A recombinant type III collagen, its preparation method and application
By using genetically engineered recombinant type III collagen to interfere with tumor signal transduction through DDR binding sites, the risks associated with animal-derived collagen have been addressed, achieving effective inhibition and safe treatment of breast cancer cells.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NORTHWEST UNIV
- Filing Date
- 2026-03-03
- Publication Date
- 2026-06-02
AI Technical Summary
Existing animal-derived type III collagen poses risks of pathogen transmission and immune rejection in biomedical and pharmaceutical applications, limiting its practical use in breast cancer treatment.
A recombinant type III collagen containing multiple DDR binding sites was designed and prepared using genetic engineering technology. By utilizing the high affinity binding of DDR1 and DDR2, it competitively or saturates the ligand binding domain, interfering with pro-tumor signal transduction and inhibiting the proliferation and migration of breast cancer cells.
Recombinant type III collagen significantly inhibits the proliferation and migration of breast cancer cells, exhibits low immunogenicity and high biocompatibility, provides a safe and reliable raw material for breast cancer treatment, and reduces the damage of chemotherapy to normal cells.
Smart Images

Figure CN122127444A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a recombinant type III collagen, its preparation method, and its application. Background Technology
[0002] Currently, traditional treatments for breast cancer include breast-conserving surgery (tumor excision, wide excision, quadrant excision) and mastectomy, as well as axillary surgery including axillary lymph node dissection and sentinel lymph node dissection, to achieve local control of tumor growth and thus improve patient survival rates.
[0003] The biological behavior of breast cancer cells is guided by the tumor microenvironment, which consists of inflammatory cells, cancer-associated fibroblasts, endothelial cells, cytokines, growth factors, and the extracellular matrix (ECM). Collagen is an abundant protein in the ECM of breast tumors. Although type III collagen (COLIII) is less abundant than type I collagen, it has unique advantages in inducing platelet aggregation and preventing scar formation in vitro. Studies have shown that COLIII plays a crucial role in regulating breast cancer development; COLIII not only protects the tissues and organs of breast cancer patients, but its reduction in the tumor microenvironment also drives tumor cell invasion and metastasis.
[0004] Currently, almost all COLIII used in biomedical and pharmaceutical applications as well as tissue-engineered medical products (TEMP) are based on animal-derived collagen, with bovine collagen dominating in both quality and quantity.
[0005] However, these animal-derived type III collagens have inherent limitations, such as the risk of transmitting animal pathogens and triggering immune rejection or allergic reactions, which limit their use in practical applications. Therefore, there is an urgent need to develop a recombinant type III collagen produced using genetic engineering technology to effectively overcome these shortcomings. Summary of the Invention
[0006] The purpose of this invention is to provide a recombinant type III collagen, its preparation method, and its application.
[0007] The technical solution adopted in this invention is: A recombinant type III collagen, the amino acid sequence of which is shown in SEQ ID NO.1.
[0008] A gene encoding the recombinant type III collagen, the nucleotide sequence of which is shown in SEQ ID NO.2.
[0009] An expression vector comprising the nucleotide sequence shown in SEQ ID NO.2 and the nucleotide sequence shown in SEQ ID NO.3.
[0010] A host cell containing the expression vector.
[0011] Preferably, the host cell is any one of Pichia pastoris, Saccharomyces cerevisiae, Escherichia coli, and Bacillus subtilis.
[0012] The method for preparing recombinant type III collagen involves culturing host cells in a culture medium, inducing the expression of recombinant type III collagen, and then purifying the cells to obtain recombinant type III collagen.
[0013] Preferably, the purification method is selected from any one of salting out, ultrafiltration, affinity chromatography, and gel filtration chromatography.
[0014] The use of the recombinant type III collagen in the preparation of medicaments for the prevention and / or treatment of breast diseases.
