Application of bacillus velezensis jnjk-1 and method for promoting growth of crops in saline-alkali soil
By applying Bacillus belye JNJK-1 in saline-alkali land, the limitations of crop growth in saline-alkali environments have been overcome, resulting in improved crop growth performance and disease control, providing a highly efficient biological control and growth promotion method.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- JINING ACAD OF AGRI SCI
- Filing Date
- 2026-03-19
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies are insufficient to effectively utilize microorganisms to promote crop growth in saline-alkali environments, especially limiting crop growth in saline-alkali soils, and lacking effective disease prevention and growth promotion methods.
The application of Bacillus berreatus JNJK-1 in saline-alkali land leverages its salt tolerance, growth-promoting, and disease-preventing properties. By utilizing its colonization of crop roots, it alleviates salt damage and inhibits pathogens. The fermentation liquid is then sprayed to improve crop growth performance.
It can significantly improve crop growth performance in saline-alkali environments, reduce the use of chemical drugs, enhance crop disease resistance, and achieve the crop growth effect of biological improvement of saline-alkali soil.
Smart Images

Figure CN122104471A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural microbial technology, and in particular to the application of Bacillus belye JNJK-1 and its method for promoting the growth of crops in saline-alkali land. Background Technology
[0002] Bacillus belye, first reported and named in 2005, is a novel species of Bacillus that produces a variety of secondary metabolites. It exhibits broad-spectrum antibacterial activity and growth-promoting effects, making it a promising new biocontrol resource. In phytochemistry, it can be used as a symbiotic bacterium in the rhizosphere and leaves, secreting intracellular acid (IAA) to promote plant growth, inhibit pathogen infection, reduce the use of chemical pesticides, and is residue-free, non-pathogenic, environmentally friendly, while also improving plant growth performance and disease resistance.
[0003] Based on the prior application CN119432654A, which discloses the application of Bacillus belye JNJK-1 in the prevention and control of diseases in edible fungi, the applicant further discovered that Bacillus belye JNJK-1 can stably colonize in saline-alkali environments and simultaneously exert growth-promoting and disease-preventing functions. Summary of the Invention
[0004] In view of this, the purpose of this invention is to propose an application of Bacillus belyssus JNJK-1 and a method for promoting the growth of crops in saline-alkali land. The strain has strong salt tolerance and can survive effectively in saline-alkali soil environments. It colonizes crop roots, alleviates crop salt damage, and has significant growth-promoting and disease-preventing effects on crops in saline-alkali environments. It can be widely used in biological methods to improve the growth of crops in saline-alkali land.
[0005] Based on the above objectives, the present invention provides an application of Bacillus belye JNJK-1 in promoting crop growth and / or biological control in saline-alkali land.
[0006] Preferably, the crop includes one or more of the following: grasses, legumes, and solanaceae.
[0007] Preferably, the gramineous crops include one or more of rice, wheat, barley, oats, corn, and sorghum; the legumes include one or more of soybeans, peanuts, peas, and mung beans; and the solanaceous crops include one or more of peppers, tomatoes, eggplants, and potatoes.
[0008] Preferably, the biological control includes the control of plant diseases caused by Fusarium solani, Fusarium oxysporum, or Rhizoctonia solani.
[0009] Preferably, the Bacillus velezensis JNJK-1 was deposited on June 25, 2024, at the China General Microbiological Culture Collection Center (address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with accession number CMCCNo31075.
[0010] This invention also provides a method for promoting crop growth in saline-alkali land, wherein the fermentation broth of the *Bacillus belye* JNJK-1 is diluted to a viable cell concentration of 10. 6 -10 12 CFU / mL bacterial solution was sprayed onto crops in saline-alkali soil.
[0011] The beneficial effects of this invention are: (1) The *Bacillus belyssii* JNJK-1 strain of this invention exhibits strong salt and alkali tolerance: the strain of this invention can grow in a saline-alkali plate environment with 12% NaCl and pH=9, which is significantly higher than the salt tolerance level of existing *Bacillus* strains, and can survive and colonize in extreme saline-alkali environments. The reason for this may be that the *Bacillus belyssii* JNJK-1 strain of this application carries its own NaCl. + / H + Antitransport proteins and other stress-resistance genes maintain intracellular ion homeostasis, utilizing H+ through these antitransport transmembrane proteins. + Electrochemical gradient drives Na + External discharge, while H + Pumping into the cell; Bacillus belesii JNJK-1 may employ a strategy of "synergistic operation of endogenous synthesis and exogenous uptake". Under salt stress, it can simultaneously upregulate the genes for the synthesis of compatible solutes and the genes for transport proteins. Through a dual-track mechanism, it can ensure that the strain can efficiently synthesize compatible solutes and take up readily available solutes from the environment, minimizing energy consumption. Finally, under salt-alkali stress, Bacillus belesii JNJK-1 can maintain membrane fluidity by adjusting membrane lipid composition and reduce the contact area between the cell and the high-salt environment by regulating cell morphology.
