Induction media and methods for stem cell culture and therapy
By using induction medium containing TLR3 ligand, erythropoietin, and hypoxia mimicry, the phenotype of mesenchymal stem cells was regulated, solving the problem of inconsistent induction and activation of MSC populations in treatment in existing technologies, and achieving effective therapeutic effects in different disease models.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SANBIO INC
- Filing Date
- 2015-09-24
- Publication Date
- 2026-06-02
AI Technical Summary
Existing technologies struggle to provide a reproducible method for inducing, activating, or triggering a homogeneous population of mesenchymal stem cells to selectively promote or suppress inflammatory and immune responses, thereby achieving consistent and predictable therapeutic effects in cell-based therapies.
By using an induction medium containing Toll-like receptor 3 (TLR3) ligand, erythropoietin, and hypoxia mimicry, the phenotype of mesenchymal stem cells was regulated to induce anti-inflammatory or pro-inflammatory properties, thereby achieving immune polarization of the MSC population.
It achieves uniform induction and activation of MSC populations in cell-based therapies, providing significant therapeutic advantages, such as reducing pain and inflammation in disease models of rheumatoid arthritis, inflammatory bowel disease, and acute lung injury, or inhibiting tumor growth and spread in ovarian cancer models.
Smart Images

Figure CN122128229A_ABST
Abstract
Description
[0001] This application is a divisional application of Chinese invention patent application No. 201580065072.7. Technical Field
[0002] This application relates to induction culture media and methods for stem cell culture and therapy.
[0003] This invention was carried out with the support of the U.S. government, through NIH 1R43AR061902-01 and 1P20RR20152-01 and Department of Defense OC073102 and OC110218. The U.S. government holds certain rights to this invention. Background Technology
[0004] Stimulation of specific Toll-like receptors (TLRs) affects the immunomodulatory response of MSCs. Toll-like receptors recognize “danger” signals, and their activation leads to significant cellular and systemic responses that mobilize innate and adaptive host immune cells. Danger signals that trigger TLRs are released after most histopathological events.
[0005] Erythropoietin, also known as EPO, is a glycoprotein hormone that controls the production of red blood cells. It is a cytokine or cell signaling molecule that is a precursor to red blood cells (erythrocytes) in the bone marrow.
[0006] A consistent oxygen supply is a critical factor affecting all major aspects of cell biology, including survival, proliferation, differentiation, and migration. Normally, mammalian cells (non-stem cells) require a consistent oxygen supply to maintain robust energy production and preserve normal cellular function and survival. Conversely, mammalian stem cells demonstrate growth and survival in the hypoxic environment of bone marrow (oxygen content ranging from 0.5% to 7%). Summary of the Invention
[0007] This invention provides novel stem cell culture and treatment methods, as well as culture medium compositions, aimed at inducing, activating, or triggering discrete, homogeneous cell phenotypes to selectively promote or suppress inflammation and immunity, thereby providing significant advantages over known culture media and methods used in cell-based therapies. This invention can be used to provide more homogeneous and predictable ex vivo expanded and induced, triggered, or activated mesenchymal stem cell (MSC) populations for use in cell-based therapies. There has long been a need in the art for an improved method to provide homogeneous and efficient large quantities of stem cells required for cell-based therapies. An advantage of the various embodiments of this invention is that they can be used to induce, activate, or trigger cultures of mesenchymal stem cells into homogeneous and discrete phenotypes that are expressed in a predictable manner upon introduction into patients.
[0008] In some embodiments, this document discloses an induction medium for generating an immune-polarized mesenchymal stem cell population from an unstimulated mesenchymal stem cell population, the induction medium comprising: a Toll-like receptor 3 (TLR3) ligand, erythropoietin, and 0.5-2% oxygen or hypoxia mimetic, wherein the immune-polarized mesenchymal stem cell population possesses anti-inflammatory properties marked by the expression of anti-inflammatory or immunosuppressive mediators. In some embodiments, the Toll-like receptor 3 (TLR3) ligand is poly(I:C). In some embodiments, the Toll-like receptor 3 (TLR3) ligand is poly(A:U). In some embodiments, erythropoietin is present at a concentration of less than 10 ng / mL. In some embodiments, the hypoxia mimetic is cobalt chloride. In some embodiments, the cobalt chloride is present at a concentration of 5 μM to 500 μM. In some embodiments, the induction medium further comprises interleukin-4 (IL-4). In some embodiments, the induction medium further comprises interleukin-13 (IL-13). In some embodiments, the induction medium does not contain serum of human or animal origin. In some embodiments, the induction medium is a concentrate. In some embodiments, mesenchymal stem cell populations treated with the induction medium are disclosed herein. In some embodiments, human mesenchymal stem cell populations treated with the induction medium are disclosed herein. In some embodiments, canine, cat, or horse mesenchymal stem cell populations treated with the induction medium are disclosed herein. In some embodiments, mesenchymal stem cell populations treated with the induction medium are disclosed herein. In some embodiments, mesenchymal stem cell populations treated with the induction medium are disclosed herein, wherein the cells increase by a certain percentage compared to an unstimulated mesenchymal stem cell population. CXCL9 mRNA expression is used as a marker. In some embodiments, this document discloses a population of mesenchymal stem cells treated with this induction medium, wherein the cells increase in number compared to an unstimulated population of mesenchymal stem cells. OAS1 mRNA expression is used as a marker. In some embodiments, this document discloses a population of mesenchymal stem cells treated with this induction medium, wherein the cells increase in number compared to an unstimulated population of mesenchymal stem cells. ISG15mRNA expression is used as a marker. In some embodiments, this document discloses compositions for treating diseases comprising a population of mesenchymal stem cells treated with the induction medium, wherein the disease is an inflammatory or autoimmune condition. In some embodiments, the inflammatory or autoimmune condition is rheumatoid arthritis. In some embodiments, the inflammatory or autoimmune condition is inflammatory bowel disease. In some embodiments, the inflammatory or autoimmune condition is acute optic neuritis. In some embodiments, the inflammatory or autoimmune condition is Krabbe disease. In some embodiments, the inflammatory or autoimmune condition is diabetic retinopathy. In some embodiments, the inflammatory or autoimmune condition is Crohn's disease. In some embodiments, the inflammatory or autoimmune condition is acute lung injury.
