Use of pparg in the preparation of products for modulating cell proliferation and testosterone synthesis

By constructing an overexpression plasmid of the PPARG gene and a small RNA interference fragment to regulate goat testicular interstitial cells, the shortcomings of existing technologies in regulating testosterone synthesis and proliferation were overcome, achieving effective regulation of goat testicular interstitial cell function and improving testosterone synthesis capacity.

CN122104557APending Publication Date: 2026-05-29GUIZHOU UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GUIZHOU UNIV
Filing Date
2026-03-06
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Current technology lacks a systematic understanding of the regulation and proliferation of testosterone synthesis in goat testicular interstitial cells, and the role of PPARG in this field is unclear, affecting testosterone levels and reproductive capacity.

Method used

By constructing the PPARG gene overexpression plasmid pcDNA3.1(+)-PPARG and the small RNA interference fragment si-PPARG, the proliferation and testosterone synthesis of goat testicular interstitial cells were regulated, respectively promoting or inhibiting the expression of the PPARG gene. Cell transfection was performed using Lipofectamine™ 3000 transfection reagent.

Benefits of technology

It significantly promotes or inhibits the proliferation of goat testicular interstitial cells and testosterone synthesis, providing technical support for regulating the function of goat testicular interstitial cells and increasing the expression of testosterone synthesis-related genes and testosterone levels.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FA1WQGYEHVCOAX59XZRSGV6UQMYOPYTQX6KAQONZ
    Figure FA1WQGYEHVCOAX59XZRSGV6UQMYOPYTQX6KAQONZ
  • Figure JUND7OYKGBXKWOTL9QVCWL3FVIXX9LPOQSH0FCQT
    Figure JUND7OYKGBXKWOTL9QVCWL3FVIXX9LPOQSH0FCQT
  • Figure YPIGXTWEOIT410EIBSTZYCT7C8WQZFIHT1VPYNUE
    Figure YPIGXTWEOIT410EIBSTZYCT7C8WQZFIHT1VPYNUE
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering, and particularly relates to application of PPARG in preparation of products for regulating cell proliferation and testosterone synthesis.The present application constructs a super-expression plasmid pcDNA3.1(+)‑PPARG of PPARG gene, simultaneously synthesizes an interference sequence si‑PPARG, and for the first time proposes that overexpression of the PPARG gene can significantly promote proliferation of goat testicular interstitial cells and testosterone synthesis, and inhibition of the PPARG gene can significantly inhibit proliferation of goat testicular interstitial cells and testosterone synthesis.The present application has important significance for improving development of goat testis, and provides technical support for research and development of products for regulating goat testicular interstitial cell proliferation and testosterone synthesis by taking the PPARG gene as a target.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to the application of PPARG in the preparation of products that regulate cell proliferation and testosterone synthesis. Background Technology

[0002] Leydig cells (LCs) are important endocrine cells in the testes of male animals, primarily responsible for the synthesis and secretion of testosterone. Testosterone is not only a key regulator of spermatogenesis but also directly affects libido, the development of secondary sexual characteristics, and the function of reproductive organs. In male animal reproduction, the normal function of LCs is crucial for semen quality, sexual behavior, and overall fertility. Impaired function (e.g., due to inflammation, oxidative stress, or hormonal imbalances) can lead to decreased testosterone levels, impaired spermatogenesis, and reduced reproductive capacity. Currently, a systematic understanding of the role of LCs in the regulation of testosterone synthesis and cell proliferation is lacking, and the mechanism of the causal relationship between PPARG and reproductive dysfunction requires further elucidation.

[0003] Studies have shown that PPARG plays a regulatory role in cell proliferation and hormone synthesis. In regulating steroid hormone synthesis, PPARG, after activation by thiazolidinediones, upregulates StAR expression and promotes the conversion of cholesterol to pregnenolone through synergistic action with transcription factor SF1. In adipose tissue, PPARG reduces the conversion of androgens to estrogens by inhibiting CYP19A1; PPARG activation inhibits DIO2, reducing the conversion of T4 to T3 and affecting energy metabolism. In regulating cell proliferation, PPARG activation upregulates p21, arresting the cell cycle in the G1 phase; PPARG reduces cancer cell growth by inhibiting the AKT / mTOR pathway (PTEN-dependent); and exerts an anti-proliferative effect by inhibiting the β-catenin / TCF signaling pathway. These studies indicate that PPARG can influence organismal development by regulating cell proliferation and cell function. Despite these important biological functions as a target, the role of PPARG in goat testicular interstitial cells remains unclear.

