Fungus lyy-02 for degrading straw and application thereof
The microbial degradation method using the fungus LYY-02 has solved the problems of high equipment cost, high energy consumption, and chemical pollution in the straw degradation process, and has achieved efficient, environmentally friendly degradation and resource utilization of straw.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GUIZHOU MINZU UNIV
- Filing Date
- 2026-04-03
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies for straw degradation suffer from problems such as high equipment costs, high energy consumption, environmental pollution from chemical treatment, and long degradation cycles, as well as a shortage of highly efficient bacterial strains.
Microbial degradation was carried out using the fungus LYY-02. By mixing and culturing it with straw at room temperature and pressure, the filter paper strips were completely degraded within 7 days using its strong cellulase activity, and the degradation rate of corn straw reached 24.50% within 14 days.
It achieves efficient and environmentally friendly degradation of straw, avoids chemical reagent residues and equipment corrosion, reduces equipment investment costs and energy consumption, and improves the efficiency of straw resource utilization.
Smart Images

Figure CN122104440A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial degradation technology, specifically to a fungus LYY-02 for degrading straw and its applications. Background Technology
[0002] Straw is generally a dry, fibrous plant residue with a hard texture, and is a byproduct of crop harvesting. 20%–30% of straw is lignin, which combines with cellulose and hemicellulose to form a dense structure, making straw difficult to degrade. Traditional straw treatment methods mainly include physical and chemical methods. Physical methods typically use crushing and steam explosion to process straw, which are not only expensive in terms of equipment but also energy-intensive. Chemical methods usually use strong acids and alkalis for pretreatment, which can easily produce byproducts that inhibit fermentation, and improper operation can leave residues that pollute the environment. Microbial degradation of straw has advantages such as safety, environmental friendliness, and low cost, making it a new approach to straw management. However, currently, there is a shortage of highly efficient bacterial strains, and the degradation cycle is long, often requiring tens of days. Therefore, discovering new strains that are highly efficient at degrading straw is of great significance for agricultural production. Summary of the Invention
[0003] This invention provides a fungus, LYY-02, for degrading straw and its applications. The fungus LYY-02 provided by this invention can completely degrade filter paper strips within 7 days and achieve a 24.50% degradation rate of corn straw within 14 days, providing an effective microbial solution for the resource utilization of agricultural waste such as straw.
[0004] This invention provides a fungus, LYY-02, for degrading straw. LYY-02 was deposited at the China Center for Type Culture Collection (CCTCC) on August 19, 2025, with accession number CCTCC NO: M 20251853, and is classified as follows: Myrmecridium schulzeri LYY-02.
[0005] The fungus LYY-02 provided by this invention can completely degrade filter paper strips within 7 days and achieve a degradation rate of 24.50% for straw within 14 days, providing an effective microbial solution for the resource utilization of agricultural waste such as straw.
[0006] The present invention also provides an LYY-02 seed culture, which is obtained by culturing the fungus LYY-02.
[0007] Further, the fungus LYY-02 was inoculated into 50 mL of CMC-Na medium and cultured on a shaker at 28℃~32℃ and 140 r / min~160 r / min for 46 h~50 h. Then, it was transferred to 50 mL of CMC-Na medium at a volume ratio of 0.5%~1.5% and cultured for another 46 h~50 h to obtain the LYY-02 seed culture.
[0008] The present invention also provides the application of the fungus LYY-02 or the LYY-02 seed liquid in the degradation of straw.
[0009] Furthermore, the degradation of straw is carried out by mixing LYY-02 seed liquid with straw and then culturing it. 1 L of culture system contains 10 mL to 30 mL of LYY-02 seed liquid and 16 g to 24 g of straw.
[0010] Furthermore, the 1 L culture system also contains 0.8 g to 1.2 g of potassium dihydrogen phosphate, 0.08 g to 0.12 g of magnesium sulfate heptahydrate, 0.08 g to 0.12 g of ferrous sulfate heptahydrate, 0.008 g to 0.012 g of manganese sulfate, and 1.8 g to 2.2 g of peptone.
[0011] Furthermore, the culture temperature is 28℃~32℃.
[0012] Furthermore, the culture time is 7 to 25 days.
[0013] Furthermore, the straw is corn straw.
[0014] Compared with the prior art, the beneficial effects of the present invention are as follows: The fungus LYY-02 provided by this invention has a strong ability to degrade cellulose materials: in the filter paper strip degradation experiment, the LYY-02 strain can completely degrade the filter paper strip within 7 days (Table 1), showing extremely high cellulase activity; in the degradation of actual agricultural waste - straw, the LYY-02 strain achieved a degradation rate of 24.50% of corn straw within 14 days (Table 2), proving its effective decomposition ability on complex natural cellulose substrates.