[0009] In some embodiments, this document discloses an induction medium for generating an immune-polarized mesenchymal stem cell population from an unstimulated mesenchymal stem cell population, the induction medium comprising: a Toll-like receptor 4 (TLR4) ligand, erythropoietin, and 0.5-2% oxygen or hypoxia mimic, wherein the immune-polarized mesenchymal stem cell population has pro-inflammatory properties marked by the expression of pro-inflammatory mediators. In some embodiments, the Toll-like receptor 4 (TLR4) ligand is lipopolysaccharide (LPS). In some embodiments, the Toll-like receptor 4 (TLR4) ligand is aminoalkylaminoglucosidase 4-phosphate. In some embodiments, erythropoietin is present at a concentration of less than 10 ng / mL. In some embodiments, the hypoxia mimic is cobalt chloride. In some embodiments, the cobalt chloride is present at a concentration of 5 μM to 500 μM. In some embodiments, the induction medium further comprises interferon. In some embodiments, the induction medium further comprises tumor necrosis factor α (TNFα). In some embodiments, the induction medium does not contain serum of human or animal origin. In some embodiments, the induction medium is a concentrate. In some embodiments, mesenchymal stem cell populations treated with the induction medium are disclosed herein. In some embodiments, human mesenchymal stem cell populations treated with the induction medium are disclosed herein. In some embodiments, canine, cat, or horse mesenchymal stem cell populations treated with the induction medium are disclosed herein. In some embodiments, mesenchymal stem cell populations treated with the induction medium are disclosed herein, wherein the mesenchymal stem cells are derived from pluripotent stem cells. In some embodiments, mesenchymal stem cell populations treated with the induction medium are disclosed herein, wherein the cells increase by a certain percentage compared to an unstimulated mesenchymal stem cell population. TNFSF10 (TRAIL)mRNA expression is used as a marker. In some embodiments, this document discloses compositions for treating diseases comprising a population of mesenchymal stem cells treated with the induction medium, wherein the disease is cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is uveal melanoma. In some embodiments, this document discloses compositions for treating diseases comprising a population of mesenchymal stem cells treated with the induction medium, wherein the disease is a viral condition. In some embodiments, this document discloses compositions for treating diseases comprising a population of mesenchymal stem cells treated with the induction medium, wherein the disease is a bacterial infection.
[0010] In some embodiments, this document discloses an induction medium for generating an immune-polarized mesenchymal stem cell population from an unstimulated mesenchymal stem cell population, the induction medium comprising: poly(I:C) at a concentration of 0.1 μg / mL to 100 μg / mL, erythropoietin at a concentration of less than 10 ng / mL, and cobalt chloride at a concentration of 5 μM to 500 μM, wherein the immune-polarized mesenchymal stem cell population possesses anti-inflammatory properties and is increased compared to an unstimulated mesenchymal stem cell population. CXCL9 , OAS1 and ISG15 mRNA expression is used as a marker.
[0011] In some embodiments, this document discloses an induction medium for generating an immune-polarized mesenchymal stem cell population from an unstimulated mesenchymal stem cell population, the induction medium comprising: LPS at a concentration of 0.1 ng / mL to 1 μg / mL, erythropoietin at a concentration of less than 10 ng / mL, and cobalt chloride at a concentration of 5 μM to 500 μM, wherein the immune-polarized mesenchymal stem cell population has pro-inflammatory properties and is increased compared to an unstimulated mesenchymal stem cell population. TNFSF10 (TRAIL) The expression is a sign.