[0012] (2) The Bacillus berleis of the present invention has both broad-spectrum disease resistance and growth promotion capabilities, and can be used for multiple purposes, reducing agricultural production inputs. Both pot and field trials have confirmed that this strain can effectively alleviate the damage of salt and alkali stress to rice and significantly increase yield, and has practical application value. Attached Figure Description
[0013] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only for this invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0014] Figure 1 This is a colony morphology diagram of Bacillus belyssus JNJK-1 in an embodiment of the present invention; Figure 2 This is a comparison diagram of the antibacterial effects of Bacillus vesiculosus JNJK-1 against Fusarium solani in an embodiment of the present invention; Figure 3 This is a comparison chart of the antibacterial effects of Bacillus vesiculosus JNJK-1 against Fusarium oxysporum in an embodiment of the present invention; Figure 4 This is a comparison chart of the antibacterial effects of Bacillus vesiculosus JNJK-1 against Rhizoctonia solani in an embodiment of the present invention; Figure 5 This is a comparison chart of rice plant height under different conditions according to an embodiment of the present invention; Detailed Implementation
[0015] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments.
[0016] Example 1: Isolation and Screening of Strains (1) Sample source: collected from the rhizosphere soil of chili pepper plants in Jining City, Shandong Province; (2) Isolation of salt-tolerant strains: Take 10g of rhizosphere soil sample and place it in a sterilized 250mL Erlenmeyer flask containing 100mL of sterile water. Place the flask on a shaker and incubate for 30min (30℃, 160r / min). Then, take 1ml of the supernatant and place it in a sterilized test tube. Add 9mL of sterile water to dilute the supernatant. Dip an inoculation loop into the above diluted solution and streak it onto NA solid culture medium plates with salt concentrations of 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, and 13%, respectively. Place the plates in a 28°C biochemical incubator and incubate for 48 hours. Colonies with the same morphology under different salt concentrations were selected as initial salt-tolerant growth-promoting colonies and streaked on NA medium with a salt concentration of 10%. They were purified and cultured at 28°C for 48 hours. Single colonies were selected and inoculated into 10% NA liquid medium for enrichment culture to obtain multiple candidate strains. (3) Determination of salt tolerance of strains: By changing the salt and alkalinity of the culture medium, strains with strong salt tolerance were screened out: Candidate bacteria were inoculated on NA plates with different NaCl concentrations of 3%, 6%, 9%, and 12% and pH=9, and cultured at 37℃ for 48h. The growth was observed, and whether the strain grew was used as the evaluation of the salt tolerance of the strain.
[0017] Table 1 Salt tolerance of each strain Note: "+" indicates that the strain has grown, and "-" indicates that the strain has not grown.
[0018] The results are shown in Table 1. Strain JNJK1 could grow at all tested concentrations, exhibiting the strongest salt tolerance. In particular, strain JNJK1 could grow in a saline-alkali plate environment with 12% NaCl and pH=9, significantly exceeding the salt tolerance level of existing Bacillus strains. This indicates that the strain in this application can survive and colonize in extreme saline-alkali environments. The reason for this may be that the *Bacillus belyssus* JNJK-1 in this application carries its own NaCl. + / H + Antitransport proteins and other stress-resistance genes maintain intracellular ion homeostasis. These antitransport transmembrane proteins utilize the H+ electrochemical gradient to drive Na+ transport. + External discharge, while H + Pumping into the cell; Bacillus belesii JNJK-1 may employ a strategy of "synergistic operation of endogenous synthesis and exogenous uptake". Under salt stress, it can simultaneously upregulate the genes for the synthesis of compatible solutes and the genes for transport proteins. Through a dual-track mechanism, it can ensure that the strain can efficiently synthesize compatible solutes and take up readily available solutes from the environment, minimizing energy consumption. Finally, under salt-alkali stress, Bacillus belesii JNJK-1 can maintain membrane fluidity by adjusting membrane lipid composition and reduce the contact area between the cell and the high-salt environment by regulating cell morphology.