[0015] This invention employs microbial fermentation, completely avoiding the chemical residues, secondary pollution, and equipment corrosion problems that may arise from traditional physicochemical methods (such as strong acid or strong alkali pretreatment or steam explosion) in straw treatment, thus meeting the requirements of green environmental protection and sustainable development. Furthermore, compared to traditional methods requiring large equipment and high-temperature, high-pressure conditions, the microbial degradation process of this invention can be carried out at ambient temperature and pressure, with mild operating conditions, significantly reducing equipment investment costs and energy consumption. In addition, the biodegradation process is highly specific, unlikely to produce byproducts that inhibit subsequent fermentation processes, thus improving the potential and efficiency of straw resource utilization.
[0016] Information on the preservation of biological materials: LYY-02, referred to as fungus LYY-02 in this invention, was deposited on August 19, 2025, at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 20251853. The address of the depository is Wuhan University, Wuhan, China, postcode: 430072. It is classified and named as follows: Myrmecridium schulzeri LYY-02. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 The effect of staining LYY-02 strain with lactic acid cotton blue solution.
[0019] Figure 2 The colony morphology of strain LYY-02 on CMC-Na screening plates.
[0020] Figure 3 The colony morphology of strain LYY-02 on Congo red agar plates.
[0021] Figure 4 Phylogenetic tree of strain LYY-02. Detailed Implementation
[0022] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.
[0023] Example 1: Isolation and identification of fungus LYY-02.
[0024] I. Enrichment of bacterial strains The soil used for microbial isolation was taken from the rhizosphere soil of straw in a farmland in Suiyang County, Guizhou Province. The culture media used for enriching straw-degrading bacteria are mainly CMC-Na medium (1.57 g potassium dihydrogen phosphate trihydrate, 0.34 g potassium dihydrogen phosphate, 0.05 g calcium chloride, 0.25 g magnesium sulfate heptahydrate, 0.99 g ammonium sulfate, 10 g CMC-Na, 0.025 mg manganese sulfate monohydrate, 1 L distilled water, pH 7.0), basic straw inorganic salt medium (1.0 g potassium dihydrogen phosphate, 0.1 g magnesium sulfate heptahydrate, 0.1 g ferrous sulfate heptahydrate, 0.01 g manganese sulfate, 2 g peptone, 20 g straw powder, water to 1000 mL), CMC-Na screening medium (10 g CMC-Na, 1 g yeast extract, 20 g agar, water to 1000 mL), and CMC-Na identification medium (5.5 g CMC-Na, 0.99 g ammonium sulfate, 0.2 g magnesium sulfate heptahydrate). 2.0 g of dipotassium hydrogen phosphate, 0.5 g of sodium chloride, 0.5 g of yeast extract, 20 g of agar, and water to a final volume of 1000 mL. 50 mL of CMC-Na medium was added to a 150 mL Erlenmeyer flask and sterilized at 121℃ for 20 min. 10 g of soil was added to 50 mL of basic straw inorganic salt medium and cultured under constant temperature shaking at 30℃ and 150 rpm for 2 weeks. 5 mL of the culture was then added to 50 mL of basic straw inorganic salt medium and cultured under the same conditions. After three consecutive subcultures, 50 mL of the culture was added to 50 mL of CMC-Na medium and cultured under constant temperature shaking at 30℃ and 150 rpm for five consecutive subcultures. When the medium became clear (indicating that CMC-Na in the medium had been degraded and the abundance of cellulose-degrading bacteria was high), a strain enrichment was obtained for the isolation and purification of the strain.
[0025] II. Isolation and purification of strains The bacterial enrichment solution was serially diluted to 1×10⁻⁶ using 0.9% sterile physiological saline. -7The diluted solution was spread onto CMC-Na differential medium and incubated at 30℃. Colony growth was observed periodically. When the colony diameter reached 2±1 mm, continuous streaking was performed until a pure strain with consistent colony morphology was obtained. The pure strain was inoculated into 50 mL of the above CMC-Na medium and cultured at 30℃ and 150 r / min for 48 h. Then, it was transferred to 50 mL of CMC-Na medium at a volume ratio of 0.5%~1.5% and cultured for another 48 h to prepare a seed culture. Under sterile conditions, 1% of the seed culture was inoculated into filter paper strip disintegration medium (ammonium sulfate 1.0 g, magnesium sulfate heptahydrate 0.5 g, dipotassium hydrogen phosphate 1.0 g, yeast extract 0.1 g, 60 filter paper strips (1 cm × 6 cm), water added to 1000 mL). Each group was divided into three replicates. After 48 h of incubation at 30℃ and 150 rpm, the degradation of the filter paper strips was observed. The results (Table 1) show that the strain can completely degrade the filter paper on day 7.
[0026] Table 1. Degradation of filter paper strips by the strains Note: + indicates that the filter paper has softened, ++ indicates that the filter paper is 1 / 4 degraded, +++ indicates that the filter paper is 1 / 2 degraded, ++++ indicates that the filter paper is 3 / 4 degraded, and +++++ indicates that the filter paper is completely degraded.