[0004] Based on this, the present invention provides the application of PPARG gene as a target in regulating the proliferation of goat testicular interstitial cells and testosterone synthesis, aiming to overcome the shortcomings of the existing technology and provide technical support for the research and development of products related to regulating the proliferation of goat testicular interstitial cells and testosterone synthesis by targeting PPARG gene. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the PPARG gene as a target in the preparation of products that regulate the proliferation of goat testicular interstitial cells and testosterone synthesis.

[0006] Another objective of this invention is to provide the application of PPARG gene as a target in the preparation of products that regulate the expression of marker genes ccNB1 and ccNE2 related to the proliferation of goat testicular interstitial cells, and products that regulate the expression of marker genes 3β-HSD and StAR related to the synthesis of testosterone in goat testicular interstitial cells.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The application of the PPARG gene as a target in the preparation of products that regulate the proliferation of goat testicular interstitial cells and testosterone synthesis.

[0008] Preferably, in the application of the PPARG gene as a target in the preparation of products that regulate the proliferation of goat testicular interstitial cells and testosterone synthesis, the products that regulate the proliferation of goat testicular interstitial cells and testosterone synthesis target the PPARG gene, and promote the proliferation of goat testicular interstitial cells and testosterone synthesis by upregulating the expression of the PPARG gene through a PPARG overexpression plasmid.

[0009] In a further preferred embodiment, in the application of the PPARG gene as a target in the preparation of products regulating the proliferation of goat testicular interstitial cells and testosterone synthesis, the PPARG overexpression plasmid is pcDNA3.1(+)-PPARG, and its construction method is as follows: S1. Extract cDNA from testicular interstitial cells, and use the cDNA as a template for PCR amplification of the PPARG gene to obtain the target fragment of the PPARG gene. S2. The obtained target gene fragment is ligated into the pcDNA3.1 vector digested with restriction endonucleases XbaI and kpn1 to obtain the pcDNA3.1(+)-PPARG recombinant plasmid.

[0010] In a further preferred embodiment, in the application of the PPARG gene as a target in the preparation of products that regulate the proliferation of goat testicular interstitial cells and testosterone synthesis, the primer sequences for PCR amplification in step S1 of the method for constructing the PPARG overexpression plasmid pcDNA3.1(+)-PPARG are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0011] Furthermore, in the application of the PPARG gene as a target in the preparation of products regulating the proliferation of goat testicular interstitial cells and testosterone synthesis, the specific amplification system and amplification program for the PCR amplification in step S1 of the method for constructing the PPARG overexpression plasmid pcDNA3.1(+)-PPARG are as follows: Amplification system: 0.5 μL of upstream and downstream primers at a concentration of 50 pmol / μL; 0.5 μL of polymerase pv2; 10 μL of 5×PV2 buffer; 1 μL of 10 mM dNTP; 38 μL of ddH2O; total volume 50 μL. Amplification program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 25 s, 60℃ annealing for 20 s, 72℃ extension for 40 s, 25 cycles; 72℃ hold for 60 s.

[0012] Preferably, in the application of the PPARG gene as a target in the preparation of products that regulate the proliferation of goat testicular interstitial cells and testosterone synthesis, the product for regulating the proliferation of goat testicular interstitial cells targets the PPARG gene and inhibits the proliferation of goat testicular interstitial cells and testosterone synthesis by downregulating the expression of the PPARG gene through a small RNA interference fragment.

[0013] In a further preferred embodiment, in the application of the PPARG gene as a target in the preparation of products that regulate the proliferation of goat testicular interstitial cells and testosterone synthesis, the small RNA interference fragment is si-PPARG, the sequence of which is shown in SEQ ID NO. 3.

[0014] The present invention relates to the application of the PPARG gene as a target in the preparation of products that regulate the expression of marker genes ccNB1 and ccNE2 related to the proliferation of goat testicular interstitial cells.

[0015] The present invention relates to the application of the PPARG gene as a target in the preparation of products containing the expression of 3β-HSD and StAR, marker genes that regulate testosterone synthesis in goat testicular interstitial cells.

