An engineered probiotic for promoting wound healing and methods of construction and use thereof
By constructing EcN engineered bacteria with the ThyA gene knocked out, and using the CRISPR-Cas9 system to control their colonization on diabetic ulcer wounds, the inflammation problem caused by excessive EcN proliferation was solved, and safe and effective wound healing was achieved.
Patent Information
- Application Number
- CN202511996160.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-26
- Publication Date
- 2026-06-02
AI Technical Summary
Currently, the probiotic EcN has been found to over-colonize on diabetic ulcer wounds, leading to persistent inflammation, disrupting the microecological balance, and affecting wound healing.
EcN engineered bacteria with ThyA gene knockout were constructed. The ThyA gene of EcN was knocked out using the CRISPR-Cas9 system to form an auxotrophic strain. The colonization of the strain on the wound surface was controlled by the pV4N20 and pRedcas9 dual plasmid system in the CRISPR-Cas9 system to avoid excessive proliferation.
It achieves precise control over the colonization of EcN in the wound, avoiding dysbiosis and biofilm formation, safely and effectively promoting the healing of diabetic ulcers, and avoiding the negative effects caused by excessive EcN proliferation.
Smart Images

Figure CN122128192A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biomedicine and genetic engineering technology, specifically relating to engineered probiotics for promoting wound healing, their construction methods, and applications. Background Technology
[0002] Diabetic ulcers are one of the most serious and common complications of diabetes, characterized by delayed wound healing, susceptibility to infection, and high recurrence rates. Current clinical treatments are limited and their effectiveness is not ideal. The poor healing nature of diabetic ulcers stems from a complex vicious cycle, including microvascular complications caused by persistent hyperglycemia, insufficient tissue perfusion, peripheral neuropathy, and an abnormal and prolonged inflammatory response. Among these, the dysregulation of the inflammatory response, particularly macrophage dysfunction, is considered the core factor causing the wound to remain in the inflammatory phase and unable to transition normally to the proliferative phase.
[0003] In the normal wound healing process, macrophages exhibit a precise temporal functional transition: in the early stages of inflammation, they primarily present a pro-inflammatory M1 phenotype, responsible for clearing pathogens and necrotic tissue; subsequently, they polarize into an anti-inflammatory, pro-repair M2 phenotype, secreting various growth factors to mediate angiogenesis, fibroblast proliferation, and extracellular matrix reconstruction, thereby promoting the healing process. However, in the wound microenvironment of diabetic ulcers, this crucial macrophage phenotype transition is severely impaired. Due to factors such as persistent hyperglycemia, the accumulation of advanced glycation end products (AGEs), and oxidative stress, macrophages are "locked" in the pro-inflammatory M1 state and unable to effectively transition to the M2 phenotype. This abnormal, low-grade chronic inflammation continuously damages new tissue, inhibits fibroblast function and keratinocyte migration, and disrupts angiogenesis, ultimately causing the wound healing process to be "stuck" at the inflammatory stage and unable to progress.
[0004] Escherichia coli Nissle 1917 (EcN) is a non-pathogenic probiotic strain with various beneficial properties, including immunomodulation, pathogen inhibition, and barrier enhancement. Its known immunomodulatory capabilities, particularly the potential of certain strain components (such as lipopolysaccharide variants) and short-chain fatty acids (butyrate, etc.) to regulate macrophage polarization, have been reported. However, direct application of EcN to wounds exhibits abnormally high proliferation rates, becoming the dominant species in the wound microbiota. This over-colonization of a single species severely disrupts the inherent microecological balance of the wound, creating persistent inflammatory stimulation and potentially exacerbating the local M1 macrophage-dominated inflammatory state. This could have a synergistic negative effect with the prolonged inflammation caused by diabetes itself. This unexpected discovery reveals the potential risks of directly applying wild-type probiotics to complex wound environments: their colonization behavior may become uncontrolled, transforming from "beneficial" to "harmful." Therefore, it is of great significance to modify wild-type EcN to make it effective for the healing of diabetic ulcers. Summary of the Invention
[0005] Purpose of the invention: To address the problems existing in the prior art, the present invention provides an engineered probiotic for promoting wound healing. The engineered bacteria constructed in this invention can retain the beneficial immunomodulatory activity of EcN (especially its potential ability to promote the transformation of macrophages into a pro-repair phenotype), while controlling the colonization of the novel engineered bacteria in vivo, so as to safely and controllably correct the abnormal inflammatory microenvironment of diabetic ulcers, thereby effectively exerting its wound healing function.
[0006] The present invention also provides a method for constructing and applying the engineered probiotics.
[0007] Technical solution: In order to achieve the above objectives, the present invention provides an engineered probiotic for promoting wound healing. The engineered probiotic is obtained by knocking out the ThyA gene of EcN as the starting strain. The nucleotide sequence of the ThyA gene is shown in SEQ ID NO.1.
[0008] Among them, the pV4N20 and pRedcas9 dual plasmid system in the CRISPR-Cas9 system was used to knock out the thymine synthase ThyA gene in the EcN genome, resulting in a auxotrophic strain (ThyA). - / - -EcN engineered bacteria).
[0009] The method for constructing engineered probiotics for promoting wound healing according to the present invention includes the following steps:
[0010] (1) Activation and identification of EcN: PCR amplification was performed to verify the specificity of the two characteristic plasmids pMUT1 and pMUT2 of EcN strain, as well as the gene sequences of type 1 fim A and F1C fim A.
[0011] (2) sgRNA design: Based on the CHOPCHOP (http: / / chopchop.cbu.uib.no / ) sgRNA target design website, ThyAsgRNA: GTTTACCATACACTGGCCCG was designed to ensure that the sequence has high specificity in the EcN genome to avoid off-target effects. Primers with homologous arms of ThyAsgRNA were designed based on this sequence for subsequent linearization.
[0012] (3) Construction of PV4n20 plasmid: Using the extracted EcN genome as a template, TupF and TupR were used as primers to amplify fragment 1, and TdownF and TdownR were used as primers to amplify fragment 2; using the extracted PV4 plasmid as a template, PV4F and PV4R were used as primers to amplify fragment 3; fragments 1-3 were recombined to obtain PV4 plasmid containing homologous arms up and down; using PV4 plasmid containing homologous arms up and down as a template, ThyAF and TupR were used as primers to amplify fragment 4, and ThyAR and TdownF were used as primers to amplify fragment 5, and fragments 4-5 were recombined to obtain PV4n20 plasmid.