[0019] Example 2: Identification of strain JNJK-1 (1) Observation of strain morphology and identification of physiological and biochemical characteristics: The selected strain JNJK-1 was streaked on NA medium plates and incubated at 28°C for 48 hours. Its morphological characteristics were then observed. Figure 1 As shown, the colonies are milky white, round, with a dry and wrinkled surface and irregular edges. The relevant physiological and biochemical indicators of the strain were identified with reference to the "Manual of Systematic Identification of Common Bacteria". It was determined that the physiological and biochemical characteristics of bacteria JNJK-1 are basically consistent with the corresponding characteristics of Bacillus belyssus. (2) Molecular biological identification: Using a single colony as a template, the 16S rRNA gene sequence was amplified using universal primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGGCTACCTTGTTA). CGACTT) was used for sequence amplification; PCR amplification system: 25 μL 2×T3 PCR Mix, 1 μL each of forward and reverse primers (10 μmol / L), ddH2O To make up to 50 μL; PCR reaction conditions: 98 ℃ pre-denaturation for 5 min; 98 ℃ denaturation for 1 min, 55 ℃ annealing for 1 min, 72 ℃ extension for 1.5 min, for a total of 35 cycles; 72 ℃ final extension for 5 min. After electrophoresis, the PCR products were sent to BGI Genomics Co., Ltd. for sequencing. 16S rRNA molecular identification: The genome of strain JNJK-1 was extracted using a kit. Using this genome as a template, its 16S rRNA was amplified using specific primers 27F and 1492R. The specific primer sequences are shown in SEQ ID NO. 1-2. SEQIDNO.1(27F):5'AGAGTTTGATCATGGCTCAG3' SEQIDNO.2(1492R):5'TAGGGTTACCTTACGACTT3' The 16S rDNA sequence of the bacterium JNJK-1 after PCR amplification is shown in SEQ ID NO. 3: The sequence is identical to that of Bacillus velezensis JNJK-1 disclosed in the prior application CN119432654A, and it was ultimately determined to be the same Bacillus velezensis strain. This Bacillus velezensis JNJK-1 was deposited on June 25, 2024, at the China General Microbiological Culture Collection Center (Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with accession number CMCCNo31075.
[0020] Example 3: Antibacterial activity of Bacillus belyssus JNJK-1 The plate confrontation method was used to verify the activity of the strain in inhibiting plant pathogenic fungi: Mycelial cakes were collected from a pathogen-containing PDA plate using a 5mm diameter punch and transferred to the center of a new PDA plate. Simultaneously, 5 μL of viable bacteria at a concentration of 10⁻⁶ was evenly inoculated at a distance of 2.5 cm from both sides of the mycelial cake. 6 CFU / mL of Bacillus belye bacterial suspension was inverted in an incubator at 28°C. The antibacterial effect was observed after 72 hours. The width of the inhibition zone was observed and recorded daily. Three replicate tests were performed for each pathogen, and the average value was taken.
[0021] Table 2. Antibacterial activity of Bacillus belyssus JNJK-1 against different pathogens. As shown in Table 2, the Bacillus berreatus JNJK-1 provided by the present invention has a good inhibitory effect on diseases that can cause solanaceous rot, pepper root rot caused by Fusarium oxysporum, and rice sheath blight caused by Rhizoctonia solani. Among them, the inhibitory effect on Fusarium oxysporum is the best.