[0016] The beneficial effects of this invention are: This invention constructed the PPARG gene overexpression plasmid pcDNA3.1(+)-PPARG (OE-PPARG) and synthesized its small RNA interference fragment si-PPARG. It is the first to propose that overexpression of the PPARG gene significantly promotes the proliferation of goat testicular interstitial cells and testosterone synthesis, while inhibiting PPARG gene expression significantly inhibits the proliferation of goat testicular interstitial cells and testosterone synthesis. This invention is of great significance for improving goat testicular development and provides technical support for the research and development of products targeting the PPARG gene to regulate the proliferation of goat testicular interstitial cells and testosterone synthesis. Attached Figure Description

[0017] Figure 1The effect of PPARG as a target on the expression of proliferation-related genes ccNB1 and ccNE1, and testosterone synthesis-related genes 3β-HSD and StAR in goat testicular interstitial cells (Figure: A shows the expression results of proliferation-related genes ccNB1 and ccNE2, and testosterone synthesis-related genes 3β-HSD and StAR in goat testicular interstitial cells after PPARG overexpression by RT-qPCR; B shows the expression results of StAR and ccNE2 proteins after PPARG overexpression; C shows the expression results of proliferation-related genes ccNB1 and ccNE2, and testosterone synthesis-related genes 3β-HSD and StAR in goat testicular interstitial cells after si-PPARG overexpression by RT-qPCR; D shows the expression results of StAR and ccNE2 proteins after si-PPARG overexpression). Figure 2 The effect of PPARG as a target on the proliferation of goat testicular interstitial cells (Figure: A is the CCK8 result after PPARG overexpression; B is the CCK8 result after si-PPARG). Figure 3 The effect of PPARG as a target on testosterone levels in goat testicular interstitial cells (Figure: A shows the testosterone level detection results in testicular interstitial cells after PPARG overexpression; B shows the testosterone level detection results in testicular interstitial cells after si-PPARG). Detailed Implementation

[0018] The technical solution of the present invention will be described in detail below with reference to specific embodiments. The following embodiments are for explanation and illustration only, and do not constitute a limitation on the technical solution of the present invention.

[0019] Example 1 A specific promoter of PPARG gene expression that targets the PPARG gene to promote the proliferation of goat testicular interstitial cells is proposed. This promoter is a pcDNA3.1(+)-PPARG recombinant plasmid, and its construction method is as follows: (1) Extract cDNA from testicular interstitial cells and use the cDNA as a template to perform PCR amplification of the PPARG gene to obtain the target fragment of the PPARG gene.

[0020] The PCR amplification primer sequences are as follows: Forward: CGACTCACTATAGGGAGACCCAAGCTGGCTAGCGCCACCATGGTTGACACAGAGATGCCG; Reverse: TCCTCGCCCTTGCTCACCATGGTGGCGACCGGTGGATACAAGTCCTTGTAGATTTCCTGTAGA.

[0021] The PCR amplification system and amplification procedure are as follows: Amplification system: 0.5 μL of upstream and downstream primers at a concentration of 50 pmol / μL; 0.5 μL of polymerase pv2; 10 μL of 5×PV2 buffer; 1 μL of 10 mM dNTP; 38 μL of ddH2O; total volume 50 μL.

[0022] Amplification program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 25 s, 60℃ annealing for 20 s, 72℃ extension for 40 s, 25 cycles; 72℃ hold for 60 s.

[0023] (2) The obtained target gene fragment was ligated into the pcDNA3.1 vector digested with restriction endonucleases XbaI and kpn1 to obtain the pcDNA3.1(+)-PPARG recombinant plasmid. The digestion temperature was 37℃ and the digestion time was 60 min. The ligation conditions between the target gene fragment and the digested pcDNA3.1 vector were: 52℃ water bath for 40 min and transformation incubation for 5 min.

[0024] Example 2 Use Lipofectamine TM The 3000 transfection reagent was used to transfect the pcDNA3.1(+)-PPARG recombinant plasmid (2 μg / mL) constructed in Example 1 into goat testicular interstitial cells according to the manufacturer's protocol. This upregulated the gene levels and protein expression of PPARG, ccNB1, ccNE2, StAR and 3β-HSD, promoting the proliferation of goat testicular interstitial cells and testosterone synthesis.

