Application of HearNPV-miR-56 in prevention and cure of cotton bollworm
By using HearNPV-miR-56 and its agomir agonist, the problem of slow action of HearNPV in the control of cotton bollworm was solved, resulting in increased virus replication and larval mortality, thus enhancing the control effect.
Patent Information
- Application Number
- CN202610325975.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-17
- Publication Date
- 2026-05-29
AI Technical Summary
The existing HearNPV has a slow effect in controlling cotton bollworm and is difficult to effectively improve insecticidal efficacy.
HearNPV-miR-56 and its agomir agonist, administered by injection or formulation, enhances viral replication in cotton bollworms and promotes the death of infected larvae.
It significantly increased the viral replication of HearNPV in cotton bollworms, promoted the death of infected larvae, and enhanced the control effect on cotton bollworms.
Smart Images

Figure CN122104706A_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of biological pesticides, specifically, this application provides the application of HearNPV-miR-56 in the control of cotton bollworm. Background Technology
[0002] The cotton bollworm is an important omnivorous agricultural pest with a wide host range, high reproductive capacity, facultative diapause, and long-distance migration ability, capable of damaging various crops such as cotton, corn, and wheat. HearNPV, a baculovirus, is an insect pathogen with high specificity and environmental friendliness, widely used in pest control. However, HearNPV has a slow effect, making research on the interaction between HearNPV and the cotton bollworm essential. This research is significant for improving the insecticidal efficacy of HearNPV and holds potential application prospects in cotton bollworm control. Summary of the Invention
[0003] This study discovered HearNPV-miR-56 and its role in HearNPV infection of the cotton bollworm host: First, a miRNA derived from HearNPV, HearNPV-miR-56, was identified by transcriptome sequencing and qRT-PCR. Treatment with agomir agonist increased viral replication in infected cotton bollworm larvae and promoted their death, showing potential applications in the biological control of cotton bollworm.
[0004] On the one hand, this application provides the application of HearNPV-miR-56 in the control of cotton bollworm, wherein the nucleotide sequence of HearNPV-miR-56 is CGGUAACAGAAGCGGUCACG.
[0005] On the other hand, this application provides the application of HearNPV-miR-56's agomir for controlling cotton bollworm, wherein the nucleotide sequence of the positive strand of HearNPV-miR-56's agomir is CGGUAACAGAAGCGGUCACG.
[0006] Furthermore, the agomir positive chain of HearNPV-miR-56 includes one or more of the following modifications: 3' end cholesterol modification; 5' end thiosclerosis modification; 3' end thiosclerosis modification; full-chain methoxy modification.
[0007] Furthermore, the HearNPV-miR-56, or the agomir of the HearNPV-miR-56, is administered via a formulation comprising microcapsules or a formulation comprising nanoparticles.
[0008] Furthermore, the application also includes the application of a preparation containing bollworm nucleopolyhedrovirus.
[0009] On the other hand, this application provides a biological control pesticide for cotton bollworm, which contains HearNPV-miR-56 with the nucleotide sequence CGGUAACAGAAGCGGUCACG.
[0010] On the other hand, this application provides a biological control pesticide for cotton bollworm, which contains the agomir of HearNPV-miR-56, wherein the nucleotide sequence of the positive strand of the agomir of HearNPV-miR-56 is CGGUAACAGAAGCGGUCACG.
[0011] Furthermore, the agomir positive chain of HearNPV-miR-56 includes one or more of the following modifications: 3' end cholesterol modification; 5' end thiosclerosis modification; 3' end thiosclerosis modification; full-chain methoxy modification.
[0012] Furthermore, the bollworm biological control pesticide is a formulation containing microcapsules or a formulation containing nanoparticles.
[0013] Furthermore, the bollworm biological control pesticide contains pesticide-acceptable excipients.
[0014] Furthermore, the bollworm biological control pesticide also includes a preparation containing bollworm nucleopolyhedrovirus.
[0015] The miRNA of this application can be prepared into various formulations acceptable in the pesticide field, including but not limited to nanoparticle-based formulations, such as liposome nanoparticles and polymer nanoparticles; microcapsule-based formulations, such as polyamide or sodium alginate microcapsules; or it can be directly formulated into solutions or suspensions using water, oil or organic solvents after adding various excipients such as RNase inhibitors, stabilizers, and penetration enhancers.
[0016] For reasons of stability and permeability, miRNAs can be modified or analogs can be prepared, including but not limited to cholesterol modification, thiocarbamate modification, and full-chain methoxy modification of the 3' end of miRNA mimics or the agomir used in the examples. Based on the known basic sequence, those skilled in the art can routinely try various modification methods and verify their effects.