[0013] (4) Electroporation: Add the constructed pV4N20 plasmid and pRedCas9 plasmid to competent cells, mix well, add to a pre-cooled electroporation cuvette, perform electroporation, and immediately add LB medium after completion, and revive at 28℃ for 1-2 hours with shaking.
[0014] (5) Screening positive clones: Spread the revived bacterial culture on LB plates containing chloramphenicol (pRedCas9 resistance) and kanamycin (genome knock-in resistance), and incubate upside down at 28°C for 24-48 hours.
[0015] (6) Induction of knockout: Single colonies were picked from overnight LB agar plates and inoculated into liquid LB medium containing 5% arabinose (containing 50 mg / L kanamycin and 34 mg / L chloramphenicol and thymine 3mM) for overnight induction. Then, the overnight bacterial culture was diluted and spread onto solid LB medium containing 5% arabinose (containing 50 mg / L kanamycin + 34 mg / L chloramphenicol + thymine 3mM) for continued overnight induction.
[0016] (7) Verification: Select single colonies and incubate overnight at 37°C and 220 rpm. Extract plasmids and genomes, and perform PCR verification using TupF and TdownR, PV4F and PV4R, pCasF and pCasR as primers.
[0017] The preferred primers for strain verification and amplification in step (1) are as follows:
[0018] Plasmid pMUT1 F:AACTGTGAAGCGATGAACCC
[0019] Plasmid pMUT1 R:GGACTGTTCAGAGAGCTATC
[0020] Plasmid pMUT2(1) F:GACCAAGCGATAACCGGATG
[0021] Plasmid pMUT2(1) R:GTGAGATGATGGCCACGATT
[0022] Plasmid pMUT2(2) F:GCGAGGTAACCTCGAACATG
[0023] Plasmid pMUT2(2) R:CGGCGTATCGATAATTCACG
[0024] fimA F:GTGTACAGAACGACTGCC
[0025] fimAR:GTAATGACGTCCCTGAAC
[0026] focA F:CTCACATTGCATTTATGAAG
[0027] focA R:GGTATATATCCGTTACACTG
[0028] The preferred primers for amplifying the up, down, and PV4 linear fragments in step (3) are as follows:
[0029] TupF:AACTTCGGCAGCGGACGCGG
[0030] TupR: ATGAAAACGGCGACCTAGTGGCGCGCCTGGCCAA
[0031] TdownF:CACTAGGTCGCCGTTTTCATCGG
[0032] TdownR:AGTTTACTGGTGCCTGGGTGC
[0033] ThyA-F: CCGGACTATTTACGCCGTTG
[0034] ThyA-R: GCCTGGGTGCAGTACATCAG
[0035] PV4F:GCACCCAGGCACCAGTAAACTGTGCGCCATGAGAACGAACC
[0036] PV4R: CCGCGTCCGCTGCCGAAGTTACCGCTGGCTAAATACGGAA.
[0037] Step (7) verifies the primers as follows:
[0038] PV4F:GCACCCAGGCACCAGTAAACTGTGCGCCATGAGAACGAACC
[0039] PV4R: CCGCGTCCGCTGCCGAAGTTACCGCTGGCTAAATACGGAA
[0040] pCasF:ATGGATATAAGAAATACTCAAT
[0041] pCasR:TCAGTCACCTCCTAGCTGAC
[0042] The application of the engineered probiotics described in this invention in the preparation of drugs for promoting wound healing or regulating the wound immune microenvironment.
[0043] The wound in question is a diabetic ulcer.
[0044] The regulation of the wound immune microenvironment includes promoting macrophage polarization toward the M2 anti-inflammatory phenotype.
[0045] The pharmaceutical composition for promoting wound healing or regulating the wound immune microenvironment described in this invention comprises the engineered probiotics and a pharmaceutically acceptable carrier or excipient.
[0046] This invention provides an engineered probiotic with the ThyA gene knocked out, using EcN as the host bacterium. Molecular biology and gene sequencing assays were used to identify and characterize a gene knockout auxotrophic strain. This invention utilizes the pV4N20 and pRedcas9 dual plasmid system in the CRISPR-Cas9 system to knock out the thymine synthase ThyA gene in the EcN genome, creating an auxotrophic strain (ThyA).- / - -EcN engineered bacteria). Further, the above-mentioned ThyA - / - - The application of EcN engineered bacteria in drugs that promote wound healing, preferably in diabetic ulcer wounds.
[0047] Among them, the ThyA gene is used to regulate EcN to promote wound healing or to regulate the wound immune microenvironment.
[0048] Among them, the growth of EcN is controlled by the ThyA gene, and it can be further used to promote wound healing or regulate the wound immune microenvironment.
[0049] Beneficial effects: Compared with the prior art, the present invention has the following advantages:
[0050] This invention utilizes the pV4N20 and pRedcas9 dual plasmid system in the CRISPR-Cas9 system to successfully construct the ThyA gene knockout auxotrophic Nissle 1917 engineered probiotic (ThyA). - / - The engineered bacterium *EcN* addresses the issue of EcN over-colonization in wounds. It retains the inhibitory activity of EcN against Staphylococcus aureus, but its colonization ability in wounds due to nutritional deficiencies is effectively controlled. This results in the suppression of excessive inflammation and promotion of healing of diabetic ulcers, providing a safe and effective innovative drug for the treatment of diabetic ulcers.
[0051] This invention, for the first time, constructs an auxotrophic EcN with the Thysine synthase ThyA gene knocked out, achieving precise "endogenous" control over the colonization of engineered bacteria. This fundamentally avoids the risks of dysbiosis and biofilm formation caused by the excessive proliferation of wild-type EcN, and innovatively solves the problem of probiotic colonization control.
[0052] This invention confirms ThyA through animal experiments. - / - -EcN engineered bacteria, when applied to diabetic ulcer wounds, do not cause subsequent ulceration. Furthermore, due to the lack of specific regulatory factors, they avoid the risk of escape and are highly safe.
[0053] The engineered bacteria constructed in this invention retain the original beneficial properties of EcN (immunomodulation, etc.) while controlling colonization, effectively promoting wound healing and demonstrating definite therapeutic effects.