[0012] In some embodiments, this document discloses a method for generating an immune-polarized mesenchymal stem cell population from an unstimulated mesenchymal stem cell population, the method comprising contacting the unstimulated mesenchymal stem cell population with a composition comprising: a Toll-like receptor 3 (TLR3) ligand, erythropoietin, and hypoxia or a hypoxia mimic, wherein the immune-polarized mesenchymal stem cell population has anti-inflammatory properties characterized by the expression of anti-inflammatory or immunosuppressive mediators. In some embodiments, the TLR3 ligand is poly(I:C). In some embodiments, the TLR3 ligand is poly(A:U). In some embodiments, the erythropoietin is present at a concentration of less than 10 ng / mL. In some embodiments, the hypoxia mimic is cobalt chloride. In some embodiments, the cobalt chloride is present at a concentration of 5 μM to 500 μM. In some embodiments, the composition further comprises interleukin-4 (IL-4). In some embodiments, the composition further comprises interleukin-13 (IL-13). In some embodiments, the composition does not contain serum of human or animal origin. In some embodiments, the composition is a concentrate. In some embodiments, the unstimulated mesenchymal stem cell population is simultaneously contacted with Toll-like receptor 3 ligand, erythropoietin, and hypoxia or a hypoxia mimic. In some embodiments, the composition is contacted with the unstimulated mesenchymal stem cell population for at least 30 minutes but less than 8 hours. In some embodiments, the method further includes monitoring at the RNA or protein level. CXCL9 The expression of [the protein / protein]. In some embodiments, the method further includes monitoring [the expression of the protein / protein]. OAS1 The expression of [the protein / protein]. In some embodiments, the method further includes monitoring [the expression of the protein / protein]. ISG15 The expression is as follows. In some embodiments, this document provides a population of mesenchymal stem cells treated by this method. In some embodiments, this document provides a population of human mesenchymal stem cells treated by this method. In some embodiments, this document provides a population of canine, cat, or horse mesenchymal stem cells treated by this method. In some embodiments, this document provides a population of mesenchymal stem cells treated by this method wherein the mesenchymal stem cells are derived from pluripotent stem cells. In some embodiments, this document provides a population of mesenchymal stem cells treated by this method wherein the cells increase by a certain percentage compared to an unstimulated population of mesenchymal stem cells. CXCL9 mRNA expression is used as a marker. In some embodiments, this document provides a population of mesenchymal stem cells treated by this method, wherein the cells increase in number compared to an unstimulated population of mesenchymal stem cells. OAS1 mRNA expression is used as a marker. In some embodiments, this document provides a population of mesenchymal stem cells treated by this method, wherein the cells increase in number compared to an unstimulated population of mesenchymal stem cells. ISG15 mRNA expression is used as a marker. In some embodiments, this document provides compositions comprising a population of mesenchymal stem cells treated by this method for treating diseases, wherein the disease is an inflammatory or autoimmune condition. In some embodiments, the inflammatory or autoimmune condition is rheumatoid arthritis. In some embodiments, the inflammatory or autoimmune condition is inflammatory bowel disease. In some embodiments, the inflammatory or autoimmune condition is acute optic neuritis. In some embodiments, the inflammatory or autoimmune condition is Krabby's disease. In some embodiments, the inflammatory or autoimmune condition is diabetic retinopathy. In some embodiments, the inflammatory or autoimmune condition is Crohn's disease. In some embodiments, the inflammatory or autoimmune condition is acute lung injury.
[0013] In some embodiments, this document discloses a method for generating an immune-polarized mesenchymal stem cell population from an unstimulated mesenchymal stem cell population, the method comprising contacting the unstimulated mesenchymal stem cell population with a composition comprising: a Toll-like receptor 4 (TLR4) ligand, erythropoietin, and hypoxia or a hypoxia mimic, wherein the immune-polarized mesenchymal stem cell population has pro-inflammatory properties characterized by the expression of pro-inflammatory or immunosuppressive mediators. In some embodiments, the TLR4 ligand is lipopolysaccharide (LPS). In some embodiments, the TLR4 ligand is aminoalkylglucosinolate 4-phosphate. In some embodiments, erythropoietin is present at a concentration of 1 ng / mL. In some embodiments, the hypoxia mimic is cobalt chloride. In some embodiments, the cobalt chloride is present at a concentration of 5 μM to 500 μM. In some embodiments, the composition further comprises interferon. In some embodiments, the composition further comprises tumor necrosis factor α (TNFα). In some embodiments, the composition does not contain serum of human or animal origin. In some embodiments, the composition is a concentrate. In some embodiments, the unstimulated mesenchymal stem cell population is simultaneously contacted with Toll-like receptor 4 ligand, erythropoietin, and hypoxia or a hypoxia mimic. In some embodiments, the composition is contacted with the unstimulated mesenchymal stem cell population for at least 30 minutes but less than 8 hours. In some embodiments, the method further includes monitoring at the RNA or protein level. TNFSF10 (TRAIL)The expression is as follows. In some embodiments, this document provides a population of mesenchymal stem cells treated by this method. In some embodiments, this document provides a population of human mesenchymal stem cells treated by this method. In some embodiments, this document provides a population of canine, cat, or horse mesenchymal stem cells treated by this method. In some embodiments, this document provides a population of mesenchymal stem cells treated by this method wherein the mesenchymal stem cells are derived from pluripotent stem cells. In some embodiments, this document provides a population of mesenchymal stem cells treated by this method wherein the cells increase by a certain percentage compared to an unstimulated population of mesenchymal stem cells. TNFSF10 (TRAIL) mRNA expression is used as a marker. In some embodiments, this document provides compositions for treating diseases comprising a population of mesenchymal stem cells treated by this method, wherein the disease is cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is uveal melanoma. In some embodiments, this document provides compositions for treating diseases comprising a population of mesenchymal stem cells treated by this method, wherein the disease is a viral condition. In some embodiments, this document provides compositions for treating diseases comprising a population of mesenchymal stem cells treated by this method, wherein the disease is a bacterial infection.