[0015] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a recombinant type III collagen protein, the amino acid sequence of which is shown in SEQ ID NO.1. Experiments have demonstrated that this recombinant type III collagen protein can significantly inhibit the proliferation and migration of MDA-MB-231 breast cancer model cells, exhibiting clear anti-tumor activity. This provides a solid experimental basis for its application in the preparation of drugs for the prevention or treatment of breast cancer. Furthermore, this recombinant protein is artificially synthesized, eliminating the limitations of traditional animal-derived collagen in terms of pathogen transmission risk and immunogenicity, thus providing a safer and more reliable source of raw materials for practical applications in breast cancer treatment. In addition, current cancer treatments often involve chemotherapy, which, while killing cancer cells, also damages normal cells. Using recombinant collagen as a therapeutic component in breast cancer treatment will significantly reduce adverse reactions in the human body. Attached Figure Description
[0016] Figure 1 This is a diagram showing the expression of recombinant type III collagen in this invention; where M: marker; lanes 1 to 5: transformants 1 to 5.
[0017] Figure 2 This is a statistical result showing the effect of different concentrations of recombinant type III collagen on the proliferation activity of MDA-MB-231 cells.
[0018] Figure 3 Fluorescence microscopy observation of the migration ability of MDA-MB-231 cells by different concentrations of recombinant type III collagen of this invention.
[0019] Figure 4This is a statistical result showing the effect of different concentrations of recombinant type III collagen on the migration ability of MDA-MB-231 cells. Detailed Implementation
[0020] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments and accompanying drawings.
[0021] Unless otherwise specified, all reagents used in this invention are commercially available, and all methods used are conventional techniques in the art.
[0022] The inventive concept of this invention is as follows: DDRs, as unique tyrosine kinase receptors, comprise two members: DDR1 and DDR2. DDR1 interacts with TM4SF1, a member of the 4L family of transmembrane proteins on the cell surface, regulating tumor quiescence and reactivation. This interaction is collagen-dependent and activates the downstream JAK-STAT signaling pathway via protein kinase Cα (PKCα). DDR2 also plays a crucial role in tumor cell quiescence. Mechanical forces generated by the tumor extracellular matrix can promote tumor cell quiescence through the DDR2 signaling pathway. Furthermore, DDRs persistently bind to the GVMGFO sequence of collagen.
[0023] Based on the above mechanism, this invention aims to design and prepare a recombinant type III collagen containing multiple DDR binding sites through genetic engineering. This protein can simultaneously bind with high affinity to both DDR1 and DDR2, competitively or saturatingly occupying their ligand-binding domains, thereby interfering with the tumor-promoting signaling mediated by these domains, ultimately achieving effective inhibition of breast cancer cell proliferation and migration. The recombinant type III collagen provided by this invention not only possesses a well-defined sequence and structure but also exhibits low immunogenicity, high biocompatibility, and potential advantages for targeted therapy. Experiments have demonstrated that the recombinant type III collagen prepared by this invention can effectively inhibit the growth of breast cancer cells and can be used as a targeted drug for cancer treatment.
[0024] This invention provides a recombinant type III collagen that inhibits the proliferation of breast cancer cells, the amino acid sequence of which is shown in SEQ ID NO.1.
[0025] SEQ ID NO.1: GRPGERGLPGENGPRGAPGERGRPGLPGAAGARGNDGARGSDGVMGFPGMPGERGRPGERGLPGENGPRGAPGERGRPGLPGAAGARGNDGARGSDGVMGFPGMPGERGRPGERGLPGENGPRGAPGERGRPGLP GAAGARGNDGARGSDGVMGFPGMPGERGRPGERGLPGENGPRGAPGERGRPGLPGAAGARGNDGARGSDGVMGFPGMPGERGRPGERGLPGENGPRGAPGERGRPGLPGAAGARGNDGARGSDGVMGFPGMPGER.
[0026] The sequence shown in SEQ ID NO.1 is designed with clear repeatability and extensibility. It can function as an independent biological monomer, or as a basic module, which can be tandemly repeated using genetic engineering techniques to construct multimers with different repeat numbers (n). Specifically, n is an integer greater than or equal to 1. When n=1, the protein is in monomeric form, i.e., the sequence in SEQ ID NO.1 itself.
[0027] When n≥2, the protein is a multimer formed by direct tandem repeats of the SEQ ID NO.1 sequence, that is, no exogenous amino acid sequence or linker peptide is inserted between each repeating unit, and the carboxyl terminus of the previous unit is directly linked to the amino terminus of the next unit.
[0028] This invention provides a recombinant type III collagen that inhibits the proliferation of breast cancer cells. Codon optimization is performed to target host cell expression, and signal peptide cleavage sites are added to both ends during the design process. Eco RI and Kpn The I restriction enzyme site facilitates subsequent gene manipulation. After the above optimization, its nucleotide sequence is shown in SEQ ID NO.2.