[0017] Preparations containing cotton bollworm nucleopolyhedrovirus can be liquid or solid preparations prepared by those skilled in the art using conventional methods, and can be administered sequentially or simultaneously with HearNPV-miR-56, agomir, or mimics.
[0018] This invention provides a miRNA encoding HearNPV (sequence: CGGUAACAGAAGCGGUCACG, SEQ ID NO.1) for the cotton bollworm nucleopolyhedrovirus HearNPV, which can increase viral replication in infected larvae, thereby promoting death. This invention uses agomir to mimic endogenous HearNPV-miR-56, enhancing the insecticidal effect against wild-type and Cry1Ac-resistant cotton bollworms infected with HearNPV. The HearNPV-miR-56 sequence provided by this invention can be used to develop cotton bollworm nucleopolyhedrovirus enhancers, showing potential application prospects in the biological control of cotton bollworm. Attached Figure Description
[0019] Figure 1 This shows the location of VmiRNAs on the viral genome.
[0020] Figure 2 This shows the effect of HearNPV-miR-56 on viral replication in infected larvae; Parts A, B, and C: relative expression levels of viral polygenes at 24, 48, 72, and 96 hours after Agomir injection of HearNPV-miR-56. Data are presented as mean ± standard error of three biological replicates, analyzed by Student's t-test. *0.01 < P < 0.05; **0.001 <P < 0.01;***P < 0.001。
[0021] Figure 3 This diagram shows the effect of HearNPV-miR-56 agomir injection on the mortality rate of infected larvae; and the survival curves of infected larvae after HearNPV-miR-56 agomir injection compared to those injected with agomirNC. Data are presented as mean ± standard error of three biological replicates and analyzed by log-rank test. *0.01 < P < 0.05; ***P < 0.001.
[0022] Figure 4 This shows the effect of HearNPV-miR-56 agomir injection on mortality rates in Cry1Ac-infected larvae; and the daily survival curves of larvae after HearNPV-miR-56 agomir injection compared to NC-agomir injection. Data are presented as mean ± standard error of three biological replicates, analyzed by Log-rank test. *0.01 < P < 0.05. Detailed Implementation
[0023] Example 1: Test Insects
[0024] Cotton bollworms were artificially reared in the Integrated Pest Management Laboratory of China Agricultural University. Rearing conditions included a temperature of (27±1)℃, relative humidity of 75%±10%, and a photoperiod of 14L:10D. Larvae were fed artificial feed, while adults were fed a 10% honey water solution. After hatching, 3-5 newly hatched larvae were placed in a 25 mL feed container with artificial feed. When the larvae reached approximately the fourth instar, they were reared individually to prevent cannibalism. After pupation, the larvae were removed and allowed to emerge as adults. After adult emergence, 15-20 pairs of adults were placed in a plastic box, with a suitable-sized gauze placed on top for egg-laying. They were fed a 10% honey water solution. After egg-laying, the gauze was removed, and the eggs were placed in a resealable bag for hatching.
[0025] Example 2 Identification of HearNPV-encoded miRNAs
[0026] We analyzed the central nervous system transcriptome sequencing data of healthy and infected cotton bollworms at three time points: 48, 72, and 96 hours. Compared to routine miRNA identification, considering the specific characteristics of VmiRNAs, sequences with a base length of 10-30 nt were selected and retained. The remaining sequences were compared against various RNA databases (excluding miRNAs), such as the mRNA database, RFam database, and Repbase database (repetitive sequence database), and then filtered. The obtained sequences were aligned using Bowtie with the *Bollworm* genome (GenBank: GCA_002156985.1) and the *HearNPV* genome (AF271059.2). For the aligned sequences, the number of bases was extended at the corresponding alignment sites on the genome for miRNA analysis and identification. The parameters were set as follows: convex loop base count ≤ 12, stem region base pairs ≥ 14, secondary structure formation reaction free energy ≤ -10, hairpin length ≥ 20, central loop ≤ 350 nt, mature region convex loops occupying no more than 8 bases, mature region asymmetric convex loops containing no more than 6 asymmetric bases, mature region asymmetric convex loops containing no more than 5 asymmetric bases, mature region mismatches no more than 7, mature region complementary pairings exceeding 12 bases, and the number of bases located on the stem of the mature body exceeding 80%. The selected VmiRNAs were then aligned with the *HearNPV* genome to analyze their generation location. Statistical analysis of raw counts was performed using the DESeq2 software, with thresholds: p-adjust < 0.05 and |log2(fold change)| > 1.
[0027] A single miRNA encoding HearNPV (HearNv virus) was identified: HearNPV-miR-56 (sequence: CGGUAACAGAAGCGGUCACG, SEQ ID NO.1). Figure 1).