[0014] The utility of invention
[0015] Improved therapeutic approaches and cell culture methods, along with appropriate culture media, are needed for inducing, activating, or triggering homogeneous MSC populations derived from various adult tissues—stem cells, mesenchymal stem cells, bone marrow stromal cells, pluripotent stromal cells, and pluripotent stem cells. The clinical application of MSCs requires reproducible cell culture and expansion methods that deliver sufficient quantities of cells of suitable quality and consistent therapeutic benefit. Different culture media and methods have achieved varying degrees of success. Further improvements to MSC culture media and methods are still needed to ensure expanded yields of induced, activated, or triggered cells for use in cell-based therapies with safe and consistently reproducible therapeutic effects.
[0016] The efficacy or therapeutic benefit of induced, activated, or provoked MSCs relative to uninduced conventional MSCs has been demonstrated in preclinical models of diseases. Anti-inflammatory induced MSC therapy alleviates pain and inflammation in models of diabetic peripheral neuropathy, rheumatoid arthritis, inflammatory bowel disease, and acute lung injury in a significantly improved manner compared to conventional MSC therapy. Furthermore, anti-inflammatory induced MSC therapy improves clinical scores, gait, and motor function in preclinical models of multiple sclerosis (EAE) and Krabby's disease. In a murine immunomodulatory ovarian cancer model, immunotherapy based on pro-immunotumor induced MSC cells leads to attenuated tumor growth and spread, while conventional MSC therapy promotes tumor growth and spread.
[0017] Scientific basis of the invention
[0018] Stimulation of specific Toll-like receptors (TLRs) influences the immunomodulatory response of MSCs. Toll-like receptors recognize “danger” signals, and their activation leads to significant cellular and systemic responses that mobilize innate and adaptive host immune cells. Danger signals that trigger TLRs are released after most histopathological events. Because danger signals recruit immune cells to the site of injury, the inventors inferred that MSCs might be recruited in a similar manner. The inventors observed that MSCs express several TLRs (e.g., TLR3 and TLR4, known in the art), and that their migration, invasion, and secretion of immunomodulatory factors are strongly influenced by specific TLR-agonists. In particular, the inventors observed a variety of consequences for MSCs following stimulation of TLR3 (when compared to TLR4) with a low-level, short-term TLR-initiating protocol. Based on these findings, the inventors propose a new paradigm of MSCs that draws clues from the monocyte literature. Specifically, this MSC can be polarized (induced, activated, or initiated) by downstream TLRs signaling two homologous phenotypes classified as MSC1 and MSC2. TLR4-induced MSCs or MSC1 predominantly express pro-immunoinflammatory mediators, while TLR3-induced MSCs or MSC2 predominantly express anti-inflammatory or immunosuppressive mediators. Furthermore, the inventors demonstrated that co-culturing TLR-induced MSCs with allogeneic (non-autologous) peripheral blood mononuclear cells (PBMCs) predictably leads to suppression of T lymphocyte activation after MSC2 co-culture and allows T lymphocyte activation upon co-culturing with MSC1. The induction of MSCs into a pro-immunoinflammatory MSC1 phenotype via TLR4 activation or an anti-inflammatory MSC2 phenotype via TLR3 activation ensures a consistent and well-defined cell profile, thus addressing an industry challenge by providing well-defined and predictable cells for cell-based therapeutic applications.
[0019] Erythropoietin, also known as EPO, is a glycoprotein hormone that controls the production of erythrocytes or red blood cells. It is a cytokine or cell signaling molecule that is a precursor to erythrocytes (red blood cells) in the bone marrow. Human EPO has a molecular weight of 34 kDa and is also known as erythropoietin or erythropoietin. EPO is produced by interstitial fibroblasts in the kidneys, which are closely associated with peritubular capillaries and tubular epithelial tubules, and by perisinusoidal cells in the liver. While liver production is dominant in early development (fetal and perinatal periods), the kidneys are the primary site of EPO production in adulthood. In addition to erythropoiesis, erythropoietin has other known biological functions. For example, it plays an important role in the brain's response to neuronal damage by providing pro-survival and anti-apoptotic (programmed cell death) signals. EPO is also involved in wound healing. Synthetic erythropoietin is also produced in cell cultures using recombinant DNA technology. Furthermore, several different EPO-like drugs with various glycosylation patterns exist and are collectively referred to as erythropoiesis stimulants (ESAs). EPO is used in this invention as a means to prevent premature cell death and prolong the survival of generated, activated, or induced cells used in cell-based therapies.
