can be O, S, or NH independently;

[0040] R and each R n It can be H, OH, alkyl, O-alkyl, or halogen independently;

[0041] B, B' and each B n Nucleoside bases that are either natural, modified, or non-natural;

[0042] L is a linear or branch header;

[0043] First, it is oxidized in step (i) of the method to produce a dialdehyde derivative (Formula 9).

[0044]

[0045] in:

[0046] n = 1-20000;

[0047] X and each X n It can be OH, BH3, NH2, or SH independently;

[0048] Y and each Y n It can be either O or S independently;

[0049] Z and each Z n It can be O, S, or NH independently;

[0050] W and each W n It can be O, S, or NH independently;

[0051] R and each R n It can be H, OH, alkyl, O-alkyl, or halogen independently;

[0052] B, B' and each B n Nucleoside bases that are either natural, modified, or non-natural;

[0053] L is a linear or branch header;

[0054] Then, during step (ii) of the method, the circRNA analog is incubated in a reducing environment to produce the desired circRNA analog.

[0055] In some embodiments of the provided method, connector L is a single-key connector or a connector according to one of Equations 2-7:

[0056] .

[0057] In some embodiments, steps (i) and (ii) are carried out in a single reactor. In some embodiments, step (i) of the method is carried out in the presence of NaIO4, preferably at a concentration below 10 mM, at a temperature below 60°C. In some embodiments, step (ii) of the method is carried out in a buffer solution, preferably at pH 5-8, in the presence of NaBH3CN below 100 mM. In some embodiments, step (i) or step (ii) of the method is carried out in the presence of a natural, modified, or non-natural nucleic acid oligomer complementary to the RNA precursor sequence. In some embodiments, circRNA analogs are separated from the reaction mixture using known RNA separation methods, such as alcohol precipitation, size exclusion chromatography, gel electrophoresis, or high-performance liquid chromatography (HPLC).

[0058] This disclosure provides for the use of the above-mentioned circRNA analogs in protein production in an in vitro setting.

[0059] This disclosure provides the aforementioned circRNA analogs for therapeutic or diagnostic purposes, particularly for protein production set up in vivo.

[0060] This disclosure provides pharmaceutical compositions comprising the above-described circRNA analogs.

[0061] definition

[0062] Unless otherwise defined, all terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0063] The terms “nucleic acid” and “nucleic acid polymer” refer to polymeric substances composed of ribose or deoxyribose derivatives and naturally occurring or synthetic nucleoside monomers, including non-canonical linkages and any degree of polymerization. These phrases include, but are not limited to, natural or synthetic RNA and DNA, as well as nucleic acids, morpholinonucleotides (MNA), locked nucleic acids (LNA), peptide nucleic acids (PNA), and threononucleotides (TNA) composed of thiophosphate, boron phosphate, selenophosphate, and phosphonate moieties.

[0064] In the context of nucleic acids, the terms “modification,” “modifying group,” and “modified” refer to any chemical part that can be attached to a nucleic acid molecule. This includes, but is not limited to, attaching a modifying group to a sugar, nucleobase, interphosphate group, or 5'-5'-oligophosphate group of a nucleic acid molecule.

[0065] The term "nucleotide link" refers to one or more covalent or non-covalent bonds that link two monomers of a nucleic acid polymer.

[0066] The terms "nucleoside base," "nucleobase," and "nitrogenous base" refer to a component of a nucleic acid molecule. The nucleobases mentioned can participate in base pairing, base stacking, and other intermolecular and intramolecular interactions. The nucleobases mentioned include, but are not limited to, natural, modified, non-natural, or synthetic purine (such as adenine, guanine, hypoxanthine, xanthine, N7-methylguanosine, N6-methyladenosine, N2-methyladenosine) and pyrimidine (such as cytosine, thymidine, uracil, dihydrouracil, 5-methylcytosine, 5-hydroxymethylcytosine, pseudouridine, methylpseudouridine, nicotinamide) nucleobases, as well as 2-aminopurine, 2,6-diaminopurine, flavin, C8-substituted adenine, C8-substituted guanine, C7-substituted 7-deadenine, C7-substituted 7-deadenine, C5-substituted uridine, C5-substituted cytosine, bicyclic and tricyclic nucleobases.

[0067] The terms “nucleic acid sequence,” “nucleotide sequence,” “nucleoside sequence,” “nucleobase sequence,” and “sequence” refer to the order and composition of a series of nucleobases within a nucleic acid molecule.

[0068] The terms “nucleobase pair” and “base pair” refer to the basic unit of a double-stranded nucleic acid, consisting of two nucleobases linked together by hydrogen bonds. The term “base pairing” refers to the specific hydrogen bonding between nucleobases, which can be canonical (Watson-Crick base pairing) or non-canonical (e.g., wobbling base pairing, Husstan base pairing).

[0069] The terms "hybridization" and "hybridize" refer to the interaction of two or more nucleic acid strands. The characteristic feature is that, under appropriate conditions, the different nucleic acid strands maintain sequence-dependent structures (e.g., double helix, triple helix, I-motif, G-tetramplex).

[0070] The term "complementarity" refers to the relationship between the sequences of two or more strands of one or more nucleic acids. Complementary sequences or strands are characterized by hybridization and the formation of sequence-dependent structures. Complementarity can be complete or partial.

[0071] In the context of nucleic acids, the terms "linear" and "circular" refer to the topological structure of nucleic acid molecules. Linear nucleic acids are linear polymers without linkages between their 5' and 3' ends. Circular nucleic acids are polymers with natural or modified linkages between their 5' and 3' ends.

[0072] The terms "circularization" and "cyclization" refer to the process of converting linear nucleic acid polymers into cyclic nucleic acid polymers.

[0073] The terms “circRNA precursor” and “pre-circRNA” refer to linear nucleic acid polymers that can undergo circulation to produce circular nucleic acid polymers.

[0074] In the context of cyclic nucleic acids, the term "linker" refers to any natural or synthetic combination of chemical moieties covalently linked to the 5' and 3' ends of a polymer. The term "linker" includes, but is not limited to, any linear or branched combination of alkyl, alkenyl, alkynyl, ether, ester, amide, amine, carbamate, triazole, phosphate, amide phosphate, or phosphonate moieties. In particular, it can be selected from the following structures:

[0075]

[0076] Where m is a natural number from 1 to 100.

[0077] The term "cap analogue" refers to any compound containing a natural or modified 5'-5'-oligophosphate linked to a natural or modified nucleoside, nucleotide, or nucleic acid. The term "cap analogue" refers to canonical and non-canonical cap structures, and includes, but is not limited to, cap 0, cap 1, cap 2, TMG-cap, NAD-cap, and FAD-cap, as well as cap structures modified within oligophosphate bridges, ribose, or nucleobases. In particular, it can be selected from structures described in any of the documents referenced in this specification, especially: WO / 2009 / 149253, WO / 2008 / 157688, WO / 2011 / 015347, WO / 2022 / 191725, WO / 2018 / 015845, WO / 2014 / 093627, WO / 2021 / 162566, WO / 2021 / 162567, and WO / 2017 / 130151.

[0078] The terms "internal ribosome entry site" and "IRES" refer to RNA sequences characterized by their ability to promote cap-independent translation initiation by interacting with or binding to cellular proteins involved in ribosome formation and translation. The term "IRES sequence" includes, but is not limited to, encephalomyocarditis virus (EMCV) IRES, Coxsackievirus B3 (CVB3) IRES, and respiratory syncytial virus (RSV) m... 6 A methylation site, viral IRES sequence, human IRES sequence, m 6 A methylation site, containing m 6 A-modified sequences, eIF4G aptamers, and artificial IRES sequences. 11,12,22,24

[0079] The term "transcription" or "transcriptional reaction" refers to a method for the enzymatic synthesis of RNA complementary to a DNA template. Transcription can occur in cells, cellular systems, or artificial settings (such as in in vitro transcription reactions). Transcription takes place in the presence of a DNA-dependent RNA polymerase, ribonucleoside triphosphates (NTPs), and a DNA template. During the reaction, the sequence of the DNA template is replicated and amplified in the form of RNA molecules. Optionally, transcription can be carried out in the presence of additional reagents, such as transcription initiators, transcription terminators, or modified nucleoside triphosphates.

[0080] The terms "label" and "detectable label" refer to any compound, particle, or any combination of compounds and / or particles that can be detected directly or indirectly. Labels can associate with target molecules through covalent and / or non-covalent interactions. Labels can be radioisotopes, NMR labels, spin labels, chromophores, fluorophores, or haptens. Preferred labels include, but are not limited to, those that are not limited to, radiolabels. 2 H, 13 C 15 C 32 P, 19 F, anthocyanins, fluorescein, rhodamine, coumarin, perylene, naphthalenedicarboximide, nitro dyes, azo dyes, BODIPY, biotin, desulfobiotin, folic acid, and N-acetylgalactosamine.

[0081] The terms "periodate oxidation," "cis-diol oxidation," and "ribose oxidation" refer to the process of cleaving the carbon-carbon bonds of ortho-cis-diols present in the structure of natural or synthetic nucleic acids to produce dialdehyde derivatives of the nucleic acids.

[0082] In the context of nucleic acid modification or cyclization, the terms "reductive amination" and "amination" refer to the amination reaction involving dialdehyde derivatives of nucleic acids.

[0083] The term "reducing environment" refers to the conditions under which a chemical reduction reaction occurs. Reducing environments include, but are not limited to, the presence of sodium cyanoborohydride, sodium borohydride, pyridineborane, or sodium ascorbate.

[0084] The terms “halogen” and “halogen” refer to all halogens, such as chlorine, fluorine, bromine, and iodine groups.

[0085] The term "alkyl" refers to a single-bonded chain of hydrocarbons ranging from 1 to 20 carbon atoms, including but not limited to methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, pentyl, isopentyl, hexyl, octyl, and dodecyl.

[0086] The term “O-alkyl” means the group -OR, where R is an alkyl group, and includes, but is not limited to, O-methoxy, O-ethoxy, O-propoxy, O-isopropoxy, O-butoxy, O-isobutoxy and O-pentoxy.

[0087] The terms “ethylenediamine motif,” “EDA motif,” “EDA group,” and “EDA” refer to the chemical motif of R-CH2-NH-(CH2)2-NH2, where R is any substituent. The structure of the EDA motif can also be identified in ionic or salt form.

