A breeding method for screening grouper with fast growth trait
By applying SNP site molecular marker screening methods in grouper, the problems of lag and uncertainty in traditional grouper growth and breeding have been solved, enabling precise screening of early growth traits and shortening the breeding cycle, thereby improving breeding efficiency and aquaculture benefits.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- 山东省日照市渔业技术推广站
- Filing Date
- 2026-02-05
- Publication Date
- 2026-05-29
AI Technical Summary
Traditional grouper breeding relies on phenotypic data measurement in the later stages of aquaculture, which is subject to lag, uncertainty and environmental interference, resulting in low breeding efficiency and the inability to effectively screen individuals with poor growth potential in the early stages, affecting the breeding cycle and selection accuracy.
A screening method based on SNP site molecular markers was developed. Using the SNP site molecular marker located at the 103rd position of the nucleic acid fragment (G/A base), the nucleic acid samples of individuals were amplified and genotyped using PCR primers, and individuals with GG homozygous genotype were screened as parent grouper with rapid growth potential.
This technology enables early and precise screening of growth traits in grouper, significantly shortens the breeding cycle, improves breeding efficiency and aquaculture yield, and ensures the speed and intensity of genetic improvement of growth traits.
Smart Images
Figure CN122104931A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of fish genetic breeding technology, specifically relating to a breeding method for screening grouper with rapid growth traits. Background Technology
[0002] Grouper (Epinephelus spp.) is an important marine aquaculture fish in my country and Southeast Asia, possessing high economic value due to its delicious flesh and high nutritional value. In grouper farming, growth rate is the core indicator determining industry efficiency, directly affecting the length of the farming cycle, feed conversion efficiency, and production costs. Therefore, selecting and breeding superior varieties with fast growth rates has always been the primary goal of grouper genetic improvement.
[0003] However, traditional growth selection mainly relies on on-site measurements of phenotypic data such as weight and body length in the later stages of aquaculture. This method has significant lag and uncertainty in production practice: First, the selection cycle is lengthy, requiring individuals to be raised to sub-adult or adult stages before their growth potential can be fully realized and accurately assessed. This process typically takes 12 to 18 months, resulting in low efficiency of single-generation selection. Second, phenotypic performance is highly susceptible to interference from environmental factors such as water temperature, stocking density, feed nutrition, and aquaculture methods. Individuals with the same genetic quality can show growth differences of 30% to 50% under different conditions, severely reducing the accuracy of selection. Third, there is a lack of effective evaluation methods at the seedling stage, making it impossible to conduct predictive screening of early individuals. This results in a large number of individuals with poor growth potential occupying aquaculture resources, limiting the rapid accumulation of genetic progress across years and generations.
[0004] Therefore, there is an urgent need to develop a precision screening technology that can overcome environmental interference, be implemented in the early stages of growth, and is simple to operate and low in cost. This is of great practical significance for achieving early selection of grouper growth traits, shortening the breeding cycle, and improving the overall economic benefits of the aquaculture industry. Summary of the Invention
[0005] The purpose of this invention is to provide a breeding method for screening grouper with rapid growth traits. Specifically, based on the screening and obtaining molecular markers related to the rapid growth trait of grouper, a molecular marker-assisted breeding method for rapid-growth grouper strains is established, thereby laying the foundation for cultivating new grouper varieties with rapid growth potential.
[0006] This invention first provides a SNP site molecular marker linked to the rapid growth trait of grouper, wherein the SNP site molecular marker is located at position 103 of the nucleic acid fragment with sequence SEQ ID NO:1 and its base is G / A;
[0007] AACTAAGGCAAAACATCAGGGTGGGCTTGAAAGCAGCCATCCCATCAAAAAGCGTTAAAGCTCAGACACTTACTATTATAAGCCTCAAGTTTCGACCATTATGTCTTACTCCCCTATATCCTACTGGGCCTTCCCATGCAAACATGGGAGTGATCCTGCTAAAATCAGTATATAAGAAAGCCTAACGGCTTTCTCCCTGCATGCGTG (SEQ ID NO: 1).