[0025] Example 3 A specific inhibitor of PPARG gene expression that targets the PPARG gene to inhibit the proliferation of goat testicular interstitial cells. This inhibitor is a small RNA interference fragment si-PPARG.

[0026] The sequence of Si-PPARG is: 5'-CGATGGTTGCAGATTATAATT-3'.

[0027] Example 4 Use Lipofectamine TM The 3000 transfection reagent was used to transfect the interfering sequence si-PPARG (final concentration of 100 nM) provided in Example 3 into goat testicular interstitial cells according to the manufacturer's protocol, downregulating the gene levels and protein expression of PPARG, ccNB1, ccNE2, StAR and 3β-HSD, and inhibiting the proliferation of goat testicular interstitial cells and testosterone synthesis.

[0028] To further verify the reliability of the present invention, the inventors conducted a series of experiments, as follows: 1. Materials 1.1 Animals After collecting goat testicles at the slaughterhouse, they were placed in a thermos containing 1 mL of sterile saline solution with penicillin-streptomycin (10000 IU / mL) and transported back to the laboratory within 1 hour. The collected testicles were rinsed three times with preheated saline solution to remove impurities and blood. Fat deposits, epididymis, and seminal vesicles were removed from the surface of the testicles with scissors. The trimmed testicles were then rinsed again with saline solution. The treated testicles were placed in a beaker containing 1 mL of penicillin-streptomycin (10000 IU / mL) saline solution and placed on a 37°C constant temperature platform for later use. Subsequently, the tunica albuginea tissue was dissected and cut into 1 mm pieces. 3 The cells were broken into small fragments. Next, they were digested with trypsin for 8 minutes. Then, complete culture medium containing 10% fetal bovine serum, 1% penicillin and streptomycin, and 89% DMEM / F-12 was added to terminate the digestion process. The digested and separated cell solution was filtered through 250-mesh and 400-mesh sieves to collect the cells. Finally, the collected cells were cultured in a cell culture incubator until 80% adherence was achieved, and the culture medium was changed regularly for subsequent experiments.

[0029] 1.2 Drugs and Reagents The PPARG gene overexpression plasmid pcDNA3.1(+)-PPARG (OE-PPARG) and the interfering sequence si-PPARG were synthesized by Shanghai Jiying Biotechnology Co., Ltd.; the CCK8 assay kit was purchased from Shanghai Beyotime Biotechnology Co., Ltd.; DMEM / F-12 was purchased from Thermofisher, Inc.; the testosterone level assay kit was purchased from Nanjing Jiancheng Bioengineering Institute; and the transfection reagent Lipofectamine was used. TM 3000, purchased from Invitrogen, USA; RNA extraction kit, purchased from Takara, Japan; reverse transcription kit, purchased from Aibimeng Technology Co., Ltd., China.

[0030] 2. Test methods The PPARG gene was overexpressed using the overexpression plasmid pcDNA3.1(+)-PPARG (OE-PPARG), with the empty vector plasmid pcDNA3.1-GFP (OE-NC) used as a negative control. PPARG gene expression was inhibited using the small RNA interference fragment si-PPARG. Lipofectamine was used. TMAccording to the manufacturer's protocol, the 3000 transfection reagent was used to transfect overexpressing PPARG plasmid (2 μg / mL), OE-NC (2 μg / mL), and si-PPARG (final concentration 100 nM) into goat testicular interstitial cells. qRT-PCR and Western blot (WB) experiments were used to detect the effects of the PPARG gene on the mRNA and protein levels of proliferation pathway marker genes and testosterone synthesis marker genes. The effect of the PPARG gene on the proliferation of goat testicular interstitial cells was detected by the CCK8 assay, and the effect of the PPARG gene on testosterone synthesis in goat testicular interstitial cells was observed by ELISA.

[0031] The construction method of the overexpression plasmid pcDNA3.1(+)-PPARG (OE-PPARG) is as follows: (1) cDNA was extracted from testicular interstitial cells, and the PPARG gene was amplified by PCR using the cDNA as a template to obtain the target fragment of the PPARG gene; the primer sequences for the PCR amplification of the PPARG gene are as follows: Forward (SEQ ID NO.1): CGACTCACTATAGGGAGACCCAAGCTGGCTAGCGCCACCATGGTTGACACAGAGATGCCG; Reverse (SEQ ID NO.2): TCCTCGCCCTTGCTCACCATGGTGGCGACCGGTGGATACAAGTCCTTGTAGATTTCCTGTAGA.