[0088] The term "reactive functional group" refers to any functional group incorporated at the 5' or 3' end of RNA that can selectively react with another (same or different) reactive group in the presence of other (natural or non-natural) chemical moieties contained within the circRNA precursor structure. Representative 5' and 3' reactive group pairs that react with each other include, but are not limited to, EDA and dialdehyde, acylhydrazine and dialdehyde, azide and alkyne, azide and cyclooctyne derivatives, amino and carboxyl, amino and fluorosulfonyl, azide and phosphine, etc.

[0089] The terms "nucleic acid alcohol precipitation," "nucleic acid precipitation," and "alcohol precipitation" refer to the process of nucleic acid separation. It is a technique for desalting and concentrating nucleic acids from aqueous solutions. Adding a polar organic solvent (such as ethanol, isopropanol, acetone) and a salt (such as sodium acetate, ammonium acetate, lithium chloride, sodium perchlorate, lithium perchlorate) to a nucleic acid solution causes nucleic acid precipitation.

[0090] The terms "polyacrylamide gel electrophoresis" and "PAGE" refer to techniques used to separate biological macromolecules based on their electrophoretic mobility. Electrophoretic mobility is a function of a molecule's mass, conformation, topology, and charge. When PAGE is performed under denaturing conditions, it provides information about the composition of nucleic acid species in the sample.

[0091] The terms “reversed-phase high-performance chromatography,” “RP-HPLC,” and “HPLC” refer to techniques used to separate, identify, quantify, and isolate components from a mixture of samples. It relies on a pump that flows a pressurized liquid mobile phase (a mixture of solvent and solution) through a solid matrix of stationary phase. The components of the sample interact differently with the mobile and stationary phases and are in equilibrium between adsorbed and dissolved states. This is facilitated by a combination of hydrophobic, dipole-dipole, and ionic interactions. As chromatography proceeds, analytes are separated based on their elution rates, can be detected by their molecular characteristics, and collected into individual fractions (peaks). The elution rate of an individual component of the sample is parameterized by the retention time and peak shape of the fraction. The active component of the stationary phase is a bulk or particulate solid resin of organic and / or inorganic composition, such as silica, poly(styrene-co-divinylbenzene), or other polymers. The mobile phase is an aqueous solution or an organic solution or a mixture of aqueous and organic solutions. Chromatography can be performed in ion-pair mode at elevated temperatures and is used for both analytical and preparative purposes.

[0092] The terms "in vitro translation," "in vitro protein synthesis," and "in vitro protein expression" refer to processes characterized as the enzymatic production of polypeptides based on RNA or RNA analog sequences in artificial systems. In vitro systems include, but are not limited to, artificial reaction mixtures, cell lysates, nuclear lysates, cell cultures, and tissue cultures.

[0093] The terms “in vivo translation,” “in vivo protein synthesis,” and “in vivo protein expression” refer to the enzymatic production of polypeptides based on RNA or RNA analog sequences in natural systems. In vivo systems include, but are not limited to, intact organisms, organs, cells, and tissue grafts derived from humans, animals, plants, fungi, or bacteria.

[0094] The terms "therapeutic protein" or "multiple therapeutic proteins" refer to polypeptide molecules that can be used in therapeutic or medical research processes. Categories of therapeutic proteins include, but are not limited to, antigens, antibodies, immunogenic proteins, fluorescent proteins, reporter proteins, protein hormones, membrane proteins, transcription factors, regulatory proteins, systems for gene editing, and systems for gene regulation.

[0095] The term "therapeutic gene" or "multiple therapeutic genes" refers to a nucleic acid sequence containing an open reading frame encoding an amino acid sequence that encodes a therapeutic protein. A therapeutic gene can consist of, but is not limited to, sequences encoded in natural or synthetic viral DNA or RNA, plasmid vectors, RNA, mRNA, or circRNA.

[0096] The term "pharmaceutical composition" refers to a composition of substances consisting of an active substance and an auxiliary substance (such as a pharmaceutically acceptable solvent and / or carrier). Pharmaceutical compositions can be formulated as solids, liquids, aqueous solutions, aqueous emulsions, suspensions, lipid nanoparticles, liposomes, or liposome suspensions. The term "pharmaceutical composition" includes, but is not limited to, compositions designed for the expression of therapeutic genes and proteins in in vitro and in vivo settings.

[0097] The publications cited in the specification and the references given therein are included here as references. Attached Figure Description

[0098] The following detailed description of embodiments of the invention will be better understood by reading in conjunction with the accompanying drawings. For the purpose of illustrating the invention, the accompanying drawings show embodiments that are currently illustrative. However, it should be understood that the invention is not limited to the precise arrangement and means of the embodiments shown in the drawings.

[0099] Figure 1This illustrates a general concept for preparing circRNA analogs. A) First, a precursor of the circRNA analog (FG-connector-RNA) is synthesized in an in vitro transcription (IVT) reaction. Due to the presence of the transcription initiator (FG-connector-AG), the transcribed RNA contains a reactive functional group (FG) at the 5' end. Next, the 3' reactive functional group is incorporated into the RNA post-synthetic via an enzymatic reaction or a preferred chemical reaction. The 5' and 3' reactive functional groups react spontaneously or in the presence of a specific trigger. B) For example, a precursor of the circRNA analog (EDA-connector-RNA) is synthesized during IVT. Due to the presence of the transcription initiator EDA-connector-AG, the transcribed RNA contains an ethylenediamine (EDA) moiety at the 5' end. The precursor is first chemically modified at the 3' end by treatment with periodate. This results in the selective oxidation of the 3' ribose, making it susceptible to nucleophilic attack by the EDA moiety. Finally, the addition of a reducing agent (i.e., NaBH3CN) leads to an irreversible covalent linking of the 5' and 3' ends of the RNA.

[0100] Figure 2 Chemical cyclization yielded higher yields and product homogeneity than enzymatic cyclization. A) A 5'-modified RNA (precursor circRNA2) was used as the precursor for chemical cyclization. For reference, a 5'-monophosphorylated RNA of the same sequence (precursor circRNA1) was used as the substrate for enzymatic cyclization catalyzed by T4 RNA ligase I. Chemical cyclization resulted in a higher yield of the desired cyclization product. B) A 5'-modified RNA (precursor circRNA21) was used as the precursor for chemical cyclization. For reference, a 5'-monophosphorylated RNA of the same sequence (precursor circRNA20) was used as the substrate for enzymatic cyclization catalyzed by T4 RNA ligase I. Chemical cyclization resulted in a higher yield of the desired cyclization product and significantly lower amounts of byproducts (linear dimers, cyclic dimers). The substrates and products of the chemical and enzymatic reactions were analyzed by PAGE (6% AA, AA:MBAA = 19:1, 7 M urea, 1x TBE). The reaction yields were determined by densitometry. M refers to linear RNA length markers. HMW refers to linear RNAs with a length ranging from 1500 nt to 6000 nt.

[0101] Figure 3Chemical cyclization of long RNA molecules yielded higher yields and fewer byproducts than ribozyme cyclization (substitutional intron-exon (PIE) splicing). The splicing reaction was performed using a self-splicing RNA precursor (precursor circRNA22), while the recyclization reaction was carried out at progressively increasing mRNA concentrations. Precursors for chemical cyclization included 5'-modified long RNAs (precursors circRNA19, circRNA10, and circRNA18). Substrates and products of both chemical and self-splicing reactions were analyzed by PAGE (6% AA, AA:MBAA = 37.5:0.5, 7 M urea, 1x TBE). Reaction yields were determined by densitometry. M refers to a linear RNA length marker. HMW refers to linear RNA ranging in length from 1500 nt to 6000 nt.

[0102] Figure 4 This study demonstrates the removal of linear RNA mediated by RNase R in the presence of circular RNA. Samples containing linear precursors of circRNA analogs (precursor circRNA2) and chemically cyclized products (a mixture of precursor circRNA2 and circRNA2) were treated with a progressive 3' exonuclease (RNase R) that selectively hydrolyzes linear RNA species. Following RNase R treatment, samples were analyzed by PAGE (6% AA, AA:MBAA = 38:1, 7M urea, 1x TBE). M refers to the linear RNA length marker. HMW refers to linear RNA ranging from 2000 nt to 6000 nt in length.

[0103] Figure 5 An RNase H digestion assay confirming the circular topology of chemically circularized RNA was performed. Samples of circRNA analogs (circRNA2) and their linear precursors (precursor circRNA2) underwent DNA-dependent endonuclease cleavage catalyzed by RNase H followed by PAGE. In the presence of targeting DNA oligonucleotides, the circRNA analogs were cleaved. Therefore, the cleaved circRNA exhibited the electrophoretic mobility of the linear precursor. On the other hand, cleavage of the linear precursor resulted in two smaller RNA molecules. PAGE conditions: 6% AA, AA:MBAA = 38:1, 7M urea, 1x TBE. M refers to the linear RNA length marker. HMW refers to linear RNA ranging in length from 2000 nt to 6000 nt.

[0104] Figure 6The effect of gel crosslinking on polyacrylamide gel electrophoresis of circRNA was demonstrated. Samples of RNA length markers, linear precursors of circRNA analogs (precursor circRNA2), and chemically cyclized products (a mixture of precursor circRNA2 and circRNA2) were analyzed by PAGE. Two types of 6% polyacrylamide gels were used in parallel: one with high crosslinking (AA:MBAA = 19:1, 7 M urea, 1x TBE) and one with low crosslinking (AA:MBAA = 38:1, 7 M urea, 1x TBE). circRNA migrated more slowly than linear RNA. Significant differences in electrophoretic migration were observed in gels with higher crosslinking. HMW refers to linear RNA with a length range of 2000 nt to 6000 nt.

[0105] Figure 7 Optimization of RNA conformation using complementary DNA oligonucleotides is shown. A) Prediction of the minimum free energy structure of the RNA5 sequence generated using the RNAfold web server. B) Prediction of the tertiary structure of the RNA sequence containing flanking regions of the RNA5 sequence generated using the RNAComposer web server. The predictions indicate that the 3' polyA sequence can separate the 5' and 3' ends and inhibit any reaction between them. Fluorescence spectra of the Cy5-RNA5-Cy3 probe recorded at 4ºC (C) or 20ºC (D) before (without ON) hybridization with one of the complementary DNA oligonucleotides (ON2-ON5). The appearance of a 660 nm emission band indicates the occurrence of FRET, promoted by the reduced distance between the 5' and 3' ends.