[0020] Consistent oxygen supply is a crucial factor influencing all major aspects of cell biology, including survival, proliferation, differentiation, and migration. Typically, mammalian cells (non-stem cells) require a consistent oxygen supply to maintain robust energy production and preserve normal cellular function and survival. Conversely, mammalian stem cells demonstrate growth and survival in the hypoxic environment of bone marrow (oxygen content ranging from 0.5% to 7%). Several studies have shown that a hypoxic environment is necessary to maintain the proliferative and self-renewal capacity of stem cells in the bone marrow. In particular, even after short-term culture of MSCs, the role of reducing oxygen content has been described as a general approach to improving their transplantability in cell-based therapies. In this invention, a hypoxic environment is used as a means to maintain the self-renewal and proliferative potential of cells generated, activated, or induced for use in cell-based therapies.
[0021] Definition and preferred values
[0022] For clarity, terms are defined and preferred values are emphasized here and elsewhere in this document as necessary.
[0023] The term "cancer" refers to any disease caused by the uncontrolled division of cells in a part of the body. Cancer includes, but is not limited to, leukemia, lymphoma, melanoma, carcinoma, sarcoma, adenoma, or any other malignant tumor or tumor caused by genetic, environmental, or random mechanisms.
[0024] The term "stem cell" refers to cells capable of producing a variety of different cell types. The term "mesenchymal stem cell" or "MSC" refers to stem cells originally derived from mesenchyme. This term refers to cells capable of differentiating into at least two or more of the following: osteoblasts, chondrocytes, adipocytes, or myocytes. MSCs can be isolated from any type of adult tissue. Typically, MSCs are isolated from bone marrow, adipose tissue, umbilical cord, or peripheral blood. In a preferred aspect of the invention, MSCs are obtained from bone marrow or from fat aspirates (which are derived from adipose tissue itself).
[0025] The term "pluripotent" and the alternative term "multipotent" refer to cells capable of producing multiple cell types from different tissue lineages. The term "pluripotent" or "multipotent" also includes induced pluripotent stem cells or induced multipotent stem cells, or cells that have been induced into a pluripotent stage using any chemical or genetic method. In some embodiments, the pluripotent or multipotent stem cells of this disclosure are mesenchymal stem cells.
[0026] The cells disclosed herein are derived from any cell of any mammalian species, including humans, primates, dogs, cats, horses, cattle, goats, sheep, and pigs. These cells can be primary cells or immortalized cell lines.
[0027] The term “cell therapy” or “cell-based treatment” refers to the transplantation of human or animal cells to prevent, treat, or improve one or more symptoms associated with a disease or condition, such as, but not limited to, replacing or repairing damaged tissues or organs, modulating immune responses, and reducing inflammatory symptoms and cancer.
[0028] The term "subject" refers to an animal, preferably including non-primate (e.g., cattle, pigs, horses, cats, dogs, rats, or mice) or primate (e.g., monkeys or humans) mammals. In a preferred embodiment, the subject is a human.
[0029] The terms “treatment” and “treatment” when used directly with a patient or subject mean improvement of one or more symptoms associated with a condition, including but not limited to any cancer, any tumor or lesion, inflammatory condition, autoimmune disease or immune-mediated disease, including rejection of transplanted organs and tissues, wherein such improvement is achieved by administering immunomodulatory cells produced by the present invention or a pharmaceutical composition containing immunomodulatory cells produced by the present invention to a subject in need of such treatment.
[0030] The term "unstimulated" refers to a population of cells that has not been treated, polarized, or induced by the methods described in this disclosure. Fresh or frozen primary isolated mesenchymal stem cells are considered unstimulated. Cells previously treated with a compound or composition lacking at least one of Toll-like receptor ligand, erythropoietin, hypoxia, or a hypoxia mimic are considered unstimulated.
[0031] The term "repair" refers, when used directly to damaged tissue, to improving such damage through direct mechanisms such as the regeneration of damaged tissue, and through indirect mechanisms such as reducing inflammation to enable tissue formation.
[0032] "Allogeneic" refers to different individuals from the same species. Individuals are considered allogeneic when they have different genes at one or more loci. Conversely, "self" refers to individuals from the same individual.
[0033] The term "immune disease" refers to a condition in a subject characterized by damage to cells, tissues, and / or organs caused by the subject's immune response.
[0034] The term "autoimmune disease" refers to a condition in a subject characterized by damage to cells, tissues, and / or organs resulting from an immune response to the subject's own cells, tissues, and / or organs. Illustrative, non-limiting examples of autoimmune diseases that can be treated with the immunomodulatory cells generated by this invention include alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, adrenal autoimmune diseases, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune oophoritis and orchitis, autoimmune thrombocytopenic purpura, Behcet's disease, bullous pemphigoid, cardiomyopathy, and celiac sprue-dermatitis. Dermatitis, chronic fatigue immune dysfunction syndrome (CF1DS), chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, cicatricial pemphigoid, CREST syndrome, cold agglutinin disease, discoid lupus, spontaneous mixed cryoglobulinemia, fibromyalgia-fibromyositis, glomerulonephritis, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura (ITP), IgA neuropathy, juvenile arthritis, lichen planus, Meniere's disease, mixed connective tissue disease, multiple sclerosis, type 1 or immune-mediated diabetes mellitus, myasthenia gravis, pemphigus vulgaris, pernicious anemia, polyarteritis nodosa. Polychondritis, polyglandular syndrome, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, psoriatic arthritis, Raynaud's phenomenon, Reiter's syndrome, sarcoidosis, scleroderma, progressive systemic sclerosis, Sjögren's syndrome, Goodpassuia syndrome, stiff-person syndrome, systemic lupus erythematosus, lupus erythematosus, aortitis, temporal arteritis / giant cell arteritis, ulcerative colitis, uveitis, vasculitis such as herpetic dermatitis vasculitis, vitiligo, Wegener's granulomatosis, antiglomerular basement membrane disease, antiphospholipid syndrome, neurological autoimmune diseases, familial Mediterranean fever, Len-Iweala syndrome, sympathetic ophthalmia, polyendocrine disorders, psoriasis, etc.