[0054] The "nutrient deficiency control" strategy provided by this invention can be widely applied to the development of other live bacterial preparations that require precise control of in vivo behavior, and has strong universality: it has significant theoretical and applied value. Attached Figure Description
[0055] Figure 1Analysis of wound microbiota in diabetic mice with EcN intervention (n=5) (A) Representative animal photographs; (B) 16sRNA wound microbiota analysis.
[0056] Figure 2 For ThyA - / - -Schematic diagram of EcN engineered bacteria construction.
[0057] Figure 3 For EcN characteristic amplification, M: 2000 bp maker, lanes: L1 characteristic plasmid pMUT1 amplification fragment; L2 characteristic plasmid pMUT2 amplification fragment; L3-L5: characteristic FimA, F1C, and FocA gene amplification.
[0058] Figure 4 Construction of PV4 plasmid (A) Fragments required for PV4 plasmid construction, lanes: L1-5 up amplification fragment; L6-10 down amplification fragment; L11-L15: Pv4; (B) Plasmid verification, lanes: L1-6, amplification using vector primers as templates, L7 is the Pv4 plasmid control.
[0059] Figure 5 Construction of PV4 n20 plasmid (A) Fragment required for PV4 n20 plasmid construction, lanes: L1-5 amplification using ThyA-R+TdownF primers as templates, L7-11 amplification using ThyA-F+TupR primers as templates; (B) Plasmid verification, lanes: L1-7 amplification using plasmid as templates, L8 as negative control.
[0060] Figure 6 For single colony verification: (A) Plasmid verification; Lanes: L1-5 were amplified using PV4F+PVR primers as templates, L6 was a positive control; L7-11 were amplified using pCasF+pCas primers as templates, L12 was a positive control; (B) Genomic verification; L1-2 were amplified using TupF+TdownR primers as templates, L3 was a positive control; (C) Sequencing verification.
[0061] Figure 7 For ThyA - / - -EcN in vitro extrinsic morphology verification (A) Solid / liquid LB culture; (B) Growth curves: In vitro liquid and solid culture results show that ThyA - / - -EcN growth is limited without the addition of Thymidine, but can grow normally with the addition of Thymidine.
[0062] Figure 8 For ThyA - / - -EcN Activity Study (A) ThyA - / -- Representative images of EcN plating plates; (B) Quantitative analysis of viable bacteria count.
[0063] Figure 9 (A) Representative animal images for wound healing rate; (B) Quantitative analysis of wound healing rate; (n=5).
[0064] Figure 10 For the wound ThyA - / - -EcN in vitro culture.
[0065] Figure 11 For ThyA - / - -EcN promotes the healing of diabetic ulcers (A) Representative wound images; (B) Quantitative analysis of wound healing rate; (C) Mouse weight records during drug intervention; (n=6).
[0066] Figure 12 For flow cytometry analysis of M1 / 2 macrophages in wound tissue on day 7: (A) Representative flow cytometry images of CD86 and CD206 positive cells; (B) Quantitative analysis of the MFI ratio of CD86 and CD206 (compared to isotype controls).
[0067] Figure 13 For PCR detection of ThyA - / - -Changes in EcN engineered bacteria supernatant after intervention with Raw264.7 related genes (AC) Expression levels of M1 macrophage-related marker genes; (DF) Expression levels of M2 macrophage-related marker genes; (n=3).
[0068] Figure 14 For immunofluorescence detection of ThyA - / - -EcN engineered bacteria supernatant intervention on changes in the number of Raw264.7 CD86+ cells.
[0069] Figure 15 For immunofluorescence detection of ThyA - / - -EcN engineered bacteria supernatant intervention on changes in the number of Raw264.7 CD206+ cells.
[0070] Figure 16 For in vitro ThyA - / - -EcN engineered bacteria co-cultured with SA (A): Solid plating; (B): Quantitative analysis of colony count ( (n=3).
[0071] Figure 17 To build ThyA - / - -Plasmid required for EcN engineered bacteria. Detailed Implementation
[0072] The present invention will be further described below with reference to the accompanying drawings and embodiments.
[0073] Unless otherwise specified, all materials and reagents used in the embodiments of this invention are commercially available. Experimental methods not specifically described in the embodiments are generally performed under standard conditions or as recommended by the manufacturer.
[0074] Escherichia coli Nissle1917 (abbreviated as EcN, BNCC361741) was purchased from Hebei Beina Biotechnology Co., Ltd.
[0075] PV4 and pRedCas9 are known plasmids donated by Zhang Xueli's laboratory at the Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, and are plasmids already reported in the literature (Optimization of Escherichia coli CRISPR / Cas9 gene editing system and its application, Journal of Biology, Vol. 37, No. 4, August 2020); pRedCas9 is also available for commercial purchase from Shanghai Qincheng Biotechnology Co., Ltd. (Catalog No. QCP2838).
[0076] Example 1
[0077] ThyA gene knockout EcN engineered bacteria (ThyA) - / - Construction of -EcN engineered bacteria (see schematic diagram of engineered bacteria construction process as shown in Figure 1) Figure 2 )
[0078] 1.1 EcN Activation and Identification
[0079] 1.1.1 Activation of the strain
[0080] First, wipe the outer surface of the cryovial with a 75% alcohol swab. Then, open the sterile cryovial cap and use a sterile pipette tip to draw 1 ml of sterile water into the cryovial. After ensuring that the bacterial solution is completely dissolved, transfer it to LB medium to complete the inoculation process.
[0081] 1.1.2 Genome Extraction
[0082] (1) Collection and lysis of bacterial cells:
[0083] Collect 1-5 ml of bacterial pellet into a centrifuge tube, add 200 μl of buffer GA, and gently pipette until the bacterial cells are completely suspended. Then add 20 μl of proteinase K solution, mix well, add 220 μl of buffer GB, vortex for 15 seconds, and incubate at 70°C for 10 minutes until the solution becomes clear and the cell walls are completely lysed.
[0084] (2) DNA binding and washing:
[0085] Add 220 μL of anhydrous ethanol and vortex to mix for 15 seconds. Transfer the entire contents of the centrifuge tube to the adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid. Place the adsorption column CB3 back into the collection tube, add 500 mL of buffer GD, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid. Then add 600 μL of wash buffer PW, centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and repeat this step once.
[0086] (3) DNA elution and preservation:
[0087] Return the CB3 adsorption column to the collection tube and centrifuge at 12,000 rpm for 2 min to completely remove residual liquid. Let the CB3 column stand at room temperature for several minutes, then transfer it to a sterile centrifuge tube. Add 50 μl of sterile H2O dropwise to the center of the adsorption membrane, let stand at room temperature for 5 min, centrifuge at 12,000 rpm for 2 min, and collect the eluent. Finally, store the extracted genomic DNA at -20°C.