[0028] Example 3: Effect of HearNPV-miR-56 on Virus Replication Rate in Infected Larvae
[0029] (1) Method of exposing cotton bollworm larvae to the virus: The concentration of the original suspension of cotton bollworm nucleopolyhedrovirus used in the experiment was 5×10⁻⁶. 9 OBs / mL, prepared with double-distilled water to a concentration of 2×10 8 The OBs / mL suspension was used, and dye was added to the suspension to a final concentration of 1%. A single 3rd instar molting larva of uniform growth was placed in a feed container and starved overnight. The next day, larvae that had successfully molted to the first day of the 4th instar were selected. The artificial feed was cut into small pieces of approximately 8 mm × 4 mm × 1 mm. 5 μL of virus suspension was added to each piece of feed. Each larva was fed one piece of feed, i.e., each larva was fed 10 μL of virus. 6 OBs. 24 hours later, 4th instar larvae on the second day after consuming the contaminated feed were selected for subsequent experiments. This time was recorded as 0 h post-infection. Sufficient feed was added to the feed for the larvae to consume.
[0030] (2) Sample collection: 4th instar larvae of uniform size on the second day of treatment were selected 0 h after exposure and injected with 1000 nM HearNPV-miR-56 agomir and antagomimir (synthesized by Shanghai Jima Pharmaceutical Technology Co., Ltd., sequence: CGGUAACAGAAGCGGUCACG, SEQ ID NO.1; agomir was modified with antisense strand, cholesterol at 3' end, two thioskeletal modifications at 5' end, four thioskeletal modifications at 3' end, and full-chain methoxy modification). 2 μL was injected into each larva, and the control was injected with the same amount corresponding to NC. Heads of cotton bollworms were collected at 24, 48, 72, and 96 h after exposure as samples and stored at -80°C for later use. Three biological replicates were used for each sample group.
[0031] (3) Total RNA extraction: Add 400 μL of Trizol reagent (TaKaRa) to the centrifuge tube containing the collected samples, grind three times at 50 Hz for 60 s each time using a tissue homogenizer, incubate on ice for 5 min, and then add 600 μL of Trizol reagent. Add 200 μL of chloroform, vortex to mix, and incubate on ice for 10 min. Centrifuge at 12000 rpm for 15 min at 4°C. After centrifugation, carefully remove the tube and transfer 300 μL of the supernatant to a new RNase-free 1.5 mL centrifuge tube. Add 300 μL of isopropanol, gently invert to mix, and incubate at -20°C for 10 min. Centrifuge at 12000 rpm for 15 min at 4°C, discard the supernatant, and use a pipette to remove as much of the remaining supernatant as possible. Add 800 μL of 75% ethanol solution prepared with DEPC-treated water, invert the container, and centrifuge at 12000 rpm for 8 min at 4°C. Discard the supernatant. Add 200 μL of 75% ethanol solution prepared with DEPC-treated water, invert the container, and centrifuge at 12000 rpm for 8 min at 4°C. Aspirate the supernatant using a 200 μL pipette tip, and then carefully aspirate as much of the remaining supernatant as possible using a 10 μL pipette tip. Centrifuge at 12000 rpm for 1 min at 4°C, aspirate the remaining liquid, and air dry in a clean bench. Dissolve the sample thoroughly in 20 μL of DEPC-treated water, and determine the sample concentration and purity using a NanoDrop 2000 (Thermo Fisher) instrument.
[0032] (4) cDNA synthesis: Total RNA was subjected to gDNA removal and reverse transcription using the PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa). The gDNA removal reaction system consisted of 2.0 μL of 5×gDNA Eraser Buffer, 1.0 μL of gDNA Eraser, 2.0 μL of Total RNA, and 5.0 μL of RNase-Free ddH2O. The reaction was carried out at 42°C for 2 min. The reverse transcription reaction system consisted of 10.0 μL of the previous reaction solution, 1.0 μL of PrimeScript RT Enzyme Mix I, 1.0 μL of RT Primer Mix, 4.0 μL of 5×PrimeScript Buffer 2 (for Real Time), and 4.0 μL of RNase-Free dH2O. The reaction was carried out at 37°C for 15 min, followed by a reaction at 85°C for 5 s.
[0033] (5) Quantitative PCR: qRT-PCR was performed using Taq Pro Universal SYBR qPCR Master Mix (Novizan) and a CFX Connect quantitative PCR instrument (BIO-RAD) according to the manufacturer's instructions. The reaction mixture consisted of 10.0 μL of 2 × Taq Pro Universal SYBR qPCR Master Mix, 0.4 μL of Primer 1 (10 µM), 0.4 μL of Primer 2 (10 µM), 1.0 μL of cDNA, and 8.2 μL of ddH2O. The reaction program was 40 cycles of 95°C for 30 s, 95°C for 10 s, and 60°C for 30 s, using the instrument's default melting curve acquisition program. The relative expression level of the target gene in qRT-PCR was measured using 2... -ΔΔCT The method involved calculations, and the Student's t-test was performed using SPSS software for difference analysis.