[0008] The primer pairs used to detect the above SNP sites have the following sequence information:
[0009] Forward primer: 5′-AAACATCAGGGTGGGCTTGA-3′ (SEQ ID NO:2);
[0010] Reverse primer: 5′-GCAGGGAGAAAGCCGTTAGG-3′ (SEQ ID NO:3);
[0011] In another aspect, the present invention provides an application of the molecular marker in screening grouper individuals with rapid growth potential;
[0012] Another aspect of the present invention is to provide a method for screening parent fish of fast-growing grouper, which involves screening individuals whose SNP loci are homozygous for GG.
[0013] The method involves amplifying the nucleic acid samples of selected individuals using PCR primers, and then typing or sequencing the amplification products.
[0014] The specific sequence information of the primer pairs used is as follows:
[0015] Forward primer: 5′-AAACATCAGGGTGGGCTTGA-3′ (SEQ ID NO:2);
[0016] Reverse primer: 5′-GCAGGGAGAAAGCCGTTAGG-3′ (SEQ ID NO:3).
[0017] In another aspect, the present invention provides a method for breeding grouper, which uses the individuals selected above as parent stock for breeding.
[0018] The present invention screens molecular markers related to the growth traits of grouper and uses them to screen for fast-growing parents, thereby accelerating the genetic improvement of the growth traits of grouper and improving the breeding efficiency and aquaculture yield of fast-growing strains. Attached Figure Description
[0019] Figure 1 : Growth performance of grouper in the fast-growing and slow-growing groups at 150 days old;
[0020] Figure 2 Agarose gel electrophoresis image;
[0021] Figure 3 SNP locus typing map. Detailed Implementation
[0022] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.
[0023] Example 1: Growth Phenotype Screening
[0024] From June 2023 to May 2024, growth performance was measured at a national-level grouper breeding farm. Five hundred healthy, uniformly sized 30-day-old red-spotted grouper fry (Epinephelus akaara) with an initial average weight of 1.5 ± 0.2 g were selected and placed in independent recirculating aquaculture systems for standardized rearing. Rearing conditions: water temperature 25 ± 0.5℃, salinity 30 ± 1 ppt, 24-hour continuous aeration, and daily feeding with equal amounts of commercial feed.
[0025] When the animals reached 150 days of age, all individuals were weighed and their body size was measured. From these, 50 individuals with the largest average weight and best body shape were selected as the "fast-growing group," and 50 individuals with the smallest average weight and slow growth were selected as the "slow-growing group," for a total of 100 individuals (Table 1 and...). Figure 1 Caudal fin tissue samples were collected and fixed in anhydrous ethanol for subsequent DNA extraction and genotyping analysis.
[0026] Table 1: Data on body shape traits at 150 days of age in families of the fast-growing and slow-growing groups
[0027] Group Average body weight (g) Average body length (cm) Average body height (cm) Average body width (cm) Fast Long Group 89.5 ± 4.2 18.3 ± 0.5 6.1 ± 0.3 3.8 ± 0.2 Slow and long groups 55.2 ± 5.1 15.2 ± 0.6 5.2 ± 0.4 2.9 ± 0.3
[0028] Example 2: SNP tagging screening
[0029] Caudal fin tissue samples were taken from 50 individuals each of the "fast-growing group" and "slow-growing group" in Example 1. Genomic DNA was extracted from the grouper using a modified high-salt precipitation method. The specific procedure was as follows: Approximately 20 mg of caudal fin tissue was ground into powder in liquid nitrogen and transferred to a 1.5 mL centrifuge tube. 600 μL of tissue lysis buffer (containing 10 mM Tris-HCl pH 8.0, 25 mM EDTA pH 8.0, 100 mM NaCl, and 0.5% SDS) and 10 μL of proteinase K (20 mg / mL) were added, and the mixture was incubated overnight at 55°C with shaking. After digestion, 200 μL of 5M NaCl solution was added, and the mixture was vigorously shaken for 30 seconds. The mixture was then centrifuged at 12,000 rpm for 15 minutes at 4°C. Collect the supernatant, add an equal volume of pre-cooled isopropanol to precipitate the DNA, wash twice with 70% ethanol, dry at room temperature, and dissolve in 50 μL TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). DNA concentration and purity were determined using Nanodrop 2000 (A260 / A280 = 1.8-1.9) and verified by 1% agarose gel electrophoresis. Figure 2 This meets the requirements for subsequent experiments.