[0088] 1.1.3 Plasmid Extraction
[0089] (1) Collection and lysis of bacterial cells:
[0090] Take 5 ml of overnight bacterial culture, centrifuge at 5000 rpm for 10 min, and discard the supernatant. Add 250 μl of Buffer P1 (containing RNase A) to the bacterial pellet to fully suspend the cells. Then add 250 μl of Buffer P2 and gently invert 8-10 times to completely lyse the cells. Next, add 350 μl of Buffer P3 and immediately gently invert 8-10 times. At this point, a white flocculent precipitate (protein precipitation) will appear.
[0091] (2) Plasmid DNA binding and washing:
[0092] Insert the adsorption column into the collection tube and carefully transfer the supernatant into the adsorption column, avoiding aspiration of precipitate. Centrifuge at 12000 rpm for 30 s and discard the waste liquid. Place the adsorption column back into the collection tube, add 600 μl of Buffer PW2 (containing anhydrous ethanol), centrifuge at 12000 rpm for 30 s, and discard the waste liquid. Repeat this washing step once.
[0093] (3) Plasmid DNA elution and preservation:
[0094] Return the adsorption column to the collection tube and centrifuge at 12,000 rpm for 2 min to completely remove residual liquid. Incubate at room temperature for 5 min to allow the column to dry completely. Transfer the column to a sterile 1.5 ml centrifuge tube, add 30 μl of sterile water to the center of the adsorption membrane, and incubate at room temperature for 2 min. Centrifuge at 12,000 rpm for 2 min to elute the plasmid DNA. Store the extracted plasmid at -20°C for subsequent experiments.
[0095] 1.1.2 Identification of strains
[0096] Based on the identification method proposed by Gabriele Blum-Oehler et al., specific PCR primers were designed targeting the gene sequences of two characteristic plasmids pMUT1 and pMUT2 of the EcN strain, as well as the type 1 fimbrial subunit fimA and the F1C fimbrial subunit focA. Using the two EcN plasmids pMUT1 and pMUT2 as templates, the primers were Plasmid pMUT1 F and Plasmid pMUT1 R, Plasmid pMUT2(1) F and Plasmid pMUT2(1) R, and Plasmid pMUT2(2) F and Plasmid pMUT2(2) R. Using EcN as a template, the primers were fimA F and fimAR, focAF and focA R. The specific primers are as follows:
[0097] Plasmid pMUT1 F:AACTGTGAAGCGATGAACCC
[0098] Plasmid pMUT1 R:GGACTGTTCAGAGAGCTATC
[0099] Plasmid pMUT2(1) F:GACCAAGCGATAACCGGATG
[0100] Plasmid pMUT2(1) R:GTGAGATGATGGCCACGATT
[0101] Plasmid pMUT2(2) F:GCGAGGTAACCTCGAACATG
[0102] Plasmid pMUT2(2) R:CGGCGTATCGATAATTCACG
[0103] fimA F:GTGTACAGAACGACTGCC
[0104] fimAR:GTAATGACGTCCCTGAAC
[0105] focA F:CTCACATTGCATTTATGAAG
[0106] focA R:GGTATATATCCGTTACACTG
[0107] The specific amplification process is shown in Tables 1 and 2.
[0108] Table 1. PCR reaction system for strain identification
[0109]
[0110] Table 2 PCR amplification program
[0111]
[0112] By comparing the two plasmids pMUT1 and pMUT2 contained in EcN, and the five specific PCR amplification fragments of the type I fimbriae subunits FimA and F1C, and the fimbriae subunit FocA, the strain can be identified as EcN (without mutation). Figure 3 ).
[0113] 1.2 sgRNA Design
[0114] The sgRNA of the ThyA gene was designed: GTTTACCATACACTGGCCCG. This sequence was ensured to have high specificity in the EcN genome to avoid off-target effects. Primers with homologous arms of the ThyAsgRNA were then designed for subsequent linearization.
[0115] 1.3 Construction of PV4n20 plasmid
[0116] 1.3.1 Using the extracted EcN genome as a template, fragment 1 was amplified using TupF and TupR primers, and fragment 2 was amplified using TdownF and TdownR primers. The PCR reaction system and PCR amplification program are shown in Tables 3-4. Using the extracted PV4 plasmid as a template, fragment 3 was amplified using PV4F and PV4R primers. Fragments 1-3 were then subjected to recombination to reconstitute the PV4 plasmid containing homologous arms up and down. The recombination reaction system is shown in Table 5. Using the PV4 plasmid containing homologous arms up and down as a template, fragment 1 was amplified using ThyA-F and TupR primers, and fragment 2 was amplified using ThyA-R and TdownF primers. The plasmid was linearized by reverse PCR. The PCR reaction system and PCR amplification program are shown in Tables 6-9, and the primer sequences are as follows:
[0117] Primers:
[0118] TupF:AACTTCGGCAGCGGACGCGG
[0119] TupR: ATGAAAACGGCGACCTAGTGGCGCGCCTGGCCAA
[0120] TdownF:CACTAGGTCGCCGTTTTCATCGG
[0121] TdownR:AGTTTACTGGTGCCTGGGTGC
[0122] ThyA-F: CCGGACTATTTACGCCGTTG
[0123] ThyA-R: GCCTGGGTGCAGTACATCAG
[0124] PV4F:GCACCCAGGCACCAGTAAACTGTGCGCCATGAGAACGAACC
[0125] PV4R: CCGCGTCCGCTGCCGAAGTTACCGCTGGCTAAATACGGAA
[0126] Table 3. PCR reaction system for up and down fragments
[0127]
[0128] Table 4. PCR amplification procedures for up and down fragments
[0129]
[0130] Table 5 Recombination reaction system containing PV4 plasmid homologous arm
[0131]
[0132] Table 6. PCR reaction system for linearized fragment 1 of PV4n20 plasmid
[0133]
[0134] Table 7 PCR Amplification Procedure
[0135]
[0136] Table 8. PCR reaction system for linearized fragment 2 of PV4n20 plasmid
[0137]
[0138] Table 9 PCR Amplification Procedure
[0139]
[0140] 1.3.2 Purification of PCR products
[0141] (1) Cutting and dissolving the glue:
[0142] After DNA electrophoresis, the gel containing the target DNA fragment is rapidly cut under blue light using a gel cutter and cut into small pieces. Buffer B2 is added at a ratio of 300-600 μl per 100 mg of gel, and the gel is incubated in a 50°C water bath for 10 min. During the water bath, the gel is periodically inverted to mix thoroughly, ensuring complete dissolution.