[0022] Example 4: Test on the growth-promoting effect of Bacillus belye JNJK-1 on rice in saline-alkali environment (1) Preparation of Bacillus belyss JNJK-1 bacterial culture: First, Bacillus belye JNJK-1 was activated on PDA plates, and single spots were picked and placed in nutrient broth liquid medium. The culture was enriched and shaken at 30℃ and 160 rpm for 24 h. After centrifugation, the culture was diluted with sterile water to a viable count of 10⁻⁶. 9 CFU / mL bacterial suspension; (2) Potted rice seedlings under different conditions: Using Rudao No. 2 as the test rice, three pot experiments were conducted. Two groups of pots were filled with Dongying saline-alkali soil (pH=8.0, NaCl content 5‰), and the last group was filled with Jining ordinary soil (pH=7.5, NaCl content <1‰). These were designated as the saline-alkali soil-water control group (CK), the saline-alkali soil-Bacillus vesiculosus JNJK-1 fermentation broth group (T1), and the ordinary soil-Bacillus vesiculosus JNJK-1 fermentation broth group (T2). Each experimental group consisted of 30 rice seedlings. After emergence, each seedling was irrigated with 10 mL of the corresponding treatment solution and placed in an artificial climate chamber at 28℃, 70% relative humidity or higher, and a photoperiod of 16 / 8h. The growth of the rice seedlings was observed. After 25 days of growth, the seedling quality was evaluated. The experimental results are shown in Table 3. Figure 5 As shown: Table 3. Growth-promoting effects of Bacillus belyssus JNJK-1 on rice seedlings. From Table 3 and Figure 5 The experimental results showed that, compared with the water control group, the treatment group T1 treated with Bacillus venetum JNJK-1 fermentation broth was significantly better than the control group. Specifically, the seedling height of T1 rice was 13.04% higher than that of the CK group, the root length increased by 61.54%, and the fresh weight increased by 69.23%. Furthermore, the T1 experimental group was close to the normal soil growth group T2, thus demonstrating that the Bacillus venetum JNJK-1 provided in this invention effectively alleviates the harm of saline-alkali soil to rice crops and has a strong growth-promoting effect.
[0023] Example 5: Application effect of Bacillus belye JNJK-1 in rice cultivation in saline-alkali land (1) Experimental location: Saline-alkali land agricultural experimental base in Dongying City, Shandong Province (2) Rice field experiment: Each plot was 1 square meter, and a blank control group and three bacterial solutions with a concentration of 10 were set up. 6 CFU / mL, 10 9 CFU / mL, 10 12 The study included four treatments (CFU / mL), with each treatment replicated three times, for a total of 12 plots. These included a blank control group (irrigated with water but without bacterial culture), and treatment group 1 (with a viable bacterial concentration of 10 CFU / mL). 6 CFU / mL; Treatment group 2: viable bacteria concentration was 10 CFU / mL; 9 CFU / mL; Treatment group 3: viable bacteria concentration was 10 CFU / mL; 12 CFU / mL; applied at 50 mL / mL after transplanting, during the heading stage, and at the flowering stage. 2 Each of the following amounts should be sprayed once.
[0024] Table 4 is a comparison table of yield factors for mature rice plants: Table 4 As shown in Table 4, the experimental data indicates that applying a live bacteria concentration of 10... 9 Treatment with *Bacillus belye* at CFU / ml significantly increased the number of effective panicles, grains per panicle, and thousand-grain weight in rice, demonstrating a high growth-promoting effect and a yield increase rate of up to 16.74%, with this concentration showing the best results. However, high concentrations of the bacterial solution may lead to rhizosphere microecological imbalance or generate excessively high osmotic pressure, causing temporary stress to seedlings; therefore, higher concentrations are not necessarily better. 9 The optimal application concentration is CFU / mL.
[0025] Those skilled in the art should understand that the discussion of any of the above embodiments is merely exemplary and is not intended to imply that the scope of the invention (including the claims) is limited to these examples; within the framework of the invention, the technical features of the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other variations of the different aspects of the invention as described above, which are not provided in the details for the sake of brevity.
[0026] This invention is intended to cover all such substitutions, modifications, and variations that fall within the broad scope of the appended claims. Therefore, any omissions, modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this invention should be included within the scope of protection of this invention.
Claims
1. Application of Bacillus belye JNJK-1 in promoting crop growth and / or biological control in saline-alkali land.
2. The application according to claim 1, characterized in that, The crops include one or more of the following: grasses, legumes, and solanaceae.
3. The application according to claim 2, characterized in that, The gramineous crops include one or more of rice, wheat, barley, oats, corn, and sorghum; the legumes include one or more of soybeans, peanuts, peas, and mung beans; and the solanaceous crops include one or more of peppers, tomatoes, eggplants, and potatoes.
4. The application according to claim 1, characterized in that, The biological control measures include the control of plant diseases caused by Fusarium solani, Fusarium oxysporum, or Rhizoctonia solani.
5. The application according to claim 1, characterized in that, The Bacillus belyes JNJK-1 is deposited at the China General Microbiological Culture Collection Center, with accession number CMCCNo31075.
6. A method for promoting crop growth in saline-alkali land, characterized in that, The fermentation broth of Bacillus belye JNJK-1 as described in claim 1 was diluted to a viable cell concentration of 10. 6 -10 12 CFU / mL bacterial solution was sprayed onto crops in saline-alkali soil.