[0029] SEQ ID NO.2: GGTCGTCCAGGCGAGCGTGGTCTGCCAGGCGAAAATGGCCCAAGAGGAGCACCAGGAGAGAGAGGCCGTCCAGGTTTGCCTGGTGCCGCAGGTGCTAGAGGCAATGATGGAGCTAGAGGTTCTGACGGTGTAATGGGCTTTCCAGGTATGCCAGGAGAAAGAGGTAGGCCAGGTGAGAGGGGTTTGCCAGGCGAGAATGGACCAAGGGGTGCTCCTGGTGAGAGAGGACGTCCAGGCCTTCCTGGCGCCGCAGGAGCAAGGGGCAACGATGGCGCTAGAGGTAGTGATGGTGTCATGGGTTTTCCTGGCATGCCTGGCGAGAGAGGTAGACCTGGAGAGCGTGGACTGCCTGGCGAAAACGGTCCAAGAGGTGCCCCTGGAGAAAGGGGACGTCCTGGCCTTCCAGGAGCCGCTGGAGCACGAGGTAACGATGGTGCCAGGGGATCTGATGGAGTCATGGGCTTTCCTGGTATGCCTGGAGAACGTGGCCGACCAGGTGAACGTGGATTGCCTGGAGAGAACGGTCCTAGAGGCGCACCAGGTGAAAGAGGCAGACCAGGTTTACCTGGCGCTGCCGGCGCCAGAGGCAACGACGGAGCAAGAGGTTCCGATGGCGTCATGGGATTTCCAGGAATGCCTGGTGAAAGGGGTAGACCAGGCGAAAGAGGCTTACCTGGTGAAAACGGCCCTAGAGGTGCTCCAGGTGAGCGTGGCAGGCCAGGCTTGCCTGGCGCAGCTGGTGCCAGAGGTAATGACGGAGCCAGAGGCTCCGACGGTGTTATGGGATTCCCTGGAATGCCAGGCGAACGT。
[0030] This invention provides an expression vector comprising the nucleotide sequence shown in SEQ ID NO. 2 above. The vector may contain regulatory sequences, such as transcription and translation start and stop codons, specific to the type of host to which the vector is to be introduced, for example, bacteria, fungi, plants, or animals, depending on whether the vector is DNA-based or RNA-based. In one specific embodiment, the expression vector is obtained by linking the nucleotide sequence shown in SEQ ID NO. 2 with pPICZ alpha A, the nucleotide sequence of which is shown in SEQ ID NO. 3.
[0031] SEQ ID NO.3:
[0032] This invention provides a host cell comprising the aforementioned nucleic acid molecules. The host cell refers to a cell in which exogenous nucleic acids have been introduced, including the progeny of such cells. The host cell includes transformants and transformed cells, comprising primary transformed cells and their derived progeny, regardless of passage number. The progeny may not be entirely identical to the parent cells in terms of nucleic acid content, but may contain mutations.
[0033] In one specific embodiment, the host cell is selected from any one of Pichia pastoris, Saccharomyces cerevisiae, Escherichia coli, and Bacillus subtilis.
[0034] In one specific embodiment, the host cell is Pichia pastoris X-33.
[0035] This invention provides a method for preparing any of the aforementioned recombinant type III collagen, comprising the following steps: The expression was performed using the aforementioned host cells, followed by separation and purification.
[0036] The expression of the host cell refers to the culture of the host cell, and the culture medium and culture conditions are well known to those skilled in the art.
[0037] In one specific embodiment, the host cell is Pichia pastoris. After obtaining the Pichia pastoris genetically engineered strain, the specific culture conditions are as follows: the Pichia pastoris genetically engineered strain is inoculated into BMGY medium and cultured at 30°C and 220 rpm for 22-24 hours until OD... 600 Use 18-20g as the seed culture for the upper tank. After expanding the seed culture, inoculate it into an NBS 415 fermenter with an initial volume of 5L at a 10% inoculation rate. The culture temperature is 28℃-30℃, the pH is 5.0-6.0, and the dissolved oxygen is controlled at 20%-30%. After the glycerol is exhausted, start the glycerol feeding culture. When the cell wet weight reaches more than 180g / L, start the induction culture.