[0106] Figure 8 The effect of complementary DNA oligonucleotides on chemical cyclization was demonstrated. Precursor circRNA10 was used as the precursor for chemical cyclization. The precursor was annealed with one of the complementary DNA oligonucleotides (ON2-ON5) prior to the oxidation step. After the reaction, samples were analyzed by PAGE (6% AA, AA:MBAA = 38:1, 7M urea, 1x TBE). For reference, samples of the precursor (NR) before reaction and the reaction product without complementary DNA (ON) were included. M refers to the linear RNA length marker. HMW refers to linear RNA with a length ranging from 3000 nt to 6000 nt. The relative amounts of cyclic product (P), linear dimer (D), and unreacted substrate (S) were determined by densitometry.

[0107] Figure 9The images show attempts to separate linear and circular RNA using IE-HPLC (A), SEC-HPLC (B), and RP-HPLC (C). Samples containing a mixture of linear and circular RNA (precursor circRNA2 + circRNA2) were analyzed using three different modes and columns. For reference, linear RNA (precursor circRNA2) was analyzed and separated under the same conditions. IE-HPLC conditions: CIMac PrimaS™ 0.1 mL analytical column (2 µm); A - 50 mM HEPES pH 7.0; B - 200 mM sodium pyrophosphate, 50 mM HEPES pH 8.5; 0% B for 2 min, 0-100% B over 6 min, 100% B for 2 min, 100-0% B over 2 min, 0% B for 1 min; flow rate: 1.0 mL / min at 25ºC. SEC-HPLC conditions: Yarra 3 µm SEC-4000 300x7.8 mm; A - 100 mM Na2HPO4, 0.025% NaN3 pH 6.8; 100% A for 50 min; flow rate at 25ºC: 1.2 ml / min; RP-HPLC conditions: RNASept Prep C18 50x7.8 mm 2 µm; A - 100 mM HAA, 10% MeCN, pH 7.0; B - 100 mM HAA, 75% MeCN, pH 7.0; 20%-70% B over 25 min; flow rate at 60ºC: 1.0 ml / min.

[0108] Figure 10 The purification of circRNA using reversed-phase high-performance liquid chromatography (RP-HPLC) is shown. The chemically cyclized product of precursor circRNA4 was analyzed chromatographically under denaturing conditions (60ºC, hexammonium acetate buffer and acetonitrile mixture as mobile phase). UV absorption eluents were collected and separated into fractions corresponding to different absorption peaks. The fractions were then concentrated and analyzed by PAGE with EP5-GLuc before and after cyclization. NR – precursor (precursor circRNA4), Cr – crude cyclized product, F1-F3 – concentrated HPLC fractions, M – linear RNA length marker. HMW refers to linear RNA with a length range of 3000 nt to 6000 nt. PAGE conditions: 6% AA, AA:MBAA = 38:1, 7M urea, 1x TBE. The purified circRNA is shown in fraction 2.

[0109] Figure 11The effect of mobile phase composition on RP-HPLC of circRNA is shown. Mixtures of linear (precursor circRNA14) and circular (circRNA14) RNA were separated and analyzed by RP-HPLC. Each chromatography was performed in the presence of different ion-pairing agents: A) hexammonium acetate; B) triethylammonium acetate; C) 2-ethylhexammonium acetate; D) dibutylammonium acetate; E) N,N-dimethylhexammonium acetate; F) N,N-diisopropylammonium acetate.

[0110] Figure 12 The PAGE analysis of selected circRNA precursors and circRNAs after HPLC and RNase R treatment is shown. M-linear RNA length markers. HMW refers to linear RNA with a length range of 3000 nt to 6000 nt. PAGE conditions: 6% AA, AA:MBAA = 38:1, 7M urea, 1x TBE.

[0111] Figure 13 Translational activity of circRNA analogs in HEK293 cells is shown. Cells were transfected with unmodified (enzymatically obtained) circRNA (circRNA11) or modified (chemically obtained) circRNA (circRNA12 with a non-natural linker and circRNA13 with a cap structure) encoding Gaussian luciferase (a reporter protein secreted by cells into the culture medium). Precursor circRNAs (precursor circRNA11-13) were used as references. Cell culture medium was harvested at time points (4, 24, 48, 72, 96, 120, 144, and 168 hours post-transfection) and used to quantify reporter protein levels using luciferase bioluminescence assays. Detected luminescence at all time points is summarized to give the total luminescence. Data presented in the figures are from three independent replicates, and error bars represent the standard error of the mean (SEM).

[0112] Figure 14 Translational activity of circRNA analogs in HEK 293 cells is shown (continued). Cells were transfected with unmodified (circRNA11) or modified circRNAs (circRNA12, 13) encoding Gaussian luciferase (a reporter protein secreted by cells into the culture medium). Precursor circRNAs (precursor circRNA11-13) were used as references. Cell culture medium was harvested at time points (4, 24, 48, 72, 96, 120, 144, and 168 hours post-transfection) and used to quantify reporter protein levels using luciferase bioluminescence assays. Data presented in the figure are from three independent replicates; error bars represent the standard error of the mean (SEM).

[0113] Figure 15The translational activity of the in vitro circRNA analog compared to its linear precursor is shown. HEK 293T, Hep G2, A549, and HeLa cells were transfected with a modified circRNA (circRNA12) encoding Gaussian luciferase (a reporter protein secreted into the culture medium by cells) or its linear precursor (precursor circRNA12). Simulated transfection (water instead of RNA) was used as a reference. Cell culture medium was harvested at time points (4, 24, 48, 72, 96, 120, 144, and 168 hours post-transfection) and used to quantify reporter protein levels using luciferase bioluminescence assay. Detected luminescence at all time points was summarized to give total luminescence, which was then normalized relative to the mean luminescence obtained against linRNA23. Data presented in the figure are from three independent replicates, and error bars represent the standard error (SEM) of the mean. Detailed Implementation

[0114] This invention relates to circular RNA (circRNA) analogs obtained by circularization of a circRNA precursor containing two reactive functional groups (one at the 5' end and the second at the 3' end). Figure 1 A] The 5' reactive functional group is incorporated into RNA during enzymatic synthesis (i.e., in vitro transcription). The 3' reactive functional group is incorporated into RNA post-synthesis via enzymatic reactions or, preferably, chemical reactions. The 5' and 3' reactive groups react spontaneously or in the presence of specific triggers, such as the addition of chemical reagents, catalysts, temperature changes, the presence of light, or changes in solution pH. Representative 5' and 3' reactive group pairs that react with each other include, but are not limited to: EDA and dialdehyde, acylhydrazine and dialdehyde, azide and alkyne, azide and cyclooctyne derivatives, amino and carboxyl, amino and fluorosulfonyl, azide and phosphine, etc.

[0115] A representative example of a 5' functional group is the EDA motif (EDA-adaptor-RNA). Figure 1 [B] The precursor is a modified nucleic acid that can be prepared by in vitro transcription. The 5'-EDA motif can be readily installed during in vitro transcription (IVT) reactions, provided that transcription is performed in the presence of an EDA-modified transcription initiator [see examples in Table 1].

[0116] This is beneficial because, unlike other chemical cyclization methods, the length of the precursor is not limited by the efficiency of RNA solid-phase synthesis.

[0117] The 5'-EDA motif and the nucleic acid strands of the EDA-linker RNA are linked by a linker. The linker itself can be a linear or branched combination of simple chemical parts (such as carbohydrate or PEG linkers), or it can contain more complex elements, such as detectable tags. The circRNA precursor can carry additional modifications, such as detectable tags, as long as they do not interfere with the cyclization reaction.

[0118] This is beneficial because, in contrast to enzymatic cyclization, users are not limited by the activity of specific enzymes or substrate specificity.

[0119] Chemical cyclization is a two-step process. First, the circRNA precursor is selectively oxidized at its 3' end with periodate to introduce a reactive functional group (dialdehyde) at the 3' end of the RNA. This occurs via ring-opening oxidation and the formation of a reactive acyclic dialdehyde derivative of the terminal 3' ribose. In the second step, the 3' dialdehyde derivative spontaneously reacts with the 5' EDA motif. This step requires a reducing environment to achieve optimal performance. If a reducing environment is ensured during this reaction, the formed intermediate is reduced, making the entire process irreversible. Besides the presence of the 5' EDA motif (5' reactive group) and the 3' dialdehyde motif (3' reactive group), chemical cyclization has no requirements regarding the chemical structure or sequence of the circRNA precursor.

[0120] This is advantageous because, in contrast to cyclization techniques based on catalytic nucleic acid activity (PIE and Tornado systems), the chemical cyclization of this invention does not require sequence engineering and construct cloning for the preparation of circRNA precursors.

[0121] circRNA precursors containing the EDA motif were prepared via IVT, followed by circularization [Table 1]. In comparison, precursors carrying the 5' monophosphate motif and the same sequence were subjected to enzymatic circularization catalyzed by T4 RNA ligase I or T4 RNA ligase II. Surprisingly, chemical circularization yields were less dependent on the precursor sequence and were generally more efficient than enzymatic circularization. Figure 2 A]. In some studies of enzymatic cyclization, the main outcome involves the production of linear and circular dimers, while chemical cyclization primarily leads to the formation of the desired circular RNA product. Figure 2 B].

[0122] The chemical cyclization method for mRNA disclosed herein is applicable to the cyclization of long RNA molecules. The crude product of the cyclization reaction is a non-complex mixture consisting of the desired circRNA product and unreacted linear precursor circRNA. The cyclization yield is high and independent of the precursor circRNA length. Unlike the PIE method, which typically requires a recyclization step, this procedure does not require an additional step. The aforementioned recyclization step can lead to degradation (cleavage) of the desired circRNA product and the formation of a complex mixture of byproducts due to prolonged incubation of RNA in the presence of magnesium salts, potentially interfering with subsequent purification steps. Figure 3 The circular topology of circRNA analogs obtained through chemical cyclization can be verified using exonuclease assays, endonuclease assays, and electrophoretic mobility assays.

[0123] Exonuclease digestion assays allow researchers to distinguish between linear and circular RNA because exonucleases can only hydrolyze RNA molecules containing a free 5' or 3' end. Circular RNA, on the other hand, is resistant to exonuclease digestion because it lacks both free 5' and 3' ends. RNase R is the most commonly used progressive 3' exonuclease for this assay. 3 Treatment of chemically cyclized products with RNase R Figure 4 In contrast to precursor formation, circRNA analogs are resistant to RNase R hydrolysis.

[0124] Nucleotide endonuclease assays are based on the cleavage and linearization of circRNAs. Site-selective and sequence-dependent cleavage of circular RNA molecules results in a single linear RNA molecule of the same size. Conversely, cleavage of linear RNA molecules results in two smaller linear RNA molecules. This assay can be performed using RNase H, an endonuclease that cleaves RNA within the RNA-DNA double helix. 25 RNase H and targeting DNA oligonucleotides are used to cleave chemically cyclized products. Figure 5 Assays confirmed that, compared with precursor formation, cleavage of circRNA analogs led to their linearization.