[0032] The PCR amplification system consisted of: 0.5 μL of upstream and downstream primers at a concentration of 50 pmol / μL; 0.5 μL of polymerase pv2; 10 μL of 5×PV2 buffer; 1 μL of 10 mM dNTP; and 38 μL of ddH2O, for a total volume of 50 μL. The amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 25 s, 60℃ annealing for 20 s, and 72℃ extension for 40 s, for 25 cycles; followed by a 60 s hold at 72℃.

[0033] (2) The obtained target fragment was ligated into the pcDNA3.1 vector digested with restriction endonucleases XbaI and kpn1 to obtain the pcDNA3.1(+)-PPARG recombinant plasmid.

[0034] Enzyme digestion conditions: 37℃, 60 min; ligation conditions: 52℃ water bath for 40 min, transformation and incubation for 5 min to allow the temperature to decrease.

[0035] The si-PPARG sequence (SEQ ID NO.3) is as follows: 5'-CGATGGTTGCAGATTATAATT-3'.

[0036] 2.1 Cell passage and transfection Select cells in the late logarithmic growth phase with good morphology for passage. Passage can be performed when the cell density reaches 80%-90%. Before passage, discard the old culture medium, wash three times with PBS, and then add an appropriate amount of preheated 0.25% trypsin to the culture dish to cover the cells. Digest at room temperature for 2 min, then immediately add an appropriate amount of DMEM / F-12 medium (containing 10% FBS) to stop digestion. Transfer the cells to a 4 mL sterile centrifuge tube, mix well, and centrifuge at 300×g for 5 min. After centrifugation, discard the supernatant, then resuspend the cells in 2 mL of DMEM / F-12 medium (containing 10% FBS). Take 3.0 × 10⁶ cells. 6 One cell was seeded in a 10 cm culture dish and transferred to a carbon dioxide incubator (5% CO2, 37°C, 100% humidity) for 48 h.

[0037] Goat testicular interstitial cells were seeded at appropriate densities in 10 cm cell culture dishes. When the cell density reached 85%-90%, the cells were passaged. The cells were cultured at 5 × 10⁻⁶ cells / day. 5 1 cell / well and 2×10 6 Goat testicular interstitial cells were seeded into 12-well and 6-well cell culture plates at a density of 1 cell / well, and then cultured in a CO2 incubator (5% CO2, 37°C, 100% humidity) until the cell density reached approximately 60%, at which point transfection was performed. Lipofectamine was used according to the transfection instructions. TM OE-PPARG (final concentration 2 μg / mL) and si-PPARG (final concentration 100 nM) were transfected into goat testicular interstitial cells using 3000 transfection reagent. Cells were harvested 24 h after transfection.

[0038] 2.2 Cell RNA Extraction and Reverse Transcription Cellular RNA extraction: Cellular RNA extraction was performed according to the instructions of Takara's RNAiso Plus reagent. The specific steps were as follows: (1) Cell collection: After transfection for 24 h, the supernatant was aspirated, washed 3 times with PBS, and 800 μL of RNAiso Plus reagent was added to each sample. The cells were scraped into a 1.5 mL EP tube using a scraper and lysed at room temperature for 5 min; (2) Total RNA extraction: 200 μL of chloroform was added and mixed by inverting the tube. The mixture was allowed to stand for 30 s and then centrifuged at 12000×g for 10 min at 4℃; (3) RNA precipitation: The supernatant was carefully aspirated with a pipette and transferred to a 1.5 mL centrifuge tube without RNase. An equal volume of anhydrous ethanol was added, and the mixture was mixed by inverting the tube. The mixture was then transferred to a nucleic acid adsorption column and centrifuged according to the instructions. The column was washed twice with 70% ethanol and then left to air dry; (4) RNA dissolution: The centrifuge column was placed in a 1.5 mL centrifuge tube without RNase. An appropriate amount of RNase-free water was added to dissolve the RNA and the mixture was allowed to stand for 1 min. Centrifuge at 10000×g for 1 min at 4℃, discard the centrifuge column, and use a UV spectrophotometer to detect RNA quality. Qualified RNA will be used directly for reverse transcription or frozen in a -80℃ freezer for later use.