[0038] The present invention does not impose any restrictions on the expression method, which can be determined as needed, for example, the expression can be induced expression, and the inducing agent is methanol.
[0039] In one specific implementation, methanol was added for induction culture, with the induction phase temperature at 28°C and pH at 5.0, and the culture was discharged after 48 hours of induction.
[0040] This application does not impose any restrictions on the methods of separation and purification, which can be determined according to the specific circumstances, such as salting out, ultrafiltration, affinity chromatography and gel filtration chromatography.
[0041] Example 1: Expression of recombinant type III collagen A chemically synthesized recombinant type III collagen gene, the nucleotide sequence of which is shown in SEQ ID NO.2, was used. SEQ ID NO.2 was ligated into the vector pPICZ alpha A using molecular cloning technology to construct the recombinant plasmid pPICZ A-RCOL(III). The correctly constructed recombinant plasmid was transformed into competent *E. coli* cells and streaked onto cells containing 50 μg / mL bleomycin-resistant (Zeo) inhibitors. + After incubating the culture medium on solid LB medium at 37°C for 12 hours, pick morphologically robust single colonies from the plates and inoculate them onto a medium containing the same concentration of Zeo. + In LB liquid medium, select single colonies with good growth from the plates and pick them into a medium containing 50 μg / mL bleomycin-resistant (Zeo) culture medium. + Continue culturing in LB liquid medium and extract pPICZ A-RCOL(III) plasmid according to the instructions in the kit.
[0042] Using Pichia pastoris X-33 as the expression host, the obtained pPICZ A-RCOL(III) plasmid was transformed into Pichia pastoris X-33 by electroporation to obtain the expression engineered strain X-33-pPICZ A-RCOL(III), and high copy positive clones were selected by bleomycin gradient method.
[0043] Screening for positive transformants: in zeo + In selecting high-copy-positive clones, some transformants were selected with a marker pen. A small amount of bacterial cells from the selected transformants was picked up with a sterile pipette tip and smeared onto the bottom of a PCR tube. Then, 50 μL of enzyme-free water was added and the tube was mixed by pipetting. The tube was first heated in a microwave oven at medium-high temperature for 10 min, and then immediately placed in a freezer at -80℃ for 10 min. This process was repeated 5 times. The tube was centrifuged at 12000 rpm for 1 min, and 3 μL of the supernatant was used as a template. PCR was performed using universal primers, 5'AOX and 3'AOX, for verification.
[0044] The obtained positive X-33-pPICZ A-RCOL(III) Pichia pastoris genetically engineered strain was inoculated into BMGY medium and cultured in a shaking incubator at 30℃ and 220rpm for 24h. Subsequently, an appropriate amount of culture was transferred to BMGY medium and the initial OD was adjusted. 600 The culture was continued at the same temperature and rotation speed for 72 hours, with methanol added every 24 hours to maintain a methanol concentration of 1% in the culture medium. The OD of the bacterial culture was measured every 24 hours. 600 The supernatant was collected by centrifugation, and protein expression was analyzed using SDS-PAGE denaturing gel electrophoresis. Figure 1 As shown, the desired recombinant type III collagen was obtained.
[0045] Example 2: Purification of recombinant type III collagen 1. When the supernatant collected by centrifugation in Example 1 is ultrafiltered to 50% of its initial volume, 5 times the volume of pure water is added, and then the mixture is concentrated to 5% of its initial volume by ultrafiltration.
[0046] 2. Add 60% of the total volume of the concentrated supernatant to saturated ammonium sulfate, stir at room temperature for 30 min, centrifuge at 9000 rpm for 10 min and collect the precipitate. Dissolve the precipitate in 500 mL of 0.05 M PBS with pH 7.0 and filter through a 0.22 μm filter membrane.
[0047] 3. Prepare equilibration buffers based on the protein's isoelectric point: 20 mmol / L sodium phosphate buffer, pH 6.5, denoted as solution A; prepare an elution buffer (pH 6.5) by mixing 20 mmol / L sodium phosphate and 1.0 mol / L NaCl, denoted as solution B. Dilute the PBS protein solution obtained in the previous step with solution A at a ratio of 10:1 to prepare the loading solution. After filtration, load the solution onto a 25 mL MMC cation exchange chromatography column, equilibrating the column with equilibration buffer before loading. After loading, wash with solution A for two column volumes, then perform gradient elution with 30% solution A and 70% solution B at a flow rate of 2 mL / min. Collect the eluted fractions and analyze them using SDS-PAGE. The protein was concentrated to 30% of its initial volume by ultrafiltration, then pre-frozen at -20°C for 4 hours, and then freeze-dried in a vacuum freeze dryer. After 72 hours, the freeze-dried protein was collected to obtain the purified recombinant type III collagen. The freeze-dried protein sample was stored at 4°C for later use.