[0125] The electrophoretic mobility of nucleic acids is affected by their size, charge, conformation, and topology. 26,27 Because of this, circRNA and its precursors can be separated during polyacrylamide gel electrophoresis under denaturing conditions. Figure 6 The degree of cross-linking of the polyacrylamide gel matrix is ​​a key factor in RNA separation based on RNA topology. Cross-linked polyacrylamide gels provide significantly better electrophoretic separation of linear and circular RNA compared to conventional or commercially available agarose gels. 27

[0126] Circulation efficiency is affected by the circRNA precursor sequence. [Table 2] In some cases, such as sequences containing a 3' polyA sequence, the circulation yield can be increased by adding a complementary nucleic acid oligomer. [Table 3] During the reaction, the oligomer hybridizes with the precursor and affects the precursor's conformation. Using an optimally designed oligomer, the conformational change of the precursor reduces the distance between the 5' and 3' ends. Figure 7 Therefore, the optimal distance and orientation between the 5' and 3' ends improves the cyclization yield. Figure 8 ].

[0127] This invention also relates to methods for preparing and isolating circRNA analogs. This includes the development of chromatographic methods for the separation of linear and circular RNAs.

[0128] The previously reported chromatographic method for cyclized products is based on size exclusion chromatography (SEC-HPLC) in an HPLC apparatus. 11,12,14 This method allows for the separation of sample components based on hydrodynamic radii and is considered to offer one of the mildest chromatographic conditions. SEC-HPLC is used for the separation and analysis of PIE-based cyclized products. 11,12,14 In these cases, the precursor and circRNA differ significantly in molecular size and form byproducts such as free introns. In the case of synthetic polymers such as polystyrene or poly(ethylene oxide), the hydrodynamic radius (Stokes radius) decreases upon cyclization. 28 This property has been used to separate linear and cyclic polymers using gel permeation chromatography (GPC). However, the reduction in Stokes radius caused by the cyclization of RNA molecules has not been documented. It can be speculated that intramolecular interactions that contribute to the presence of RNA conformational isoform landscapes may reduce the effect of topological changes on the Stokes radius differentiation between cyclic and linear RNAs. 29 This also explains why SEC-HPLC under mild conditions leads to the co-elution of intact and nicked circRNAs. 12,14

[0129] During the development of this invention, we found that size exclusion chromatography (SEC-HPLC) and ion exchange chromatography (IE-HPLC) are not effective enough for separating linear and circular RNAs of the same molar mass. Figure 9 The ion-pair mode reversed-phase HPLC (RP-HPLC) was found to be the most suitable method for separating cyclized products. Figure 9 , Figure 10Chromatography was performed using polystyrene-divinylbenzene (PSDVB) resin, high temperature (50ºC-80ºC), and a mixture of an aqueous solution of ion-pairing reagent and acetonitrile as the mobile phase. The separation of linear and circular RNA was affected by the mobile phase composition, i.e., the selected ion-pairing reagent. The most efficient separation was achieved using a linear gradient of 100 mM hexammonium acetate (HAA) and acetonitrile (45%-58.5% over 25 min, at a flow rate of 1.00 ml / min at 60ºC). Figure 11 ].

[0130] This invention also relates to the therapeutic applications of circRNA analogs. To demonstrate the suitability of protein-encoding circRNA analogs for gene delivery, circRNA analogs encoding the reporter protein Gaussian luciferase were synthesized and expressed in cell lines HEK 293T, A549, HeLa, and Hep G2. Compared to unmodified circRNA (circRNA11), the expression of chemically modified circRNA analogs (circRNA12, 13) resulted in higher levels of the reporter protein. Figure 13 Both modified and unmodified circRNAs showed increased duration of protein expression compared to their linear precursors (precursor circRNA11-12). Figure 14 Chemically circularized mRNAs exhibit higher translation efficiency compared to their linear precursors. Figure 15 The results indicate that chemical modifications within circRNA analogs are beneficial in the context of therapeutic protein expression.

[0131] Table and its brief description

[0132] Table 1: List of DNA templates (linearized plasmids) and corresponding RNA sequences, along with descriptions and properties. Column descriptions: Plasmid ID - Name of the plasmid; Restriction enzyme - Name of the enzyme used for plasmid linearization; RNA sequence ID - Name of the RNA sequence encoded in the DNA template used for IVT; RNA sequence elements - 5' and 3' untranslated regions (5' UTR and 3' UTR), protein-coding sequence (CDS), and the sequence downstream of the 3' UTR (3' tail); RNA length - Total length of the transcript; RNA E260 - Molar extinction coefficient calculated for a specific RNA sequence. 30 HBB: Human β-globin UTR (5' or 3') sequence, EMCV: Encephalomyocarditis virus IRES, RSV: Respiratory syncytial virus IRES, OligoIRES: Synthetic IRES, eGFP: Enhanced green fluorescent protein sequence, Gluc: Gauss-Dura luciferase sequence, A30: 30 nucleotide long polyadenine sequence.

[0133]

[0134] Table 2: List of circRNAs and their chemical or enzymatic cyclization yields. Column descriptions: circRNA number - the name of the circRNA and its corresponding precursor circRNA; RNA sequence number - the name of the RNA sequence encoded in the DNA template used for IVT; IVT initiator - the compound used as a transcription initiator in the IVT reaction; cyclization type - the type of reaction used for RNA cyclization (chemical cyclization or enzymatic cyclization catalyzed by T4 RNA ligase I or T4 RNA ligase II); DNA oligonucleotide - information on whether complementary DNA oligonucleotides were used during a specific cyclization reaction; cyclization yield - the fraction of the circRNA precursor converted to a specific circRNA product during the cyclization reaction, determined by PAGE and densitometric analysis of the crude cyclized product.

[0135]

[0136] Table 3: List of complementary DNA oligonucleotides used for RNA circularization and FRET experiments. Column descriptions: ON number - name of DNA oligonucleotide sequence; RNA sequence number - name of RNA sequence; ON sequence - sequence of the specified oligonucleotide.

[0137]

[0138] Table 4: List of plasmids and insert sequences used to prepare IVT templates. Underlined sequences are coding sequences from the T7 RNA polymerase transcription start site to the linearization site. Recognition sequences for BamHI (GGATCC), PmeI (GTTTAAAC), AarI (AAAAAAAAAGCAGGTG), Esp3I (NNCGTCTC), and Eco52I (CGGCCG) are in bold, and cleavage sites between nucleotides are in italics.

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145] Example

[0146] The following examples are provided only to illustrate the invention and explain its various aspects. These examples should not be considered as limiting or demonstrating the full scope of the invention. Examples 1-3 illustrate the synthesis of representative transcription initiators containing EDA groups, said initiators being suitable for synthesizing precursor circRNAs for circulation according to the invention. Example 4 describes the generation of a DNA template for synthesizing RNA by in vitro transcription. Examples 5-11 describe the preparation of circRNAs according to the invention and reference circRNAs obtained by prior art methods for comparative studies. Examples 12-14 describe procedures for circRNA purification and structural confirmation. Examples 15 and 16 describe the optimization of RNA conformations for optimal chemical circulation. Example 17 describes the evaluation of the translational activity of circ-mRNAs in living cells.

[0147] Example 1. Synthesis of EDA-PEG5-AG:

[0148]

[0149] Diethylenetriamine (33.7 µl, 310 µmol, Sigma) was added to a solution of acetylene-PEG5-NHS ester (12.5 mg, 31.2 µmol, Sigma) in DMF (200 µl). After vortexing at 20ºC for 150 min, ammonium acetate aqueous solution (50 µl, 500 mM, HPLC grade) and acetic acid (60 µl, 50%) were added to obtain a mixture with a pH of approximately 7. Next, a solution of N3-AG (28 µmol, 2.00 mL) was added. 31A solution of the Cu(II)-THPTA complex (60 µl, 50 mM) was combined with the mixture. Then, sodium ascorbate (31 mg, 157 µmol) was added, and the reaction mixture was stirred at 20ºC and monitored by HPLC. Two hours later, a solution of triethylammonium acetate (200 µl, 1 M, HPLC grade), a solution of the Cu(II)-THPTA complex (20 µl, 50 mM), and sodium ascorbate (114 mg, 586 µmol) were added, and the reaction was continued overnight. The reaction was quenched with EDTA and separated by HPLC, with the following column: Gemini 5 µm NX-C18 110 Å 250 x 10 mm; flow rate 5 mL / min at 23ºC; solvent A: 50 mM NH4OAc pH 5.9; solvent B: acetonitrile; elution: from 0% to 41% B over 25 min, then from 41% to 100% B over 10 min, followed by 100% B for 5 min. The HPLC eluent containing the desired product was lyophilized and resuspended in water three times to remove trace amounts of solvent and ammonium acetate. The final product, EDA-PEG5-AG, was obtained as a solution of the ion pair with ammonium acetate (9.2 µmol, 95% purity achieved by HPLC), in a yield of 33%. MS ESI(-): m / z = 1025.8, against C 38 H 58 N 16 O 16 P - The calculated value of m / z is 1025.4.

[0150] Example 2. Synthesis of EDA-AG

[0151]

[0152] Sodium ascorbate (10.3 mg, 52 µmol) and PEDAX2HCl (3.4 mg, 20 µmol) were added to N3-AG (7.4 mg, 11.5 µmol). 2It was dissolved in degassed triethylamine acetate solution (2.0 mL, 45 mM, pH 7). Then, a solution of CuSO4-THPTA complex (10 µL, 100 / 500 mM, in water) was added and incubated at room temperature for 2 hours. Then, EDTA solution (20 µL, 100 mM, pH 7.0) was added, and HPLC separation was performed on a C18 column; System A: 100 mM NH4OAc, pH 5.9; System B: 30% MeCN; Program: 0-25% B over 40 min at 22ºC, 4.5 mL / min. After combining fractions and lyophilizing three times, the product in ammonium acetate form (2.8 mg, 3.50 µmol, E) was obtained. 260 = 24.3 mM -1 cm -1 The yield was 30%. MS ESI(-): 734.4 ([MH]) - Calculated value: 734.2).