[0039] Cellular mRNA reverse transcription: Cellular mRNA reverse transcription was performed according to the instructions of the All-In-One 5X RT MasterMix kit from Abimont Technology Co., Ltd. After preparing the reaction solution, the incubation times were 37°C for 10 min, 60°C for 5 min, and 95°C for 5 s.

[0040] 2.3 Analytical Methods (1) Detection of cell proliferation level The effects of PPARG and si-PPARG overexpression on the proliferation of goat testicular interstitial cells were detected using the CCK8 cell proliferation assay kit. The specific detection method is as follows: Goat testicular interstitial cells were inoculated at 3.0 × 10⁶ cells / year... 3 Cells were seeded at a density of 100 μL of culture medium per well into 96-well cell culture plates. After 12 h of cell adhesion, the cells were transfected. 24 h later, 10 μL of CCK8 was added to each well. The plates were incubated in the dark at 37°C for 2 h. The optical density (OD450) at 450 nm was measured using a microplate reader and statistical analysis was performed.

[0041] (2) Detection of gene levels for cell proliferation and testosterone synthesis Twenty-four hours after transfection with goat testicular interstitial cells, the mRNA and protein levels of proliferation-related genes ccNB1 and ccNE2, and testosterone synthesis-related genes 3β-HSD and StAR were detected using qRT-PCR and Western blot. The qRT-PCR and Western blot methods are as follows: qRT-PCR uses cDNA as a template and follows the BlasTaq protocol developed by Albemarle Technology Co., Ltd. TM The 2X qPCR MasterMix kit was used according to the instructions. After preparing the reaction solution, the reaction program was as follows: 95℃, 30 s; 95℃, 10 s; 60℃, 30 s; 40 cycles; 95℃, 15 s; 60℃, 60 s; 95℃, 15 s, with β-actin as an internal control. Real-time quantitative PCR results were obtained using... The primer sequences were calculated using the method described in Table 1.

[0042] .

[0043] (3) Testosterone level detection in testicular interstitial cells Testicular interstitial cells were seeded into 6-well cell culture plates, and the cell supernatant was collected 24 h after transfection. Subsequently, testosterone (T) levels in mouse serum were detected using an ELISA kit. Follow the instructions provided in the kit for testing. The specific steps are as follows: 1) Equilibrate the ELISA kit at room temperature for 30 min to prepare the standard; 2) Set up blank wells, standard wells (for creating a standard curve), and sample wells according to experimental needs. Add 50 μL of standard and 50 μL of cell supernatant to the standard and sample wells, respectively; 3) Add 50 μL of biotin-HRP to each well containing the standard and sample, gently vortex to mix, seal with sealing film, and incubate at 37°C for 30 min. After incubation, discard the liquid in the wells and add diluted washing buffer to wash for 30 s / wash, for a total of 5 washes; 4) After washing, pat the plate dry. Add 50 μL of biotin-HRP to each well containing the standard and sample wells, gently vortex to mix, seal with sealing film, and incubate at 37°C for 30 min. After incubation, discard the liquid in the wells and add diluted washing buffer to wash for 30 s / wash, for a total of 5 washes; 5) After washing, pat the plate dry. Add 50 μL of colorimetric solution A to each well, then add 50 μL of colorimetric solution B. Gently shake to mix, then seal with sealing film and incubate at 37℃ for 10 min. 6) After incubation, add stop solution to each well to stop the reaction, and use a microplate reader to detect the absorbance value at 450 nm (OD450). The detection should be completed within 10 min. 7) Plot a standard curve based on the concentration and OD value of the standard, and calculate the testosterone concentration in the cell supernatant based on the standard curve.

[0044] 3. Results All data in this study are expressed as mean ± standard deviation, with at least three independent replicates. Differences between two groups were analyzed using t-tests and ANOVA. All analyses were performed in GraphPad Prism 8. (The text in the figures is incomplete and likely refers to a separate section.) "Represents P" 0.05, "Represents P" 0.01.