[0034] Table 1. qPCR primers
[0035]
[0036] result:
[0037] Using specially modified agomir to mimic endogenous miRNAs, injection of agomir containing HearNPV-miR-56 upregulated the level of HearNPV-miR-56 in cotton bollworms. qPCR was used to detect the expression level of HearNPV-miR-56 after agomir injection. The results showed that compared with agomir NC as a control, agomir injection effectively upregulated the expression level of HearNPV-miR-56. Figure 2 Part A). Simultaneously, the expression level of the viral poly gene was detected 24, 48, 72, and 96 hours after Agomir injection into infected larvae. The results showed that, compared with the control, the expression level of the viral poly gene in HearNPV-miR-56 significantly increased at 24, 48, and 72 hours after Agomir injection. Since the viral poly gene can reflect viral replication, this indicates that HearNPV-miR-56 can significantly upregulate the viral replication of HearNPV in cotton bollworm larvae and promote viral proliferation. Figure 2 Parts B, C, and D).
[0038] Example 5: Effect of 4HearNPV-miR-56 on mortality rate of infected larvae
[0039] At 0 h post-exposure, fourth-instar larvae of uniform size were selected and injected with 1000 nM HearNPV-miR-56 Agomir (Shanghai Jima Pharmaceutical Technology Co., Ltd.). Each larva received 2 μL of Agomir, while the control group received an equal volume of non-nitrogenous (NC). On the same day after injection, the larvae were transferred to 30 cm plastic tubes lined with wire mesh, and sufficient feed was added. The bottom was sealed with breathable sealing film and rubber bands, and the top was sealed with plastic film. Larval mortality was observed and recorded daily from 8:00 AM to 9:00 AM and 8:00 PM to 9:00 PM until all larvae died or pupated. Mortality rates were expressed as survival curves, and differences were analyzed using the Log-rank test.
[0040] result:
[0041] The effect of HearNPV-miR-56 agomir injection on the mortality rate of infected larvae was investigated. The results showed that HearNPV-miR-56 agomir injection significantly promoted the mortality of infected larvae. Figure 3 ).
[0042] The effect of HearNPV-miR-56 agomir injection on the mortality rate of Cry1Ac-resistant larvae was investigated. The results showed that HearNPV-miR-56 agomir injection significantly accelerated the mortality rate of Cry1Ac-resistant larvae. Figure 4 ).
Claims
1. The application of HearNPV-miR-56 in controlling cotton bollworm, characterized in that, The nucleotide sequence of HearNPV-miR-56 is CGGUAACAGAAGCGGUCACG.
2. The application of HearNPV-miR-56's agomir in controlling cotton bollworm, characterized in that the nucleotide sequence of the positive strand of HearNPV-miR-56's agomir is CGGUAACAGAAGCGGUCACG.
3. In the application according to claim 2, the agomir positive chain of HearNPV-miR-56 includes one or more of the following modifications: 3' end cholesterol modification; 5' end thiosclerosis modification; 3' end thiosclerosis modification; full-chain methoxy modification.
4. The application according to any one of claims 1-3, wherein the agomir of HearNPV-miR-56 is administered via a formulation comprising microcapsules or a formulation comprising nanoparticles.
5. The application according to any one of claims 1-4, further comprising the application of a preparation containing bollworm nucleopolyhedrovirus.
6. A biological control pesticide for cotton bollworm, characterized in that, The bollworm biological control pesticide contains HearNPV-miR-56 with the nucleotide sequence CGGUAACAGAAGCGGUCACG.
7. A biological control pesticide for cotton bollworm, characterized in that, The bollworm biological control pesticide contains the nucleotide sequence of the positive strand of the agomir gene HearNPV-miR-56, which is CGGUAACAGAAGCGGUCACG.
8. The bollworm biological control pesticide according to claim 7, wherein the agomir positive chain of HearNPV-miR-56 comprises one or more of the following modifications: 3' end cholesterol modification; 5' end thiosclerosis modification; 3' end thiosclerosis modification; full-chain methoxy modification.
9. The bollworm biological control pesticide according to any one of claims 6-8, wherein the bollworm biological control pesticide is a formulation comprising microcapsules or a formulation comprising nanoparticles.
10. The bollworm biological control pesticide according to any one of claims 6-9, wherein the bollworm biological control pesticide further comprises a preparation containing bollworm nucleopolyhedrovirus.