[0027] III. Strain Identification Medulla staining microscopic examination results are shown in Figure 1 The stained bacterial cells are filamentous. On the CMC-Na differential medium described above, the colonies are irregular in shape, 1.5 ± 0.5 mm in diameter, with smooth edges, a smooth and moist surface, no protrusions, and a translucent, pale yellow color (see...). Figure 2 After incubation at 30℃ for 3 days on CMC-Na screening plates, 0.1% Congo red staining solution was added for staining for 15 min, followed by destaining with 1 mol / L NaCl solution for 2 min. The ratio of hydrolysis zone diameter D to colony diameter d was observed and calculated to be 2.930 (Table 2 and ). Figure 3 This indicates that the strain has a strong ability to secrete cellulase. Strain LYY-02 was sent to Shanghai Sangon Biotech (Shanghai) Co., Ltd. for identification and sequencing analysis. The ITS sequence (SEQ ID NO: 1) of this strain was amplified using universal primers ITS1 and ITS4, and its length was 530 bp. A phylogenetic tree was constructed using the ITS sequence. Figure 4 The results showed that this strain was similar to known strains. Myrmecridium schulzeri The strain showed the highest homology, confirming it as... Myrmecridium schulzeri It was named fungus LYY-02.
[0028] Table 2. Hydrolysis zone and colony diameter data of the strains on Congo red screening plates. SEQ ID NO: 1: CCTGCGGAGGGATCATTACGAGAGTGTCACCACTCCCA ACCCACTGTTTACCTACCCGTCCACCGTGCTTCGGCAGGCAGTCCTGTGG GACAGGGCCTCGCCCCCGCGAGGGGGTGCCTGCCGCTGGCCAACCAAAA ATTCTAGCTGTTTTTGTACCATCTGAGTCTTCCACAAATAAACAAAACTTT CAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGC GATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGC ACATTGCGCCCACTAGTATTCTGGTGGGCATGCCTGTTCGAGCGTCATTTC AACCCTCAAGCCTGGCTTGGTGTTGGGGCTCTGCGTCTGCAGTCCCTTAA ATCCAGTGGCGGACACGCTAGGTCTCCGAGCGCAGTAGTTTTCTCCTCGCT CAGGGCGTCCGGCGTGGGCTTGCCTCGCACCCATCTTTTACAAGGTTGAC CTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATC.
[0029] Example 2: The degradation effect of fungus LYY-02 on straw.
[0030] LYY-02 seed culture was transferred at a volume ratio of 2% to 50 mL of straw liquid culture medium (1.0 g potassium dihydrogen phosphate, 0.1 g magnesium sulfate heptahydrate, 0.1 g ferrous sulfate heptahydrate, 0.01 g manganese sulfate, 2 g peptone, water added to 1000 mL, and 1 g of corn straw fragments (2 ± 1 cm) added to each 50 mL culture medium). The medium was cultured at 30℃ and 150 r / min for 14 days to allow the fungus LYY-02 to degrade the corn straw fragments. After cultivation, the residue was filtered through a 100-mesh filter and collected, then dried in an oven at 85℃ until constant weight. The results (Table 2) showed that the LYY-02 strain could effectively degrade straw, with a degradation rate of 24.50% for corn straw in the straw liquid culture medium.
[0031] Table 3. Degradation data of straw by strain LYY-02 Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.
[0032] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. A fungus, LYY-02, for degrading straw, characterized in that, The fungus LYY-02 was deposited at the China Center for Type Culture Collection (CCTCC) on August 19, 2025, with accession number CCTCC NO: M 20251853, and classified as follows: Myrmecridium schulzeri LYY-02.
2. An LYY-02 seed liquid, characterized in that, The LYY-02 seed culture was obtained by culturing the fungus LYY-02 as described in claim 1.
3. The LYY-02 seed liquid according to claim 2, characterized in that, The fungus LYY-02 was inoculated into 50 mL of CMC-Na medium and cultured on a shaker at 28℃~32℃ and 140 r / min~160 r / min for 46 h~50 h. Then, it was transferred to 50 mL of CMC-Na medium at a volume ratio of 0.5%~1.5% and cultured for another 46 h~50 h to obtain the LYY-02 seed culture.
4. The application of the fungus LYY-02 as described in claim 1 or the LYY-02 seed liquid as described in claims 2-3 in the degradation of straw.
5. The application according to claim 4, characterized in that, The degradation of straw is achieved by mixing LYY-02 seed liquid with straw and then culturing it. 1 L of culture system contains 10 mL to 30 mL of LYY-02 seed liquid and 16 g to 24 g of straw.
6. The application according to claim 5, characterized in that, The 1 L culture system also contains 0.8 g to 1.2 g of potassium dihydrogen phosphate, 0.08 g to 0.12 g of magnesium sulfate heptahydrate, 0.08 g to 0.12 g of ferrous sulfate heptahydrate, 0.008 g to 0.012 g of manganese sulfate, and 1.8 g to 2.2 g of peptone.
7. The application according to claim 5, characterized in that, The culture temperature is 28℃~32℃.
8. The application according to claim 5, characterized in that, The culture time is 7 to 25 days.
9. The application according to claim 5, characterized in that, The straw in question is corn stalks.