[0045] 3.1 Effects of PPARG as a target on the expression of goat testicular interstitial cell proliferation-related genes ccNB1 and ccNE2, and testosterone synthesis-related genes 3β-HSD and StAR. The results are as follows Figure 1 As shown in the results, OE-PPARG significantly promoted the mRNA levels of ccNB1 and ccNE2, 3β-HSD and StAR in LCs. Figure 1A), the Western blot results were consistent with the RT-qPCR results ( Figure 1 B). The si-PPARG group significantly suppressed the mRNA levels of ccNB1 and ccNE2, 3β-HSD, and StAR in LCs (B). Figure 1 C), the Western blot results were consistent with the RT-qPCR results. Figure 1 D).

[0046] 3.2 Effects of PPARG as a target on the proliferation of goat testicular interstitial cells The results are as follows Figure 2 As shown in the results, OE-PPARG significantly promoted the viability of LCs (as indicated). Figure 2 A), while the si-PPARG group significantly inhibited LCs cell viability ( Figure 2 B).

[0047] 3.3 Effects of PPARG as a target on testosterone levels in goat testicular interstitial cells The results are as follows Figure 3 As shown. This study found that OE-PPARG significantly promoted testosterone levels in LCs ( Figure 3 A), while si-PPARG significantly reduced testosterone levels in LCs (A). Figure 3 B). The above results indicate that overexpression of PPARG can promote testosterone synthesis in LCs.

[0048] Although the present invention has been described in detail above with general descriptions, specific embodiments, and experiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. Application of a PPARG gene as a target in the preparation of a product that regulates the proliferation of goat testicular interstitial cells and testosterone synthesis.

2. The application according to claim 1, characterized in that, The product regulating goat testicular interstitial cell proliferation and testosterone synthesis targets the PPARG gene. By using a PPARG overexpression plasmid to upregulate the expression of the PPARG gene, it promotes the proliferation of goat testicular interstitial cells and testosterone synthesis.

3. The application according to claim 2, characterized in that, The PPARG overexpression plasmid is pcDNA3.1(+)-PPARG, and its construction method is as follows: S1. Extract cDNA from testicular interstitial cells, and use the cDNA as a template for PCR amplification of the PPARG gene to obtain the target fragment of the PPARG gene. S2. The obtained target gene fragment is ligated into the pcDNA3.1 vector digested with restriction endonucleases XbaI and kpn1 to obtain the pcDNA3.1(+)-PPARG recombinant plasmid.

4. The application according to claim 3, characterized in that, In the method for constructing the PPARG overexpression plasmid pcDNA3.1(+)-PPARG, the primer sequences for PCR amplification in step S1 are shown in SEQ ID NO.1 and SEQ ID NO.

2.

5. The application according to claim 3, characterized in that, In the method for constructing the PPARG overexpression plasmid pcDNA3.1(+)-PPARG, the amplification system and amplification program for PCR amplification in step S1 are as follows: Amplification system: 0.5 μL of upstream and downstream primers at a concentration of 50 pmol / μL; 0.5 μL of polymerase pv2; 10 μL of 5×PV2 buffer; 1 μL of 10 mM dNTP; 38 μL of ddH2O; total volume 50 μL. Amplification program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 25 s, 60℃ annealing for 20 s, 72℃ extension for 40 s, 25 cycles; 72℃ hold for 60 s.

6. The application according to claim 3, characterized in that, In the method for constructing the PPARG overexpression plasmid pcDNA3.1(+)-PPARG, in step S2: The enzyme digestion temperature was 37℃, and the digestion time was 60 min. The ligation conditions for the target gene fragment and the enzyme-digested pcDNA3.1 vector were: 52℃ water bath for 40 min, followed by transformation and incubation for 5 min.

7. The application according to claim 1, characterized in that, The product regulating goat testicular interstitial cell proliferation and testosterone synthesis targets the PPARG gene and downregulates PPARG gene expression through a small RNA interference fragment, thereby inhibiting goat testicular interstitial cell proliferation and testosterone synthesis.

8. The application according to claim 7, characterized in that, The small RNA interference fragment is si-PPARG, and its sequence is shown in SEQ ID NO.

3.

9. Application of a PPARG gene as a target in the preparation of products that regulate the expression of marker genes ccNB1 and ccNE2 related to the proliferation of goat testicular interstitial cells.

10. Application of a PPARG gene as a target in the preparation of products containing the expression of 3β-HSD and StAR, marker genes regulating testosterone synthesis in goat testicular interstitial cells.