[0143] (2) DNA binding and washing:
[0144] Cool the dissolved liquid to room temperature, then transfer it entirely to the adsorption column. Centrifuge at 8000g for 30 s and discard the filtrate in the collection tube. Return the adsorption column to the collection tube, add 500 μl of Wash Solution, let stand for 10 min, centrifuge at 9000g for 30 s, and discard the filtrate. Repeat this washing step once.
[0145] (3) DNA elution and preservation:
[0146] Return the adsorption column to the collection tube and centrifuge at 9000g for 2 min to completely remove residual liquid. Transfer the adsorption column to a 1.5mL sterile centrifuge tube, add 30 μl of sterile ddH2O to the center of the adsorption membrane, and incubate at room temperature for 2 min. Centrifuge at 9000g for 1 min to elute the DNA. Store the recovered DNA at -20°C for subsequent use.
[0147] 1.3.3 Conversion of Recycled Products
[0148] E. coli DH5α competent cells, frozen at -80°C, were slowly thawed on ice. 100 ng of purified DNA product was added, gently mixed, and incubated on ice for 30 min. The mixture was then subjected to a 45 s heat shock in a 42°C water bath, immediately transferred to ice for 2 min of cooling. 1 mL of LB liquid medium was added to a clean bench, and the cells were incubated at 37°C with shaking at 220 rpm for 1 h for recovery. Finally, an appropriate amount of bacterial culture was evenly spread onto LB agar plates, and after absorption, the plates were inverted and incubated at 37°C for 12–16 h.
[0149] Using the EcN genome as a template, TupF and TupR were used as primers to amplify fragment 1, TdownF and TdownR were used as primers to amplify fragment 2, and PV4 plasmid was used as a template, PV4F and PV4R were used as primers to amplify fragment 3. PCR amplification was performed, and the band sizes of the target gene homologous arms (up, down) and the PV4 recombination fragment were all correct (e.g., Figure 4 Using homologous recombinase, fragments 1-3 were recombined to obtain the PV4 plasmid containing homologous arms. Using the PV4 plasmid containing homologous arms as a template, ThyA-F and TupR were used as primers to amplify fragment 1, and ThyA-R and TdownF were used as primers to amplify fragment 2. The required amplified fragment band sizes for PV4n20 plasmid recombination were all correct (e.g., ...). Figure 5 The PV4n20 plasmid was obtained by recombining fragments 4-5 using homologous recombinase.
[0150] 1.4 Preparation of EcN competent cells
[0151] Single EcN colonies obtained by streaking were inoculated onto LB medium and cultured overnight at 37°C and 220 rpm with a shaker. The overnight culture was then transferred to fresh LB medium at a 10% inoculation rate and cultured for another 1.5–2 h at 37°C and 220 rpm with a shaker, until the OD600 value reached 0.5. The culture was centrifuged at 6000g for 5 min at 4°C, and the cells were collected. The supernatant was discarded, and the cells were resuspended in pre-chilled 10% glycerol and placed on ice for 30 min. This process was repeated twice. Finally, the cells were aliquoted and stored at -80°C as competent cells.
[0152] 1.5 Electroconversion
[0153] Take 100 μL of the above competent cells and add approximately 80 ng of the constructed pV4N20 and pRedCas9 plasmids (e.g., ...). Figure 16 Mix well. Add the mixture to a pre-cooled electroporation vessel and electroporate using appropriate electroporation parameters (1.8 kV, 5 ms). Immediately add 1 mL of LB medium and incubate at 28°C with shaking for 1-2 hours.
[0154] 1.6 Screening for positive clones
[0155] The revived bacterial culture was spread on LB plates containing chloramphenicol (pRedCas9 resistance) and kanamycin (genome knock-in resistance) and incubated upside down at 28°C for 24-48 hours.
[0156] 1.7 Induced Knockout
[0157] Single colonies were picked from overnight LB agar plates and inoculated into liquid LB medium containing 5% arabinose (containing 50 mg / L kanamycin and 34 mg / L chloramphenicol and 3 mM thymine), and incubated overnight for induction. Then, the overnight culture was diluted and spread onto solid LB medium containing 5% arabinose (containing 50 mg / L kanamycin + 34 mg / L chloramphenicol + 3 mM thymine), and incubated overnight for further induction.
[0158] 1.8 Verification
[0159] Single colonies were selected and cultured overnight at 37°C and 220 rpm in LB medium. Plasmids and genomes were extracted, and PCR verification was performed using TupF and TdownR, PV4F and PV4R, pCasF and pCasR as primers. The PCR reaction system, PCR amplification program (Tables 10-15), and primer sequences are as follows:
[0160] PV4F:GCACCCAGGCACCAGTAAACTGTGCGCCATGAGAACGAACC
[0161] PV4R: CCGCGTCCGCTGCCGAAGTTACCGCTGGCTAAATACGGAA
[0162] pCasF:ATGGATATAAGAAATACTCAAT
[0163] pCasR:TCAGTCACCTCCTAGCTGAC
[0164] Table 10 PCR reaction system for genome validation
[0165]
[0166] Table 11 PCR Amplification Procedure for Genome Validation
[0167]
[0168] Table 12 PCR reaction system for genome validation
[0169]
[0170] Table 13 PCR Amplification Procedure for Genome Validation
[0171]
[0172] Table 14 PCR reaction system for genome validation
[0173]
[0174] Table 15 PCR Amplification Procedure for Genome Validation
[0175]
[0176] The extracted genome and plasmids were amplified by PCR to obtain the target band, as shown below. Figure 6 A and B. The successfully validated PCR reaction solution was further sent for sequencing verification. The sequencing results showed that the ThyA gene on the EcN genome had been successfully knocked out. Figure 6 C), indicating that ThyA - / - -EcN genetically engineered bacteria have been successfully constructed using CRISPR / Cas9 gene editing technology.