[0035] "Immune disorders" include autoimmune diseases and immune-mediated inflammatory diseases.
[0036] "Immune-mediated inflammatory diseases" refers to any disease characterized by chronic or acute inflammation caused, associated with, or triggered by abnormal regulation of the normal immune response: for example, Crohn's disease, type 1 diabetes, rheumatoid arthritis, inflammatory bowel disease, psoriasis, psoriatic arthritis, ankylosing spondylitis, systemic lupus erythematosus, Hashimoto's disease, graft-versus-host disease, Sjögren's syndrome, pernicious anemia, Addison's disease, scleroderma, Goodpassuia syndrome, ulcerative colitis, autoimmune hemolytic anemia, infertility, myasthenia gravis, multiple sclerosis, Bazedo's disease, thrombocytopenic purpura, Guillain-Barré syndrome, allergic reactions, asthma, atopic diseases, arteriosclerosis, myocarditis, cardiomyopathy, glomerulonephritis, developmental anemia, and organ transplant rejection.
[0037] The term "immunomodulatory" refers to alterations, enhancements, suppression, or reductions in one or more biological activities of the immune system, including but not limited to downregulation of the immune response, increase of the immune response, and changes in the inflammatory state mediated by changes in cytokine profiles, cytotoxic activity, and antibody production levels and their effects on immunity and immune-related cells.
[0038] The term "inflammatory condition" refers to a condition in a subject characterized by inflammation, such as chronic inflammation. Illustrative, non-limiting examples of inflammatory conditions include, but are not limited to, acute optic neuritis, diabetic neuropathy, Krabby's disease, acute lung injury, Crohn's disease, celiac disease, rheumatoid arthritis (RA), inflammatory bowel disease (IBD), asthma, encephalitis, chronic obstructive pulmonary disease (COPD), inflammatory osteolysis, allergic conditions, septic shock, pulmonary fibrosis (e.g., idiopathic pulmonary fibrosis), vacultides (e.g., polyarteritis nodosa, Wegener's granulomatosis, high-ankle arteritis, temporal arteritis, and lymphomatoid granulomatosis), post-traumatic angioplasty (e.g., restenosis after angioplasty), undifferentiated spondyloarthropathy, undifferentiated arthropathy, arthritis, inflammatory osteolysis, chronic hepatitis, and chronic inflammation caused by chronic viral or bacterial infections.
[0039] The term "viral illness" refers to any disease caused by a virus. Suitable illnesses include, but are not limited to: influenza, adenovirus infection, respiratory syncytial disease, rhinovirus infection, herpes simplex, varicella (chickenpox), measles (rubella), rubella (rubella), mumps (epidemic parotitis), smallpox (variola), Kawasaki disease, yellow fever, dengue fever, hepatitis A, hepatitis B, non-A, non-B hepatitis, viral gastroenteritis, viral fever, cytomegalovirus disease, HIV, rabies, poliomyelitis, Ebola virus, hemorrhagic fever, Epstein-Barr virus (EBV), and diseases including cancers caused by viruses that cause any of the aforementioned illnesses.
[0040] The term "bacterial infection" refers to any infection caused by medically relevant bacteria, including but not limited to pertussis, leprosy, tuberculosis, toxic shock syndrome, food poisoning, Salmonella, Escherichia coli poisoning, Staphylococcus aureus, Clostridium difficile, sepsis, Lyme disease, cholera, dysentery, etc.
[0041] "Separated cell population" refers to a cell population isolated from a human or animal body that does not contain one or more other cell populations that are normally associated with that cell population in vivo or in vitro.
[0042] The term "ligand inducer" refers to one or more agents that cause an increase in the production of such ligands. A ligand inducer for Toll-like receptor (TLR) ligands will produce an increase in TLR ligands and is therefore substantially equivalent to the TLR ligands themselves.
[0043] The term "MHC" (Major Histocompatibility Complex) refers to a subset of genes encoding cell surface antigen-presenting proteins. In humans, these genes are known as human leukocyte antigen (HLA) genes. The abbreviations MHC and HLA are used interchangeably.
[0044] The term "population of cells" refers to a population greater than 1 but at least 1 x 10-1. 3 1 cell, at least 1 x 10 4 1 cell, at least 1 x 10 5 1 cell, at least 1 x 10 6 1 cell, at least 1 x 10 7 1 cell, at least 1 x 10 8 1 cell or at least 1 x 10 9 Any number of cells, one or more. A cell population also refers to a batch of cells grown using bioreactors or other industrial methods designed to culture large numbers of cells.