[0153] Example 3. Synthesis of EDA-AG-v2

[0154] N3ApG (42 µmol) was dissolved in MQ water (5.0 mL). 1 M phosphate buffer (550 µl, pH = 7.0) was added to this solution. TCEP hydrochloride (60 mg, 210 µmol) was dissolved in 1 M NaOH solution (780 µl) and immediately added to the N3-ApG solution. The reaction was monitored by HPLC. After the starting material was completely consumed (approximately 2 h), the reaction mixture was lyophilized. The resulting foam was dissolved in a minimal amount of water and the product was separated by RP rapid chromatography (25 g C18 column; buffer A: 0.05% TFA / water, B: MeCN, program: A in 5 column volumes, then B in 20 column volumes 0–30, 40 mL / min). The fractions were combined and lyophilized three times to obtain the product (32 µmol) as a TFA salt, in 76% yield.

[0155] The synthesis of Boc-EDA-ApG involved dissolving NH₂ApG (9 µmol) in 0.1 M AcONa buffer (1.8 mL, pH 5.4) and mixing it with 9 µl of N-Boc-2-aminoacetaldehyde solution (1 M, in DMF) and 40 µl of NaBH₃CN solution (1 M, in DMF). The reaction mixture was stirred at 45ºC for 3 h (at which point HPLC analysis indicated approximately 25% conversion of the starting material and formation of the double-reductive amination product). The reaction mixture was directly separated by rapid RP chromatography (25 g C18 column; buffer A: 0.05% TFA / water, B: MeCN, program: 5 column volumes of A, then 0–30 column volumes of B in 20 column volumes, 40 mL / min). Unreacted starting material (6 µmol) was recovered. The combined fractions containing the desired product were lyophilized three times. The product was obtained as a TFA salt (2 µmol) in 22% yield, MS ESI(-): 753.7 (calculated [MH]- for C27H38N12O12P-: 753.2).

[0156] The synthesis of EDA-ApG involved dissolving Boc-EDA-ApG (2 µmol) in 0.05 M HCl (250 µl) and stirring overnight at 30ºC. The reaction mixture was neutralized with 0.1 M NaHCO3 and directly subjected to rapid RP chromatography (25 g C18 column; 0.05% TFA / water, 5 column volumes, 40 mL / min). The combined fractions containing the desired product were lyophilized three times. The product (2 µmol) was obtained in quantitative yield as a TFA salt, MS ESI(-): 653.2 ([MH]- calculated for C22H30N12O10P-: 653.2).

[0157] 1 H NMR (500 MHz, D 2 O) δ 8.13 (s, 1H), 8.12 (s, 1H), 7.92 (s, 1H), 5.93 (d, J = 3.4 Hz, 1H), 5.76 (d, J = 4.0 Hz, 1H), 4.76 – 4.73 (m, 1H), 4.59– 4.54 (m, 1H), 4.54 – 4.51 (m, 1H), 4.50 – 4.45 (m, 1H), 4.44 – 4.38 (m,1H), 4.36 – 4.28 (m, 2H), 4.20 – 4.10 (m, 1H), 3.22 – 3.15 (m, 3H), 3.12 –3.04 (m, 3H).

[0158] Example 4. DNA template preparation

[0159] Plasmids were prepared by cloning a selected sequence (Table 4) containing the T7 RNA polymerase promoter and specific restriction enzyme cleavage sites into the pJet vector. To provide the required DNA template for IVT, the plasmids were linearized with restriction enzymes according to the manufacturer's protocol (Thermo). See Table 2 for details.

[0160] Example 5. General protocol for preparing EDA-adaptor-RNA (precursor circRNAs 2, 4-6, 8, 10, 12, 13, 15, 17, 21)

[0161]

[0162] Mix all components of the reaction mixture listed in the table above in the following order at room temperature: water, transcription buffer x5 (200 mM Tris-HCl pH 7.9, 30 mM MgCl2, 50 mM DTT, 50 mM NaCl and 10 mM spermidine, Thermo), NTP (Thermo), EDA-adaptor-AG (or EDA-adaptor-cap), DNA template, MgCl2, Ribolock (Thermo), and T7 RNA polymerase HC (Thermo). Vortex the reaction mixture, gently centrifuge, and incubate at 37ºC for 2 h. Then add DNase I (2.0 μl, 1 U / μl, Thermo) and incubate the mixture at 37ºC for 30 min. Separate the RNA product from the reaction mixture using the Monarch RNA Purification Kit (500 µg, NEB). The isolated RNA (approximately 200 µg) was analyzed by RP-HPLC with the following parameters: column: PolymerX RP-1 3 µm 100 Å, 4.1 x 150 mm; flow rate: 1.0 ml / min at 60ºC; solvent A: 100 mM TEAA pH 7.0; solvent B: 200 mM TEAA pH 7.0 / acetonitrile 1:1 (v / v); elution: from 20% to 32.5% B over 25 min, then from 32.5% to 100% B over 2 min, followed by 100% B for 2 min. The HPLC eluent containing the desired RNA product was concentrated by precipitation: sodium acetate (0.1 V, 3.0 M, pH 5.2) and isopropanol (1.0–1.5 V) were added to the eluent (initial volume = 1 V), and the solution was cooled at -80ºC for 30 min or overnight at -20ºC. The precipitate was centrifuged (30 min, 14000 g, 4ºC), washed with 80% ethanol (1.0 ml), centrifuged (10 min, 14000 g, 4ºC), dried in vacuum, and suspended in water to obtain the RNA product (100-180 µg, 50%-90% of the crude product).

[0163] Example 6. General protocol for preparing p-RNA (precursor circRNAs 1, 3, 7, 9, 11, 14, 16)

[0164]

[0165] Mix all components of the reaction mixture listed in the table above in the following order at 37ºC: water, transcription buffer x5 (200 mM Tris-HCl pH 7.9, 30 mM MgCl2, 50 mM DTT, 50 mM NaCl and 10 mM spermidine, Thermo), NTP (Thermo), GMP (pre-incubated at 37ºC), DNA template, MgCl2, Ribolock (Thermo), and T7 RNA polymerase HC (Thermo). Vortex the reaction mixture, centrifuge gently, and incubate at 37ºC for 2 h. Then add DNase I (2.0 μl, 1 U / μl, Thermo) and incubate the mixture at 37ºC for 30 min. Separate the crude RNA product from the reaction mixture using the Monarch RNA Purification Kit (500 µg, NEB). The isolated crude RNA (approximately 150 µg, 2.5–3.5 g RNA per liter of IVT reaction mixture) was separated and analyzed by RP-HPLC with the following column: PolymerX RP-1 3 µm 100 Å, 4.1 x 150 mm; flow rate 1.0 ml / min at 60ºC; solvent A: 100 mM TEAA pH 7.0; solvent B: 200 mM TEAA pH 7.0 / acetonitrile 1:1 (v / v); elution: from 20% to 32.5% B over 25 min, then from 32.5% to 100% B over 2 min, followed by 100% B for 2 min. Concentrate the HPLC eluent containing the desired RNA product by precipitation: Add sodium acetate (0.1 V, 3.0 M, pH 5.2) and isopropanol (1.0–1.5 V) to the eluent (initial volume = 1 V), and cool the solution at -80°C for 30 min or at -20°C overnight. Centrifuge the precipitate (30 min, 14000 g, 4°C), wash with 80% ethanol (1.0 ml), centrifuge (10 min, 14000 g, 4°C), dry under vacuum, and resuspend in water to obtain the RNA product (70–130 µg, 50%–90% of the crude product).

[0166] Example 7. Chemical cyclization of RNA

[0167] The diluted precursor RNA solution (30–40 µg, approximately 140 µM in 490 µl, precursor circRNAs 2, 4–6, 8, 10, 12, 13, 15, 17) was mixed with buffer (70 µl, 800 mM KH₂PO₄, 200 mM NaCl, pH 7.0) and incubated at 65ºC for 5 min. Afterward, the hot solution was transferred to the workbench and allowed to cool to room temperature. After 10–15 min at room temperature, fresh sodium periodate solution (70 µl, 10 mM) was added, and the reaction mixture was immediately placed in the dark and incubated at 25ºC. After 30 min, fresh sodium cyanoborohydride solution (70 µl, 200 mM) was added, and incubation continued for 90 min. The crude circRNA product was separated from the reaction mixture using a Monarch RNA purification kit (50 µg, NEB). The isolated RNA (80%–99% of the initial volume) was analyzed by RP-HPLC with the following parameters: column: PolymerX RP-1 3 µm 100 Å, 4.1 x 150 mm; flow rate: 1.0 ml / min at 60°C; solvent A: 100 mM HAA, pH 7.0; solvent B: 100 mM HAA, pH 7, in 75% acetonitrile; elution: from 55% to 60% B over 25 min, then from 60% to 100% B over 2 min, then 100% B for 2 min. The HPLC eluent containing the desired RNA product was concentrated by precipitation: sodium acetate (0.1 V, 3.0 M, pH 5.2) and isopropanol (1.0–1.5 V) were added to the eluent (initial volume = 1 V), and the solution was cooled at -80°C for 30 min or at -20°C overnight. The precipitate was centrifuged (30 min, 14000 g, 4ºC), washed with 80% ethanol (1.0 ml), centrifuged again (10 min, 14000 g, 4ºC), dried under vacuum, and resuspended in water to obtain the circRNA product (5–10 µg, 15%–25% of the initial amount). For further purification and removal of linear RNA, the product was treated with RNase R as described below (see the section on RNase R digestion).

[0168] Example 8. RNA cyclization in the presence of complementary oligonucleotides

[0169] The diluted precursor RNA solution (30–40 µg, approximately 145 µM in 480 µl, precursor circRNAs 2, 4–6, 8, 10, 12, 13, 15, 17) was mixed with buffer (70 µl, 800 mM KH₂PO₄, 200 mM NaCl, pH 7.0) and complementary oligonucleotides (approximately 11 µl, 10 µM, 1.5 equivalents, see sequences in Table 3) and incubated at 65ºC for 5 min. Afterward, the hot solution was transferred to the workbench and cooled to room temperature. After 10–15 min at room temperature, fresh sodium periodate solution (70 µl, 10 mM) was added, and the reaction mixture was immediately placed in the dark and incubated at 25ºC. After 30 min, fresh sodium cyanoborohydride solution (70 µl, 200 mM) was added, and incubation continued for 90 min. Crude circRNA products were isolated from the reaction mixture using the Monarch RNA Purification Kit (50 µg, NEB). The isolated RNA was analyzed by RP-HPLC with the following parameters: column: PolymerX RP-1 3 µm 100 Å, 4.1 x 150 mm; flow rate: 1.0 ml / min at 60ºC; solvent A: 100 mM HAA, pH 7.0; solvent B: 100 mM HAA, pH 7, in 75% acetonitrile; elution: from 55% to 60% B over 25 min, then from 60% to 100% B over 2 min, followed by 100% B for 2 min. Concentrate the HPLC eluent containing the desired RNA product by precipitation: Add sodium acetate (0.1 V, 3.0 M, pH 5.2) and isopropanol (1.0–1.5 V) to the eluent (initial volume = 1 V), and cool the solution at -80°C for 30 min or at -20°C overnight. Centrifuge the precipitate (30 min, 14000 g, 4°C), wash with 80% ethanol (1.0 ml), centrifuge (10 min, 14000 g, 4°C), dry under vacuum, and resuspend in water to obtain the circRNA product (5–10 µg, 15%–25% of the initial amount). For further purification and removal of linear RNA, treat the product with RNase R as described below (see the section on RNase R digestion).