[0177] 1.9 Phenotypic Validation
[0178] Inoculate ThyA with / without Thymidine in LB medium. - / - -EcN engineered bacteria, observe ThyA - / - The growth of -EcN, the results are as follows Figure 7 The result shows that in the absence of Thymidine, ThyA... - / - -EcN showed no significant growth, further proving that the auxotrophic engineered bacteria were successfully constructed.
[0179] 1.10 ThyA - / - -EcN engineered bacteria in vitro activity detection
[0180] ThyA - / - The EcN engineered bacteria were cultured overnight at 37°C and 220 rpm in LB liquid medium (containing 500 ng / ml Thymidine). The bacterial culture was then spread onto LB solid medium (without Thymidine) and cultured in vitro. After 12 hours, the viable cell count was quantitatively analyzed. The results are as follows: Figure 8 Display: ThyA - / - The number of EcN engineered bacteria did not change significantly within 8 hours, but then gradually decreased and died, proving that the constructed engineered bacteria can maintain activity for a certain period of time when lacking specific nutrients, but will gradually die, thus achieving the purpose of constructing nutrient-deficient engineered bacteria and preventing excessive proliferation of EcN.
[0181] Example 2
[0182] EcN and ThyA - / - In vivo efficacy evaluation and mechanism study of EcN engineered bacteria in promoting diabetic ulcer healing
[0183] I. In vivo evaluation of EcN intervention in diabetic ulcers and analysis of wound microbiota
[0184] 1. EcN intervention in in vivo animal experiments of diabetic ulcers
[0185] A full-thickness skin defect model of diabetic ulcer was constructed. Twelve DB / DB mice were acclimatized for one week, then anesthetized with isoflurane. The fur on the backs of the mice was removed, and a 1 cm × 1 cm area was marked. Skin and subcutaneous tissue were excised along the marked line down to the fascia layer. After surgery, saline was injected intraperitoneally to prevent dehydration caused by model construction. After model construction, the mice were randomly divided into a control group and an EcN group (10...). 6 CFU / ml, 10 µl); all groups were given the above drug dosage once after the wound model was completed.
[0186] Animal experiments have yielded the following conclusions ( Figure 1 A): Compared with the blank group, the EcN group showed some activity in the early stage, specifically a reduction in inflammatory exudation on the 3rd day. However, in the later stage of drug administration, the wound showed severe ulceration and difficulty in healing.
[0187] 2. 16SRNA detection of EcN intervention in the abundance of microbial flora in diabetic ulcer wounds
[0188] Wound healing rate was observed on day 3 of intervention. Wound microbiota was collected using cotton swabs, and total genomic DNA was extracted and quality tested. Next, the hypervariable region (V3-V4 region) of the 16S rRNA gene was selected and amplified by PCR using barcode-protected primers to enrich the target fragment. After purification, the amplified products were mixed in equal volumes to construct a library, which was then subjected to high-throughput sequencing using the Illumina platform. Finally, bioinformatics analysis was performed on the sequencing data: after quality control and noise reduction, ASVs (amplifier sequence variants) were generated and annotated. The microbiota structure was assessed, and statistical methods such as LEfSe were used to screen for marker microorganisms with significant intergroup differences, ultimately elucidating the specific impact of diabetes on the wound microbiota.
[0189] 16sRNA results showed that in the EcN group, EcN had become the dominant bacterial species in the wound microbiota, indicating a disruption of diversity (e.g., Figure 1 B). Although EcN is a probiotic, if the amount of probiotics added exceeds the threshold that the wound flora can tolerate, it will also disrupt the wound healing microenvironment, thereby further aggravating the difficulty in healing diabetic ulcers. The difficulty in healing wound ulceration may be related to the excessive proliferation of this probiotic.
[0190] II. In vivo evaluation of EcN intervention in diabetic ulcers and analysis of wound microbiota
[0191] 1. ThyA - / - - Screening for optimal in vivo concentrations of EcN engineered bacteria
[0192] A full-thickness skin defect model was constructed using 18 Balb / c mice that were acclimatized for one week. Following this, the mice were anesthetized with isoflurane, and the hair on their backs was removed. A 1 cm × 1 cm area was marked, and the skin and subcutaneous tissue were excised along the marked line down to the fascia layer. After surgery, saline was injected intraperitoneally to prevent dehydration caused by model construction. After model construction, the mice were randomly divided into a control group (saline, 10 µl) and a ThyA group. - / - -EcN engineered microbial group (10 4 CFU / ml, 10 µl), ThyA - / - -EcN engineered microbial group (10 6 CFU / ml (10 µl) is added to the wound at the indicated concentration. After covering with oil sand, it can be fixed with IV3000.
[0193] The results were obtained based on the wound healing rate. Figure 9 ): ThyA - / - -EcN engineered bacteria caused no ulceration in the wound after in vivo intervention, and within 10 6 CFU / ml has certain healing-promoting activity, so this concentration was chosen for subsequent experiments.
[0194] 2. ThyA - / - -EcN engineered bacteria wound colonization investigation
[0195] Wound healing rate was observed on day 3 after intervention. Simultaneously, wound flora was scraped from the wound with a cotton swab and inoculated onto LB solid conditioned medium containing chloramphenicol and kanamycin. The culture was incubated at 37°C for 24 h, and ThyA was observed. - / - -EcN engineered bacteria colonization quantity, results as follows Figure 10 Display: 10 6 CFU / ml ThyA - / - -EcN engineered bacteria can colonize wounds.
[0196] 3. ThyA - / - -Efficacy and safety evaluation of EcN engineered bacteria in the treatment of diabetic ulcers
[0197] A full-thickness skin defect model of diabetic ulcer was constructed. Eighteen DB / DB mice were acclimatized for one week, then anesthetized with isoflurane. The fur on the backs of the mice was removed, and a 1 cm × 1 cm area was marked. Skin and subcutaneous tissue were excised along the marked line down to the fascia layer. After surgery, saline was injected intraperitoneally to prevent dehydration caused by model construction. After model construction, the mice were randomly divided into a control group and a ThyA group. - / - -EcN engineered microbial group (10 6CFU / ml, 10 µl), positive control group (SyBio / ON101, 100 µg / ml, 100 µl); all groups were administered the above drug dosage once on day 0 after the wound model was completed, and the blank group and ThyA were administered at subsequent time points. - / - - An equal volume of physiological saline was added to the EcN engineered bacteria group, while the positive control group was given Subiyi (100 µg / ml, 100 µl).