[0045] In a preferred embodiment of the invention, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, or at least 95% of the stem cells (cell number %) in the original cell population will be undifferentiated MSCs.
[0046] The terms “significant expression” or their equivalents “positive” and “+”, when used for cell surface markers, mean that more than 20%, preferably more than 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% of the cells in a cell population express the cell surface marker.
[0047] For example, the expression of cell surface markers can be determined by flow cytometry targeting a specific cell surface marker using conventional methods and apparatus (e.g., a BECKMAN COULTER EPICS XL FACS system used with commercially available antibodies and standard protocols known in the art), showing a higher signal for that specific cell surface marker in flow cytometry than the background signal using conventional methods and apparatus. This background signal is defined as the signal intensity given by a non-specific antibody of the same type as the specific antibody used to detect each surface marker in a conventional FACS analysis. For a marker considered positive, the observed specific signal is 20% stronger than the background signal intensity using conventional methods and apparatus, preferably 30%, 40%, 50%, 60%, 70%, 80%, 90%, 500%, 1000%, 5000%, 10000%, or more. Furthermore, commercially available and known monoclonal antibodies (e.g., cell receptors and transmembrane proteins) targeting said cell surface markers can be used to identify the relevant cells.
[0048] mRNA expression is determined by any suitable technique, including but not limited to gene expression arrays (gene chips), mRNA-SEQ, Northern blotting, or polymerase chain reaction (PCR), including quantitative PCR (qPCR) methods, which involve the use of reverse transcriptase. qPCR methods include, but are not limited to: probe-based quantification, such as TaqMan®; dye-based quantification, such as SYBR Green; and digital PCR. qPCR methods can be one that utilizes absolute quantification or a relative quantification method that requires normalization relative to housekeeping genes such as actin, GAPDH, or ribosomal subunits.
[0049] Incorporation
[0050] All publications, patents and patent applications mentioned in this specification are incorporated herein by reference to the extent that each individual publication, patent or patent application is specifically and individually cited and incorporated herein by reference. Attached Figure Description
[0051] Figure 1 Gene expression data generated using a PCR array from MSCs polarized with TLR3 ligands (I:C) to possess anti-inflammatory properties are shown. Gray indicates at least two-fold induction of gene expression; black indicates a reduction of gene expression to half; thick boxes indicate upregulation of more than two-fold and selection for [specific gene expression]. Figure 2 Further validation of the genes (except for PIAS2, which was reduced to at least half).
[0052] Figure 2 This demonstrates the use of qPCR to verify the origin of... Figure 1 The selected genes (A and B) for the experiment. Error bars indicate SEM.
[0053] Figure 3 This demonstrates the use of TLR4 ligand (MSC1) or TLR4 ligand plus EPO and cobalt chloride (MSC1). Induction of IL-6 and IL-8 secretion in MSC cells after treatment.
[0054] Figure 4 This demonstrates the use of TLR3 ligand (MSC2) or TLR3 ligand plus EPO and cobalt chloride (MSC2). Treatment with CXCL5 induces the secretion of CCL5 and CXCL10 in MSC cells.
[0055] Figure 5 This shows the effect of using TLR4 ligand (without) ) or TLR4 ligand plus EPO and cobalt chloride (with After processing, MSC cells from different human donors were analyzed. TNFSF10 (TRAIL) Expression of MSC1 and induction of MSC1 phenotype.
[0056] Figure 6 This shows the effect of using TLR3 ligand (without) ) or TLR3 ligand plus EPO and cobalt chloride (with After processing, MSC cells from different human donors were analyzed. CXCL9 Expression of MSC2 and induction of MSC2 phenotype.
[0057] Figure 7 This demonstrates the use of TLR4 ligand (MSC1) or TLR4 ligand plus EPO and cobalt chloride (MSC1). After treatment, MSC cells from MSCs TNFSF10 (TRAIL) Expression-induced time process.
[0058] Figure 8 This demonstrates the use of TLR3 ligand (MSC2) or TLR3 ligand plus EPO and cobalt chloride (MSC2). After treatment, MSC cells from MSCs CXCL9 Expression-induced time process.
[0059] Figure 9 The diagram shows the use of TLR4 ligand (MSC1), TLR4 ligand plus EPO and cobalt chloride (MSC1). ), TLR3 ligand (MSC2) and TLR3 ligand plus EPO and cobalt chloride (MSC2) Transwell migration assay of unstimulated MSCs (negative control) compared to stimulated MSCs. Error bars indicate SEM.
[0060] Figure 10 The diagram shows the use of TLR4 ligand (MSC1), TLR4 ligand plus EPO and cobalt chloride (MSC1). ), TLR3 ligand (MSC2) and TLR3 ligand plus EPO and cobalt chloride (MSC2) Cell proliferation / viability assay of unstimulated MSCs (negative control) compared to stimulated MSCs. Error bars indicate SEM.