[0030] To address the high GC content and potential inhibitors in the grouper genome, the PCR-RFLP reaction system was optimized. First, specific primers were designed based on candidate regions selected using Scaffold 18, referencing the red-spotted grouper reference genome (ASM324882v1). Primer design was performed using Primer Premier 5.0 software, amplifying fragments up to 190 bp in length. Primer sequences, annealing temperatures, and polymorphism information are shown in Table 2.
[0031] Table 2: Information on some SNP primers for grouper
[0032]
[0033] PCR reactions were performed on an ABI 9700 PCR instrument. The reaction system consisted of 25 μL: 17.75 μL ddH2O, 2.5 μL 10×PCR Buffer, 2.0 μL dNTPs (2.5 mM each), 0.5 μL each of forward and reverse primers, 1.5 μL DNA template (50 ng / μL), and 1.25 U Taq DNA polymerase. The reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, followed by annealing for 30 s (adjusted according to the primer annealing temperatures in Table 2), 72℃ extension for 45 s, for a total of 35 cycles; and a final extension at 72℃ for 10 min. After PCR product detection by 1.5% agarose gel electrophoresis, the samples were sent to Shanghai Meiji Biotechnology Co., Ltd. for Sanger sequencing and genotyping.
[0034] The allele frequency, observed heterozygosity (Ho), expected heterozygosity (He), and polymorphism information content (PIC) of each SNP locus in the fast-growing and slow-growing groups were calculated using POPGENE32 software. Association analysis between SNP loci and growth traits in the two populations was performed using SPSS 22.0 software. The chi-square test was used to compare differences in genotype distribution, with P < 0.01 considered highly significant.
[0035] The results showed that 28 alleles were detected at the 10 SNP loci in the fast-growing group, with an average of 2.8 alleles; and 22 alleles were detected in the slow-growing group, with an average of 2.2 alleles. Polymorphism analysis is shown in Table 3.
[0036] Table 3: Polymorphism information of growth-related SNP sites in grouper
[0037]
[0038] General linear model (GLM) analysis revealed a highly significant association between the SNP locus Sg-07 and growth traits (P<0.01). Specifically, the GG genotype at the Sg-07 locus was significantly more prevalent in the fast-growing group than in the slow-growing group, and individuals with this genotype had a significantly higher average body weight at 150 days of standardized rearing than those with the GA and AA genotypes (P<0.001). The association analysis results between different genotypes and growth traits are shown in Table 4.
[0039] Table 4: Association analysis of different SNP loci Sg-07 genotypes with growth traits at 150 days of age
[0040] Sequencing analysis revealed that the significantly associated SNP site was the core site Sg-07. Its polymorphism is located at position 103 of the following sequence, with a base type of G / A (…). Figure 3 ).
[0041] AACTAAGGCAAAACATCAGGGTGGGCTTGAAAGCAGCCATCCCATCAAAAAGCGTTAAAGCTCAGACACTTACTATTATAAGCCTCAAGTTTCGACCATTATG / ATCTTACTCCCCTATATCCTACTGGGCCTTCCCATGCAAACATGGGAGTGATCCTGCTAAAATCAGTATATAAGAAAGCCTAACGGCTTTCTCCCTGCATGCGTG.