[0198] Pharmacodynamic experiments have drawn conclusions ( Figure 11 Compared with the blank group, ThyA - / - -EcN engineered bacteria exhibit significant healing-promoting activity, with marked effects on days 3 and 5, suggesting that ThyA - / - -EcN engineered bacteria can regulate the inflammatory retention problem of diabetic ulcers. At the same time, compared with the control group, the mice did not have significant changes in body weight and no ulceration of the wounds during the drug intervention period.
[0199] Furthermore, the results of the detection of liver and kidney function and myocardial enzyme spectrum biochemical indicators in mice are shown in Tables 16-18. (ThyA) - / - The mice showed no obvious abnormalities after intervention with the EcN engineered bacteria, indicating that it is safe in vivo.
[0200]
[0201] 4. Flow cytometry analysis of the number of M1 / 2 positive macrophage cells in the skin wound on day 7.
[0202] 4.1 Preparation of single-cell suspension for skin wounds
[0203] Sampling: After inhalation anesthesia, mice were fixed at the back. Using sterile fine scissors and forceps, the wound tissue, including the wound bed and approximately 2-3 mm of surrounding marginal tissue, was completely excised. The tissue was quickly placed into pre-cooled DMEM culture dishes containing complete culture medium and stored at 4°C.
[0204] Enzymatic digestion: Transfer the skin tissue to a centrifuge tube containing a small amount of pre-chilled PBS, mince the tissue with scissors, add a mixture of enzymes (Collagenase IV 1 mg / ml, Dispase 1 mg / ml, DNase I 50 ug / ml) and place in a 37°C constant temperature shaker for 45 minutes at 200 rpm.
[0205] Termination of digestion and preparation of cell suspension: Immediately after digestion, add an equal volume of pre-cooled DMEM containing serum (2%) to terminate the reaction. Use a 1 mL pipette tip (the tip can be cut off to enlarge the pore size) to repeatedly pipette the tissue digestion solution 10 times. Filter the cell suspension through a 70 μm cell sieve into a new 50 mL centrifuge tube (using a syringe sieve tip to press). Rinse the original centrifuge tube and cell sieve for any remaining cells with washing buffer. Centrifuge the filtrate at 4°C, 300-400 × g for 5 minutes, discard the supernatant, resuspend the cells with an appropriate amount of washing buffer, and pass the suspension through a 40 μm cell sieve again to obtain a mouse skin single-cell suspension for cell counting.
[0206] 4.2 Flow cytometry staining
[0207] Live / dead staining and blocking: Add live / dead stain (1 µg / million) to the mouse skin single-cell suspension prepared above, and stain for 15 min in the dark; add washing buffer, centrifuge, and discard the supernatant. Add an appropriate amount of Fc receptor blocker, incubate at room temperature in the dark for 10 min to reduce non-specific staining, centrifuge, and discard the supernatant;
[0208] Surface antibody staining: Add the pre-titrated concentration of fluorescently labeled surface antibody mixture, vortex to mix, incubate at 4°C in the dark for 30 minutes, centrifuge, and discard the supernatant;
[0209] Washing and fixation: Add 2 mL of washing buffer, centrifuge at 300 × g for 5 minutes at 4°C, discard the supernatant, and repeat the washing once. Resuspend the cells in permeabilization and fixation buffer, incubate at room temperature in the dark for 15 minutes, centrifuge, discard the supernatant, wash once with washing buffer; add CD206 antibody, incubate at 4°C in the dark for 30 minutes, wash, and centrifuge.
[0210] Instrumentation: Resuspend cells in PBS, transfer the stained cell suspension to flow cytometry tubes, and prepare for instrumentation.
[0211] Data acquisition: First, unstained cells and single-positive antibody control samples were loaded for voltage adjustment and compensation. All experimental samples were then collected.
[0212] Flow cytometry analysis of M1 / 2 macrophages in mouse wound tissue showed that the drug-treated group reduced CD86 levels. + Increased macrophage number, CD206 + The number of macrophages indicates ThyA - / - -EcN engineered bacteria can effectively reverse the cytokine storm in diabetic ulcers (such as...) Figure 12 ).
[0213] 5. ThyA - / - -EcN engineered bacteria regulate macrophage polarization
[0214] 10% fetal bovine serum (filtered) and 1% penicillin-streptomycin were added to DMEM basal medium for Raw264.7 cell culture. The entire preparation process was performed in a sterile cell culture bench. Raw264.7 cells in logarithmic growth phase were taken and the cell concentration was adjusted to 1×10⁻⁶ cells. 6 / well, seeded into 12-well plates, with experimental groups set up as follows: blank group, blank group + thymidine group (dT 500 ng / ml), model group (LPS 250 ng / ml), EcN supernatant group (1% v / v), ThyA - / - -EcN engineered bacteria supernatant group (1% v / v) and curcumin group (Cur, 6 µg / mL), relevant cell samples were collected 24 h after intervention for subsequent experiments.
[0215] PCR results as follows Figure 13 The results showed no difference between the blank group and the dT group (thymidine group), indicating that thymidine has no effect on macrophage polarization. Compared with the blank group, the mRNA expression levels of TNF-α, IL-1β, and iNOS were significantly increased in the LPS group, and the mRNA expression levels of Arg-1, IL-10, and Ym-1 were significantly increased in the IL-4 group, indicating successful cell model construction. Simultaneously, compared with the LPS model group, the expression levels of LPS+EcN and LPS+ThyA were significantly increased. - / - Both the EcN engineered bacteria and curcumin groups reduced the mRNA levels of TNF-α, IL-1β, and iNOS; compared with the blank group, EcN and ThyA... - / - - The EcN engineered bacterial group could increase the mRNA levels of Arg-1, IL-10, and Ym-1, among which EcN and ThyA... - / - There was no significant difference between the two groups of EcN engineered bacteria, indicating that knocking out the ThyA gene in EcN does not affect its function in regulating macrophage polarization.
[0216] Furthermore, the results are as follows Figure 14 and 15 The results showed that, compared with the control group, the expression level of CD86 in the LPS group was significantly increased, and the expression level of CD206 in the IL-4 group was significantly increased, indicating that the cell model was successfully constructed. LPS can promote the transformation of macrophages into pro-inflammatory M1 cells. Simultaneously, compared with the control group, EcN and ThyA expression levels were significantly increased. - / - -EcN engineered bacteria groups can all reduce CD86 expression levels, including EcN and ThyA. - / - There was no significant difference between the two groups of EcN engineered bacteria; IL-4 could promote the transformation of macrophages into anti-inflammatory M2 cells. Meanwhile, compared with the control group, EcN and ThyA... - / -The increased CD206 expression level in the EcN engineered bacterial groups indicates that knocking out the ThyA gene in EcN does not affect its function in regulating macrophage polarization, a result consistent with PCR results.