[0170] Example 9. Enzymatic cyclization of T4 RNA ligase I

[0171] The diluted precursor RNA solutions (10–15 µg, approximately 150 µM in 95 µl, precursor circRNAs 1, 3, 7, 9, 11, 14, and 16) were mixed with buffer (5 µl, 100 mM Tris-HCl, 500 mM NaCl, pH 7.0) and incubated at 65ºC for 5 min. Afterward, the heated solution was transferred to the workbench and cooled to room temperature on the workbench. After 10–15 min at room temperature, add 10 x T4 RNA ligase 1 buffer (15 µl, 500 mM Tris-HCl, 100 mM MgCl2, 10 mM DTT, pH 7.5, NEB), PEG 8000 (15 µl, 50%, NEB), ATP (0.75 µl, 10 mM, NEB), RiboLock RNase inhibitor (3.75 µl, 40 U / µl, Thermo), and T4 RNA ligase 1 (15 µl, 10 U / µl, NEB), and incubate the reaction mixture at 25ºC for 150 min. Separate the crude circRNA product from the reaction mixture using a Monarch RNA purification kit (10 µg, NEB). The isolated RNA (80%–99% of the initial volume) was analyzed by RP-HPLC with the following column settings: RNASept Prep 2 µm 100 Å, 7.8 x 50 mm; flow rate 1.0 ml / min at 60ºC; solvent A: 100 mM HAA pH 7.0 in 10% acetonitrile; solvent B: 100 mM HAA pH 7 in 75% acetonitrile; elution: from 20% to 70% B over 25 min, then from 70% to 100% B over 2 min, then 100% B for 2 min. The HPLC eluent containing the desired RNA product was concentrated by precipitation: sodium acetate (0.1 V, 3.0 M, pH 5.2) and isopropanol (1.0–1.5 V) were added to the eluent (initial volume = 1 V), and the solution was cooled at -80ºC for 30 min or at -20ºC overnight. The precipitate was centrifuged (30 min, 14000 g, 4ºC), washed with 80% ethanol (1.0 ml), centrifuged again (10 min, 14000 g, 4ºC), dried under vacuum, and resuspended in water to obtain the circRNA product (1–4 µg, 10%–30% of the crude product). For further purification and removal of linear RNA, the product was treated with RNase R as described below (see the section on RNase R digestion).

[0172] Example 10. Enzymatic cyclization of T4 RNA ligase II

[0173] The diluted precursor RNA solution (30–40 µg in 220 µl, approximately 320 µM, precursor circRNAs 1, 3, 7, 9, 11, 14, 16) was mixed with complementary oligonucleotides (approximately 11 µl, 10 µM, 1.5 equivalents, see sequences in Table 3) and incubated at 65ºC for 5 min. Afterward, the hot solution was transferred to a workbench and cooled to room temperature on the workbench. After 10–15 min at room temperature, add 10 x T4 RNA ligase 2 buffer (35 µl, 500 mM Tris-HCl, 20 mM MgCl2, 10 mM DTT, 4 mM ATP, pH 7.5, NEB), PEG 8000 (70 µl, 50%, NEB), RiboLock RNase inhibitor (8.75 µl, 40 U / µl, Thermo), and T4 RNA ligase 2 (3.5 µl, 10 U / µl, NEB), and incubate the reaction mixture at 25ºC for 150 min. Separate the crude circRNA product from the reaction mixture using a Monarch RNA purification kit (500 µg, NEB). The isolated RNA (80%–99% of the initial volume) was analyzed by RP-HPLC with the following parameters: column: PolymerX RP-1 3 µm 100 Å, 4.1 x 150 mm; flow rate: 1.0 ml / min at 60°C; solvent A: 100 mM HAA, pH 7.0; solvent B: 100 mM HAA, pH 7, in 75% acetonitrile; elution: from 55% to 60% B over 25 min, then from 60% to 100% B over 2 min, followed by 100% B for 2 min. The HPLC eluent containing the desired RNA product was concentrated by precipitation: sodium acetate (0.1 V, 3.0 M, pH 5.2) and isopropanol (1.0–1.5 V) were added to the eluent (initial volume = 1 V), and the solution was cooled at -80°C for 30 min or at -20°C overnight. The precipitate was centrifuged (30 min, 14000 g, 4ºC), washed with 80% ethanol (1.0 ml), centrifuged again (10 min, 14000 g, 4ºC), dried under vacuum, and resuspended in water to obtain the circRNA product (5–10 µg, 15%–25% of the initial amount). For further purification and removal of linear RNA, the product was treated with RNase R as described below (see the section on RNase R digestion).

[0174] Example 11. Self-splicing looping using a substitutional intron-exon (PIE) system

[0175]

[0176] Linear precursors and circular products (precursor circRNA18 and circRNA18) of mRNA were produced from linearized plasmid DNA (PL10) via in vitro transcription. All components of the reaction mixture listed in the table above were mixed at room temperature in the following order: water, transcription buffer x5 (200 mM Tris-HCl pH 7.9, 30 mM MgCl2, 50 mM DTT, 50 mM NaCl and 10 mM spermidine, Thermo), NTP (Thermo), DNA template, MgCl2, Ribolock (Thermo), and T7 RNA polymerase HC (Thermo). The reaction mixture was vortexed, gently centrifuged, and incubated at 37ºC for 2 h. Then, DNase I (2.0 μl, 1 U / μl, Thermo) was added, and the mixture was incubated at 37ºC for 30 min. The RNA products were isolated from the reaction mixture using a Monarch RNA purification kit (500 µg, NEB). The isolated RNA (approximately 200 µg) was analyzed by RP-HPLC with the following parameters: column: PolymerX RP-1 3 µm 100 Å, 4.1 x 150 mm; flow rate: 1.0 ml / min at 60ºC; solvent A: 100 mM TEAA pH 7.0; solvent B: 200 mM TEAA pH 7.0 / acetonitrile 1:1 (v / v); elution: from 20% to 32.5% B over 25 min, then from 32.5% to 100% B over 2 min, followed by 100% B for 2 min. The HPLC eluent containing the desired RNA product was concentrated by precipitation: sodium acetate (0.1 V, 3.0 M, pH 5.2) and isopropanol (1.0–1.5 V) were added to the eluent (initial volume = 1 V), and the solution was cooled at -80ºC for 30 min or overnight at -20ºC. Centrifuge the precipitate (30 min, 14000 g, 4ºC), wash with 80% ethanol (1.0 ml), centrifuge (10 min, 14000 g, 4ºC), dry under vacuum, and resuspend in water to obtain the RNA product (100–180 µg, 50%–90% of the crude product). For circRNA, add additional GTP along with a magnesium-containing buffer to a final concentration of 2 mM. Heat the RNA to 55ºC for 8 min, then perform column purification.

[0177] Example 12. RP-HPLC of circRNA

[0178] All HPLC separations were performed on a modular low-pressure gradient HPLC system (LC-40 / LC-20 series) manufactured by Shimadzu, equipped with a temperature-controlled column rack or column oven, a DAD detector, and a fluorescence detector. The mobile phase consisted of non-autoclaved MQ water, HPLC-grade acetonitrile (JTBaker), high-quality triethylamine (Bioultra, Sigma), HPLC-grade n-hexylamine (Ottokemi), and HPLC-grade glacial acetic acid (JTBaker). Solvents with the desired composition, concentration, and pH were filtered through a 0.45 μm filter and stored in the dark at 4ºC for extended periods. Chromatograms were recorded, showing absorbance at 260 nm (reference 360 ​​nm, 10 nm bandwidth), absorption spectra (220–700 nm), and target fluorescence (Cy3–550 / 565, Cy5–650 / 665).

[0179] Example 13. RNase R digestion

[0180] The RNA solution (43 µl, 10 µg) was incubated at 65ºC for 5 min and then rapidly cooled in an ice bath. After 5 min at 0–4ºC, 10 x RNase R buffer (5 µl, 200 mM Tris-HCl, 1 M KCl, 1 mM MgCl2, pH 7.5, ABM), RiboLock RNase inhibitor (1.25 µl, 40 U / µl, Thermo), and RNase R (1 µl, 10 U / µl, ABM) were added. After incubation at 37ºC for 30 min, the digestion products were analyzed directly by PAGE or separated from the reaction mixture using the Monarch RNA Purification Kit (10 µg, NEB).

[0181] Example 14. RNase H assay

[0182] A solution (8.5 µl) containing circRNA2 (100 ng), DNA oligonucleotides (0 or 150 nM, CCTTCAGCTCGATGCGGTTCA), and RNase H buffer x1 (20 mM Tris-HCl, 10 mM KCl, 8 mM MgCl2, 1 mM DTT, Thermo) was heated to 65ºC for 5 min and then gradually cooled to 37ºC for 30 min. Next, RiboLock RNase inhibitor (0.5 µl, 40 U / µl, Thermo) and RNase H (1 µl, 5 U / µl, Thermo) were added. After incubation at 37ºC for 30 min, the digestion products were directly analyzed by PAGE.

[0183] Example 15. Synthesis of FRET probes

[0184] The Cy5-RNA1-Cy3 FRET probe was synthesized according to a previously reported protocol. 31 The first in vitro transcription of the RNA1 sequence was performed in the presence of N3-AG transcription initiator. The crude IVT product was isolated using the Monarch RNA Purification Kit (NEB) and subjected to dual labeling with 5'-Cy5 and 3'-Cy3. The crude labeled product was separated from the labeling reaction mixture using the Monarch RNA Purification Kit (NEB) and subsequently analyzed by HPLC. The HPLC eluent containing the desired product was concentrated by precipitation, dried under vacuum, and suspended in water to obtain the Cy5-RNA1-Cy3 FRET probe solution.