[0048] Example 3: Experiment on the inhibition of breast cancer cell proliferation by recombinant type III collagen An in vitro cell proliferation model was established to evaluate cell viability induced by recombinant type III collagen. In short, logarithmically growing breast cancer cells (MDA-MB-231) were seeded in 96-well tissue culture plates, achieving a cell density of 510 cells per well. 3 The cells were cultured at 37°C in a 5% CO2 incubator for 1 day. The old culture medium was discarded, and recombinant type III collagen was dissolved sequentially in DMEM medium at concentrations of 0.5 mg / mL, 1 mg / mL, 3 mg / mL, and 5 mg / mL. The solutions were filtered and sterilized, and 100 μL was added to each well of a 96-well plate. In the negative control group, 100 μL of fresh complete culture medium was added. After 24 hours of incubation, cell proliferation was verified using the CCK8 assay, and absorbance was measured at 450 nm. The proliferation of breast cancer cells was statistically analyzed as follows: Figure 2 As shown.
[0049] The results are as follows: the negative control group (100%) was set up without the addition of recombinant type III collagen, and the results are shown in Table 1.
[0050] Table 1. Statistics on breast cancer cell proliferation Note: " / " indicates that this item is not present.
[0051] The results show that the recombinant type III collagen of the present invention can significantly inhibit the growth of breast cancer cells, which is consistent with the results observed under light microscopy.
[0052] Example 4: Experiment on the inhibition of breast cancer cell migration by recombinant type III collagen MDA-MB-231 breast cancer cells were seeded into six-well plates at a volume of 2 mL / well. After cell attachment, 2 mL of recombinant type III collagen prepared with 10% FBS medium was added to the experimental group for co-culture, with a final concentration of 1 mg / mL. The control group received the same amount of 10% FBS medium. When each well reached 95% confluence and formed a monolayer, a 200 μL pipette tip was used to make a "V" shaped incision on the monolayer. The cells were washed three times with PBS. The experimental group was then cultured with 2 mL of serum-free medium prepared with recombinant type III collagen at a concentration of 1 mg / mL, while the control group received the same amount of serum-free medium. After incubation for 24 hours, the culture medium was aspirated, and the cells were washed three times with PBS. The cells were observed and photographed under an inverted fluorescence microscope, and the relative migration rate was recorded. Figure 3 and Figure 4 As shown.
[0053] The results showed that, after group culture, the migration rate of breast cancer cells treated with recombinant type III collagen was significantly reduced compared with the control group, indicating that recombinant type III collagen has an inhibitory effect on the migration ability of breast cancer cells.
[0054] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0055] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.
Claims
1. A recombinant type III collagen, characterized in that, The amino acid sequence is shown in SEQ ID NO.
1.
2. A gene encoding the recombinant type III collagen as described in claim 1, characterized in that, The nucleotide sequence is shown in SEQ ID NO.
2.
3. An expression carrier, characterized in that, It comprises the nucleotide sequence as described in claim 2, the nucleotide sequence being shown in SEQ ID NO.
3.
4. A host cell, characterized in that, It includes the expression vector as described in claim 3.
5. The host cell according to claim 4, characterized in that, The host cell is any one of Pichia pastoris, Saccharomyces cerevisiae, Escherichia coli, and Bacillus subtilis.
6. The method for preparing recombinant type III collagen according to claim 1, characterized in that, The host cells as described in claim 4 or claim 5 are cultured in a culture medium, and recombinant type III collagen is induced to express and then purified to obtain recombinant type III collagen.
7. The preparation method according to claim 7, characterized in that, The purification method is selected from any one of salting out, ultrafiltration, affinity chromatography, and gel filtration chromatography.
8. Use of the recombinant type III collagen according to claim 1 in the preparation of a medicament for the prevention and / or treatment of breast diseases.