[0217] 6. ThyA - / - - Inhibitory effect of EcN engineered bacteria on Staphylococcus aureus
[0218] Pick Thy A - / - EcN engineered bacteria and SA single colonies (wild-type Staphylococcus aureus) were inoculated into LB (with 500 ng / ml thymine added) and ordinary LB liquid medium, respectively, and cultured on a shaker (200 rpm) at 28°C. After 24 h of culture, ThyA - / - -EcN engineered bacteria suspension and SA bacterial suspension, after being compared to the Maxwell turbidity, were diluted with sterile physiological saline to 0.5 Maxwell turbidity (at which point the concentration was 1.5 × 10⁻⁶). 8 CFU / mL). Add equal volumes of bacterial suspensions of different concentrations and co-culture (10). 8 CFU / mL ThyA - / - -EcN engineered bacteria + 10 8 CFU / mL SA, 10 6 CFU / mL ThyA - / - -EcN engineered bacteria + 10 8 CFU / mL SA, 10 4 CFU / mLThyA - / - -EcN engineered bacteria + 10 8 CFU / mL SA, 1.5×10 8 (CFU / mL SA), take the culture medium of each treatment group and blank control, dilute it with sterile physiological saline to an appropriate multiple, and then pipette evenly. Take 100 μl of bacterial solution and spread it on Baird-Parker solid medium. After spreading, incubate at 28℃ for 24 h until SA colonies grow and count them.
[0219] ThyA - / - -After co-culturing EcN engineered bacteria with SA, the results of plating are as follows: Figure 16 The results showed that engineered bacteria at different concentrations all inhibited Staphylococcus aureus in a concentration-dependent manner.
[0220] In summary, this invention successfully constructed an EcN engineered bacterium with the ThyA gene knocked out. This engineered bacterium cleverly achieved self-limitation of its colonization. It inherits the beneficial vitality of wild-type EcN to promote healing, while avoiding the risks of dysbiosis and biofilm formation caused by excessive proliferation, ultimately demonstrating a safe and effective therapeutic prospect in a diabetic ulcer model.
Claims
1. An engineered probiotic for promoting wound healing, characterized in that, The engineered probiotic was obtained by knocking out the ThyA gene from Escherichia coli Nissle 1917 (EcN), and the nucleotide sequence of the ThyA gene is shown in SEQ ID NO.
1.
2. The engineered probiotic for promoting wound healing according to claim 1, characterized in that, Using the pV4N20 and pRedcas9 dual plasmid system in the CRISPR-Cas9 system, the thymine synthase ThyA gene in the EcN genome was knocked out, resulting in a auxotrophic strain (ThyA). - / - -EcN engineered bacteria).
3. A method for constructing engineered probiotics for promoting wound healing as described in claim 1, characterized in that, Includes the following steps: (1) sgRNA design: Design the sgRNA sequence of the ThyA gene, and design primers with homologous arms of the sgRNA of the ThyA gene for subsequent linearization; (2) Construction of PV4n20 plasmid: Using the extracted EcN genome as a template, TupF and TupR were used as primers to amplify fragment 1, and TdownF and TdownR were used as primers to amplify fragment 2; using the extracted PV4 plasmid as a template, PV4F and PV4R were used as primers to amplify fragment 3; fragments 1-3 were recombined to obtain PV4 plasmid containing homologous arms up and down; using PV4 plasmid containing homologous arms up and down as a template, ThyAF and TupR were used as primers to amplify fragment 4, and ThyAR and TdownF were used as primers to amplify fragment 5, and fragments 4-5 were recombined to obtain PV4n20 plasmid; (3) Electroporation: The constructed pV4N20 plasmid and pRedCas9 plasmid were transformed into EcN competent cells; (4) Screening for positive clones: Spread the revived bacterial culture onto plates containing chloramphenicol and kanamycin and culture it; (5) Induction and knockout: Select a single clone and induce culture overnight, then dilute the overnight bacterial culture, spread it and continue to induce culture overnight; (6) Verification: Plasmids and genomes were extracted after single colony culture. PCR verification was performed using TupF and TdownR, PV4F and PV4R, pCasF and pCasR as primers to obtain engineered probiotics for promoting wound healing.
4. The method for constructing engineered probiotics for promoting wound healing according to claim 3, characterized in that, The target sequence in step (1) is: GTTTACCATACACTGGCCCG.
5. The method for constructing engineered probiotics for promoting wound healing according to claim 3, characterized in that, The primers: TupF:AACTTCGGCAGCGGACGCGG TupR: ATGAAAACGGCGACCTAGTGGCGCGCCTGGCCAA TdownF:CACTAGGTCGCCGTTTTCATCGG TdownR:AGTTTACTGGTGCCTGGGTGC ThyAF: CCGGACTATTTACGCCGTTG ThyAR: GCCTGGGTGCAGTACATCAG Pv4F: GCACCCAGGCACCAGTAAACTGTGCGCCATGAGAACGAACC PV4R: CCGCGTCCGCTGCCGAAGTTACCGCTGGCTAAATACGGAA pCasF:ATGGATATAAGAAATACTCAAT pCasR:TCAGTCACCTCCTAGCTGAC.
6. The use of the engineered probiotic of claim 1 in the preparation of a drug for promoting wound healing or regulating the wound immune microenvironment.
7. The application according to claim 6, characterized in that, The wound is a diabetic ulcer.
8. The application according to claim 6, characterized in that, The regulation of the wound immune microenvironment includes promoting macrophage polarization toward the M2 anti-inflammatory phenotype.
9. A pharmaceutical composition for promoting wound healing or regulating the wound immune microenvironment, characterized in that, It includes the engineered probiotics as described in claim 1, as well as a pharmaceutically acceptable carrier or excipient.
10. The application of the ThyA gene in regulating EcN to promote wound healing or modulating the wound immune microenvironment, wherein the nucleotide sequence of the ThyA gene is shown in SEQ ID NO.
1.
11. The application according to claim 10, characterized in that, The ThyA gene controls EcN growth and can be further used to promote wound healing or modulate the wound immune microenvironment.