[0185] Example 16. FRET Experiment

[0186] The Cy5-RNA1-Cy3 FRET probe solution was diluted with buffer (80 mM KH2PO4, 20 mM NaCl, pH 7.0, final volume 100 µl) to obtain a final probe concentration of 100 nM and transferred to a quartz fluorescence cuvette (1 x 1 x 350 mm). Optionally, a solution of complementary DNA oligonucleotides (2 µl, 10 µM, ON2-ON5) was added. The mixture was heated from 20ºC to 90ºC over 8 min and then gradually cooled to 20ºC or 4ºC over 20–30 min. Emission spectra were recorded on a CaryEclipse spectrofluorometer (Agilent) equipped with a xenon lamp, a single-sample-cell Peltier attachment (SPVF1X0, Agilent), excitation at 500 nm, emission at 510–800 nm, and a 10 mm slit.

[0187] Example 17. Cell Culture and Transfection

[0188] Analysis was performed in four cell lines: HEK 293T, Hep G2, A549, and HeLa, as well as in mouse dendritic cells and macrophages derived from bone marrow mononuclear cells. One day prior to transfection, 8x10... 3Cells were seeded in each well of a 96-well plate. The next day, the cells were transfected with RNA. For each cell line, each RNA variant was transfected in triplicate. Transfection was performed using Lipofectamine Messenger MAX (Invitrogen, Waltham, MATLAB, USA) according to the manufacturer's instructions. During transfection, the molar concentration of each RNA was considered such that an equal amount of RNA molecule was added to each well. Briefly, for each reaction, 0.15 μL of the liposome transfection reagent (Lipofectamine) was first diluted in 5 μL of Opti-MEM (GIBCO, Grand Alan, NY, USA) medium (mixture 1) and incubated at room temperature for 10 minutes. In another tube, the RNA was diluted in 5 μL of Opti-MEM medium (mixture 2). Next, mixture 1 and mixture 2 were combined and incubated at room temperature for 5 minutes. Then, 10 μL of the mixture was transferred to the appropriate wells of a 96-well plate containing the previously seeded cells. Following transfection, cells were incubated under standard culture conditions (37ºC, 5% CO2, saturated humidity). At appropriate time points, 20 μL of medium was removed from each well to test the amount of protein produced, and the remaining medium was completely replaced with fresh medium. The amount of luciferase released into the medium was analyzed using GLuc GLOW Assay (NanoLight Technologies, Norman, Oklahoma, USA) reagents, following the manufacturer's instructions. Luminescence was read in a white opaque plate. Measurements were performed using an EnVision plate reader (Perkin Elmer, Waltham, Massachusetts, USA).

[0189] in conclusion

[0190] In summarizing the results presented, it should be noted that these results confirm the unexpected advantages of the chemical cyclization proposed according to the present invention compared with known methods using enzymatic ligation.

[0191] The method according to the present invention allows for better cyclization efficiency.

[0192] Furthermore, the method according to the invention allows for the reduction of the formation of undesirable byproducts (such as polymers, dimers) that contaminate products obtained by known enzymatic methods.

[0193] Furthermore, the method of the present invention is independent of the sequence and length of the circularized mRNA. In particular, the circularized mRNA may contain sequences such as 5' and 3' UTR, CDS, and poly(A).

[0194] The method of the present invention is also compatible with other possible modifications that may occur within the polynucleotide chain, such as, for example, N-methylpseudouridine or the presence of a detectable tag or label.

[0195] Furthermore, the method of the present invention is more advantageous than the known PIE method. This is evidenced by the characteristics of the byproducts formed in the two reactions.

[0196] References

[0197] (1) Qin, S.; Tang, X.; Chen, Y.; Chen, K.; Fan, N.; Xiao, W.; Zheng,Q.; Li, G.; Teng, Y.; Wu, M.; et al. 10.1038 / s41392-022-01007-w (acccessed 2022-10-07T12:03:06).Janowski, M.; Andrzejewska, A. The legacy of mRNA engineering: A lineup ofpioneers for the Nobel Prize. Molecular Therapy - Nucleic Acids 2022, 29,272-284. DOI: 10.1016 / j.omtn.2022.07.003 (Accessed 2022-10-07T11:43:22).

[0198] (2) Garneau, NL; Wilusz, J.; Wilusz, CJ The highways and byways of mRNA decay. Nature Reviews Molecular Cell Biology 2007, 8 (2), 113-126.DOI: 10.1038 / nrm2104. Houseley, J.; Tollervey, D. The Many Pathways of RNADegradation. Cell 2009, 136 (4), 763-776. DOI: 10.1016 / j.cell.2009.01.019(accessed 2022-10-07T12:34:14).

[0199] (3) Jeck, W. R.; Sharpless, N. E. Detecting and characterizingcircular RNAs. Nature Biotechnology 2014, 32 (5), 453-461. DOI: 10.1038 / nbt.2890 (acccessed 2022-10-07T12:45:35).

[0200] (4) Dolinnaya, N. G.; Blumenfeld, M.; Merenkova, I. N.; Oretskaya, T.S.; Krynetskaya, N.; Ivanovskaya, M. G.; Vasseur, M.; Shabarova, Z. A.Oligonucleotide circularization by template-directed chemical ligation.Nucleic Acids Research 1993, 21 (23), 5403-5407. DOI: 10.1093 / nar / 21.23.5403(acccessed 10 / 7 / 2022). Fedorova, O. A.; Gottikh, M. B.; Oretskaya, T. S.;Shabarova, Z. A. Cyanogen Bromide-Induced Chemical Ligation: Mechanism andOptimization of the Reaction Conditions. Nucleosides and Nucleotides 1996, 15(6), 1137-1147. DOI: 10.1080 / 07328319608007382.

[0201] (5) Nakamoto, K.; Abe, N.; Tsuji, G.; Kimura, Y.; Tomoike, F.;Shimizu, Y.; Abe, H. Chemically synthesized circular RNAs withphosphoramidate linkages enable rolling circle translation. ChemicalCommunications 2020, 56 (46), 6217-6220, 10.1039 / D0CC02140G. DOI: 10.1039 / D0CC02140G.

[0202] (6) Rigden, J. E.; Rezaian, M. A. In Vitro synthesis of an infectiousviroid: Analysis of the infectivity of monomeric linear CEV. Virology 1992,186 (1), 201-206. DOI: https: / / doi.org / 10.1016 / 0042-6822(92)90074-Y .

[0203] (7) Chen, C.-y.; Sarnow, P. Initiation of Protein Synthesis by theEukaryotic Translational Apparatus on Circular RNAs. Science 1995, 268(5209), 415-417. DOI: 10.1126 / science.7536344 (acccessed 2022 / 10 / 07).

[0204] (8) Litke, J. L.; Jaffrey, S. R. Highly efficient expression ofcircular RNA aptamers in cells using autocatalytic transcripts. NatureBiotechnology 2019, 37 (6), 667-675. DOI: 10.1038 / s41587-019-0090-6(acccessed 2022-10-07T13:55:58).

[0205] (9) Kumar, A.; Palmer, N.; Miyasaki, K.; Finburgh, E.; Xiang, Y.;Portell, A.; Dailamy, A.; Suhardjo, A.; Chew, W. L.; Kwon, E. J.; et al.Extensive in vitro and in vivo protein translation via in situ circularizedRNAs. Cold Spring Harbor Laboratory: 2022.

[0206] (10) Ford, E.; Ares, M. Synthesis of circular RNA in bacteria andyeast using RNA cyclase ribozymes derived from a group I intron of phage T4.Proceedings of the National Academy of Sciences 1994, 91 (8), 3117-3121. DOI:10.1073 / pnas.91.8.3117 (acccessed 2022-10-07T13:11:48).

[0207] (11) Wesselhoeft, R. A.; Kowalski, P. S.; Anderson, D. G. Engineeringcircular RNA for potent and stable translation in eukaryotic cells. NatureCommunications 2018, 9 (1). DOI: 10.1038 / s41467-018-05096-6 (acccessed 2022-10-07T13:35:12).

[0208] (12) Wesselhoeft, R. A.; Kowalski, P. S.; Parker-Hale, F. C.; Huang,Y.; Bisaria, N.; Anderson, D. G. RNA Circularization DiminishesImmunogenicity and Can Extend Translation Duration In Vivo. Molecular Cell2019, 74 (3), 508-520.e504. DOI: 10.1016 / j.molcel.2019.02.015 (acccessed2022-10-07T13:26:51).

[0209] (13) Ni, L.; Yamada, T.; Murata, A.; Nakatani, K. Mismatch bindingligand upregulated back-splicing reaction producing circular RNA in acellular model. Chemical Communications 2022, 58 (22), 3629-3632. DOI:10.1039 / d1cc06936e (acccessed 2022-10-07T13:11:41).

[0210] (14) Qu, L.; Yi, Z.; Shen, Y.; Lin, L.; Chen, F.; Xu, Y.; Wu, Z.;Tang, H.; Zhang, X.; Tian, F.; et al. Circular RNA vaccines against SARS-CoV-2 and emerging variants. Cell 2022, 185 (10), 1728-1744.e1716. DOI: 10.1016 / j.cell.2022.03.044 (acccessed 2022-10-07T13:26:16).

[0211] (15) Nichols, N. M.; Tabor, S.; McReynolds, L. A. RNA Ligases.Current Protocols in Molecular Biology 2008, 84 (1), 3.15.11-13.15.14, https: / / doi.org / 10.1002 / 0471142727.mb0315s84 . DOI: https: / / doi.org / 10.1002 / 0471142727.mb0315s84 (acccessed 2022 / 10 / 07).

[0212] (16) Kaufmann, G.; Klein, T.; Littauer, U. Z. T4 RNA ligase:Substrate chain length requirements. FEBS Letters 1974, 46 (1-2), 271-275.DOI: 10.1016 / 0014-5793(74)80385-6 (acccessed 2022-10-07T13:11:45).

[0213] (17) Puttaraju, M.; Been, M. Group I permuted intron-exon (PIE)sequences self-splice to produce circular exons. Nucleic Acids Research 1992,20 (20), 5357-5364. DOI: 10.1093 / nar / 20.20.5357 (acccessed 2022-10-10T16:55:04).