[0042] Therefore, by using upstream primer F: AAACATCAGGGTGGGCTTGA (SEQ ID NO: 2) and downstream primer R: GCAGGGAGAAAGCCGTTAGG (SEQ ID NO: 3), i.e. the primers for Sg-07 in Table 2, grouper individuals with rapid growth potential can be screened; among them, individuals with the GG genotype have the best growth potential.
[0043] Example 3: Application of Molecular Marker-Assisted Breeding
[0044] In July 2024, the Sg-07 marker was used for early screening of grouper fry. From a batch of 30,000 45-day-old commercial grouper fry, 2,000 fish were randomly selected, and DNA was extracted from a small amount of tail fin for Sg-07 genotyping. The results showed that the genotype distribution conformed to Hardy-Weinberg equilibrium.
[0045] Three hundred individuals of type GG and three hundred individuals of type AA were randomly selected and fluorescently labeled. They were then mixed and cultured in two identical standardized recirculating aquaculture tanks for a parallel culture experiment lasting 75 days. The body shape traits at the end of the experiment (120 days of age) are shown in Tables 5 and 6.
[0046] Table 5: Growth of the screening group (GG type) and the normal group (AA type) at different rearing stages
[0047]
[0048] Table 6: Body size and morphological proportions of the two groups of fish at 120 days of age.
[0049] Group Body weight (g) Body length (cm) Body height (cm) Body width (cm) Conditionness (CF, g / cm³) Screening group (GG type) 112.5 ± 9.8 18.9 ± 0.8 6.3 ± 0.3 4.0 ± 0.3 1.67 ± 0.11 Ordinary Group (Type AA) 68.3 ± 10.5 15.6 ± 1.0 5.4 ± 0.4 3.1 ± 0.3 1.80 ± 0.15
[0050] The 50 fastest-growing GG-type individuals were selected from the screening group as core parent candidates for breeding. One year later, a retrospective growth analysis was performed on these candidate parents, and their early growth performance was correlated with that of their offspring (F1). The results are shown in Table 7.
[0051] Table 7: Body type verification table of offspring of core parents screened based on Sg-07 marker in early (90 days)
[0052] Parental genotype Average weight of F1 offspring (g) Average body length of F1 offspring (cm) GG (Screening Group) 48.6 ± 6.3 a 13.1 ± 0.8 a AA (normal control group) 35.2 ± 7.8 b 11.5 ± 1.0 b
[0053] The results showed that the offspring of the GG-type parents screened based on the Sg-07 marker exhibited significant advantages in weight and body length at an early age (90 days old), confirming the stability and effectiveness of this marker in assisting the selection of growth traits.
[0054] This invention enables early screening of rapidly growing grouper individuals based on the SNP molecular marker Sg-07. This method effectively selects individuals with superior overall development in terms of weight, length, and width, significantly shortening the breeding cycle and increasing selection intensity. It has significant application value for breeding high-yielding grouper strains with excellent body shape.
Claims
1. A SNP locus linked to the rapid growth trait of grouper, characterized in that, The SNP site is located at position 103 of the nucleic acid fragment with sequence SEQ ID NO:1, and its base is G / A.
2. The application of the SNP site described in claim 1 as a molecular marker in screening grouper individuals with rapid growth potential.
3. A method for screening parent fish of fast-growing grouper, characterized in that, The method is to detect and screen individuals with a specific genotype at the SNP site as described in claim 1.
4. The method as described in claim 3, characterized in that, The method described involves amplifying the nucleic acid samples of selected individuals using PCR primers, and then determining the genotype by typing or sequencing the amplification products.
5. The method as described in claim 4, characterized in that, The primer pair described herein has the sequences SEQ ID NO:2 and SEQ ID NO:
3.
6. The method as described in claim 3, characterized in that, The genotype mentioned is GG homozygous.
7. A method for raising grouper fry, characterized in that, The method described herein uses individuals selected by the method described in claim 3 as parents for seedling cultivation.