[0214] (18) Ramanathan, A.; Robb, G. B.; Chan, S.-H. mRNA capping:biological functions and applications. Nucleic Acids Research 2016, 44 (16),7511-7526. DOI: 10.1093 / nar / gkw551 (acccessed 10 / 7 / 2022). Topisirovic, I.;Svitkin Yuri, V.; Sonenberg, N.; Shatkin Aaron, J. Cap and cap‐bindingproteins in the control of gene expression. Wiley Interdisciplinary Reviews:RNA 2010, 2 (2), 277-298. DOI: 10.1002 / wrna.52 (acccessed 2018 / 05 / 06).Mitchell, S. F.; Walker, S. E.; Algire, M. A.; Park, E.-H.; Hinnebusch, A.G.; Lorsch, J. R. The 5′-7-Methylguanosine Cap on Eukaryotic mRNAs ServesBoth to Stimulate Canonical Translation Initiation and to Block anAlternative Pathway. Molecular Cell 2010, 39 (6), 950-962. DOI: 10.1016 / j.molcel.2010.08.021 (acccessed 2022-10-07T14:25:08).

[0215] (19) Koch, A.; Aguilera, L.; Morisaki, T.; Munsky, B.; Stasevich, T.J. Quantifying the dynamics of IRES and cap translation with single-moleculeresolution in live cells. Nature Structural & Molecular Biology 2020, 27(12), 1095-1104. DOI: 10.1038 / s41594-020-0504-7.

[0216] (20) Warminski, M.; Sikorski, P. J.; Kowalska, J.; Jemielity, J.Applications of Phosphate Modification and Labeling to Study (m)RNA Caps.Topics in Current Chemistry 2017, 375 (1), 16. DOI: 10.1007 / s41061-017-0106-y.

[0217] (21) Sikorski, P. J.; Warminski, M.; Kubacka, D.; Ratajczak, T.;Nowis, D.; Kowalska, J.; Jemielity, J. The identity and methylation status ofthe first transcribed nucleotide in eukaryotic mRNA 5′ cap modulates proteinexpression in living cells. Nucleic acids research 2020, 48 (4), 1607-1626.

[0218] (22) Chen, C.-K.; Cheng, R.; Demeter, J.; Chen, J.; Weingarten-Gabbay, S.; Jiang, L.; Snyder, M. P.; Weissman, J. S.; Segal, E.; Jackson, P.K.; et al. Structured elements drive extensive circular RNA translation.Molecular Cell 2021, 81 (20), 4300-4318.e4313. DOI: 10.1016 / j.molcel.2021.07.042 (acccessed 2022 / 10 / 07). Yang, Y.; Fan, X.; Mao, M.;Song, X.; Wu, P.; Zhang, Y.; Jin, Y.; Yang, Y.; Chen, L.-L.; Wang, Y.; et al.Extensive translation of circular RNAs driven by N6-methyladenosine. CellResearch 2017, 27 (5), 626-641. DOI: 10.1038 / cr.2017.31 (acccessed 2022-10-07T13:35:12). Fan, X.; Yang, Y.; Chen, C.; Wang, Z. Pervasive translation ofcircular RNAs driven by short IRES-like elements. Nature Communications 2022,13 (1). DOI: 10.1038 / s41467-022-31327-y (acccessed 2022-10-10T11:25:34).

[0219] (23) Lei, M.; Zheng, G.; Ning, Q.; Zheng, J.; Dong, D. Translationand functional roles of circular RNAs in human cancer. Molecular Cancer 2020,19 (1). DOI: 10.1186 / s12943-020-1135-7 (acccessed 2022-10-07T13:34:49).Prats, A.-C.; David, F.; Diallo, L. H.; Roussel, E.; Tatin, F.; Garmy-Susini,B.; Lacazette, E. Circular RNA, the Key for Translation. InternationalJournal of Molecular Sciences 2020, 21 (22), 8591. DOI: 10.3390 / ijms21228591(acccessed 2022-10-07T13:30:21).

[0220] (24) Martinez-Salas, E.; Francisco-Velilla, R.; Fernandez-Chamorro,J.; Embarek, A. M. Insights into Structural and Mechanistic Features of ViralIRES Elements. Frontiers in Microbiology 2018, 8, Review. Marques, R.;Lacerda, R.; Romão, L. Internal Ribosome Entry Site (IRES)-MediatedTranslation and Its Potential for Novel mRNA-Based Therapy Development.Biomedicines 2022, 10 (8), 1865. DOI: 10.3390 / biomedicines10081865 (acccessed2023-02-13T14:08:04). Chen, R.; Wang, S. K.; Belk, J. A.; Amaya, L.; Li, Z.;Cardenas, A.; Abe, B. T.; Chen, C.-K.; Wender, P. A.; Chang, H. Y.Engineering circular RNA for enhanced protein production. NatureBiotechnology 2022. DOI: 10.1038 / s41587-022-01393-0 (acccessed 2022-10-07T11:58:17).

[0221] (25) Nowotny, M.; Gaidamakov, S. A.; Ghirlando, R.; Cerritelli, S.M.; Crouch, R. J.; Yang, W. Structure of human RNase H1 complexed with anRNA / DNA hybrid: insight into HIV reverse transcription. Molecular cell 2007,28 (2), 264-276.

[0222] (26) Jacques, J.-P.; Susskind, M. M. Use of electrophoretic mobilityto determine the secondary structure of a small antisense RNA. Nucleic AcidsResearch 1991, 19 (11), 2971-2977. DOI: 10.1093 / nar / 19.11.2971 (acccessed2022-10-07T16:18:29). Cebrián, J.; Kadomatsu-Hermosa, M. J.; Castán, A.; Martínez, V.; Parra, C.; Fernández-Nestosa, M. J.; Schaerer, C.; Martínez-Robles,M.-L.; Hernández, P.; Krimer, D. B.; et al. Electrophoretic mobility ofsupercoiled, catenated and knotted DNA molecules. Nucleic Acids Research2015, 43 (4), e24-e24. DOI: 10.1093 / nar / gku1255 (acccessed 10 / 7 / 2022).

[0223] (27) Abe, B. T.; Wesselhoeft, R. A.; Chen, R.; Anderson, D. G.;Chang, H. Y. Circular RNA migration in agarose gel electrophoresis. MolecularCell 2022, 82 (9), 1768-1777.e1763. DOI: 10.1016 / j.molcel.2022.03.008(acccessed 2022-10-07T13:26:14).

[0224] (28) Haque, F. M.; Grayson, S. M. The synthesis, properties andpotential applications of cyclic polymers. Nature Chemistry 2020, 12 (5),433-444. DOI: 10.1038 / s41557-020-0440-5 (acccessed 2022-10-07T13:56:08).

[0225] (29) Vicens, Q.; Kieft, J. S. Thoughts on how to think (and talk)about RNA structure. Proceedings of the National Academy of Sciences 2022,119 (17). DOI: 10.1073 / pnas.2112677119 (acccessed 2022-10-07T12:03:32).

[0226] (30) Kibbe, W. A. OligoCalc: an online oligonucleotide propertiescalculator. Nucleic Acids Research 2007, 35 (suppl_2), W43-W46. DOI: 10.1093 / nar / gkm234 (acccessed 10 / 10 / 2022).

[0227] (31) Mamot, A.; Sikorski, P. J.; Siekierska, A.; de Witte, P.;Kowalska, J.; Jemielity, J. Ethylenediamine derivatives efficiently reactwith oxidized RNA 3′ ends providing access to mono and dually labelled RNAprobes for enzymatic assays and in vivo translation. Nucleic Acids Research2022, 50 (1), e3-e3. DOI: 10.1093 / nar / gkab867 (acccessed 2 / 17 / 2022).

Claims

1. A circRNA analog according to Formula 1 in: n is any integer from 1 to 20000; X and each X n It can be OH, BH3, NH2, or SH independently; Y and each Y n It can be either O or S independently; Z and each Z n It can be O, S, or NH independently; W and each W n It can be O, S, or NH independently; R and each R n It can be H, OH, alkyl, O-alkyl, or halogen independently; B, B' and each B n Nucleoside bases that are either natural, modified, or non-natural; L is a linear or branch header.

2. The circRNA analog according to claim 1, wherein... The connector L is a single-key connector or a connector according to one of formulas 2-7: 。 3. The circRNA analog according to any one of claims 1-2, wherein: The connector L contains a detectable tag or mark.

4. A method for synthesizing a circRNA analog according to any one of claims 1-3, characterized in that the method contains a circRNA analog precursor (Formula 8). in: n = 1-20000； X and each X n It can be OH, BH3, NH2, or SH independently; Y and each Y n It can be either O or S independently; Z and each Z n It can be O, S, or NH independently; W and each W n It can be O, S, or NH independently; R and each R n It can be H, OH, alkyl, O-alkyl, or halogen independently; B, B' and each B n Nucleoside bases that are either natural, modified, or non-natural; L is a linear or branch header; First, it is oxidized in step (i) of the method to produce a dialdehyde derivative (Formula 9). in: n = 1-20000； X and each X n It can be OH, BH3, NH2, or SH independently; Y and each Y n It can be either O or S independently; Z and each Z n It can be O, S, or NH independently; W and each W n It can be O, S, or NH independently; R and each R n It can be H, OH, alkyl, O-alkyl, or halogen independently; B, B' and each B n Nucleoside bases that are either natural, modified, or non-natural; L is a linear or branch header; Then, during step (ii) of the method, the circRNA analog is incubated in a reducing environment to produce the desired circRNA analog.

5. The method according to claim 4, wherein The connector L is a single-key connector or a connector according to one of formulas 2-7: 。 6. The method according to claim 4, wherein steps (i) and (ii) are carried out in a reactor.

7. The method according to claim 4, characterized in that step (i) of the method is carried out in the presence of NaIO4, preferably at a concentration of less than 10 mM, at a temperature of less than 60ºC.

8. The method according to claim 4, characterized in that step (ii) of the method is carried out in a buffer solution, preferably at pH 5-8, in the presence of less than 100 mM NaBH3CN.

9. The method according to claim 4, characterized in that step (i) or step (ii) of the method is performed in the presence of a natural, modified or non-natural nucleic acid oligomer complementary to the RNA precursor sequence.

10. The method according to claim 4, characterized in that the circRNA analog is separated from the reaction mixture by a known RNA separation method, such as alcohol precipitation, size exclusion chromatography, gel electrophoresis or high performance liquid chromatography (HPLC).

11. Use of the circRNA analogue according to any one of claims 1-3 in protein production in an in vitro setting, wherein the in vitro setting includes, but is not limited to, artificial reaction mixtures, cell lysates, nuclear lysates, cell cultures, and tissue cultures.

12. The circRNA analog according to any one of claims 1-3, wherein the circRNA analog is used in therapeutic or diagnostic methods, particularly for protein production in an in vivo setting, the in vivo setting including but not limited to intact organisms, organs, cells and tissue grafts.

13. A pharmaceutical composition comprising a circRNA analog according to any one of claims 1-3.

Images