[0061] Figure 11 Measurements were shown TNFSF10 (TRAIL) Validation of the expression by qPCR assay, which showed TNFSF10 (TRAIL) Agarose gel of primer PCR amplification products.
[0062] Figure 12 (A) shows MSCs polarized to MSC2 CXCL9 (A) The time course of expression; (B) shows the agarose gel of the PCR amplification product of CXCL9 primers. Detailed Implementation
[0063] The present invention is carried out using conventional techniques of cell culture, molecular biology, and microbiology—in addition to the present invention itself—which are within the skill of those skilled in the art.
[0064] The present invention provides an induction medium for inducing, activating, polarizing, or initiating culture of mesenchymal stem cell populations, comprising a Toll-like receptor (TLR) ligand or TLR ligand inducer in combination with erythropoietin (EPO) and hypoxia or hypoxia mimic exposure, plus additional standard components of cell culture media known in the art and described herein.
[0065] This invention also provides a culture medium induction supplement comprising a Toll-like receptor (TLR) ligand or TLR ligand inducer in combination with erythropoietin (EPO) and hypoxia or hypoxia mimic exposure, which can be added to other existing culture media. Such a supplement may be suitable when the anomalous component or other components at unusual concentrations are appropriate for a particular situation.
[0066] The present invention also provides an airtight culture container containing the culture induction medium or culture medium induction supplement of the present invention.
[0067] The present invention also provides a method for preparing the culture induction medium disclosed herein, comprising the steps of: (a) obtaining the culture medium; and (b) adding to the culture medium a Toll-like receptor (TLR) ligand or a TLR ligand inducer in combination with erythropoietin (EPO) and hypoxia or hypoxia mimic exposure.
[0068] The present invention also provides a composition comprising (a) a culture medium according to the invention and (b) stem cells.
[0069] The present invention also provides compositions comprising (a) a culture medium according to the invention and (b) a solid surface. In some embodiments, the solid surface is any tissue culture compatible surface, including tissue culture plates, flasks, and bottles of any size for 2D cell culture. In some embodiments, the solid surface is a microcarrier or any other supporting matrix for 3D cell culture.
[0070] The present invention also provides the use of the culture medium of the present invention for inducing, activating or initiating mesenchymal stem cell populations.
[0071] The present invention also provides an in vitro method for inducing, activating or triggering a population of mesenchymal stem cells, comprising: (a) providing a population of mesenchymal stem cells; (b) providing the culture medium of the present invention; (c) contacting the stem cells with the culture medium; and (d) culturing the cells under appropriate conditions.
[0072] One aspect of the present invention provides the use of a Toll-like receptor (TLR) ligand or TLR ligand inducer in combination with erythropoietin and exposure to hypoxia or a hypoxia mimicry in the preparation of a cell therapeutic agent. Therefore, in one embodiment, the present invention also provides a method for preparing a cell therapeutic agent, comprising: (a) providing a population of mesenchymal stem cells; (b) providing the culture medium of the present invention; (c) contacting the stem cells with the culture medium; and (d) culturing the cells under suitable conditions. The present invention also provides the use of a composition comprising (a) the culture medium according to the present invention and (b) stem cells for the preparation of a cell therapeutic agent. The present invention further provides the use of a composition comprising (a) the culture medium according to the present invention and (b) a solid surface for the preparation of a cell therapeutic agent.
[0073] The medicament is used to treat, repair, prevent, and / or improve damaged tissue, or one or more symptoms associated with inflammatory and / or immune conditions such as, but not limited to, autoimmune diseases, inflammatory conditions, and immune-mediated diseases, including rejection of transplanted organs and tissues, and cancer. The cell therapy medicament of the present invention comprises a preventively or therapeutically effective amount of stem cells and a drug carrier. Mesenchymal stem cells are particularly preferred. Examples of dosages and dosing regimens for each of these cell types are known in the art. Suitable drug carriers are known in the art and are preferably those approved by a U.S. federal or state regulatory agency, or listed in the United States Pharmacopeia, the European Pharmacopeia, or other recognized pharmacopoeias for use in animals and particularly for use in humans. The term "carrier" refers to a diluent, adjuvant, excipient, or medium administered with the therapeutic agent. The composition may also contain a small amount of a pH buffer, if desired. Examples of suitable drug carriers are described by EW Martin in "Remington's Pharmaceutical Sciences". Such compositions will contain a preventively or therapeutically effective amount of a preferred purified form of the preventive or therapeutic agent and a suitable amount of the carrier to provide a form suitable for administration to a subject. The formulation should be suitable for the method of administration. In a preferred embodiment, the drug is sterile and in a form suitable for administration to a subject, preferably an animal subject, more preferably a mammalian subject, and most preferably a human subject.
[0074] In some embodiments, the methods, cells, and induction culture media of this disclosure are used to treat acute or chronic pain. In some embodiments, the pain is not related to a specific diagnosis. In some embodiments, the pain is related to trauma. In some embodiments, the pain is back pain. In some embodiments, the pain is related to herniated discs or degenerative disc disease. In some embodiments, the pain is neurogenic. In some embodiments, the pain is caused by sciatica.
[0075] In some embodiments, the methods, cells, and induction media of this disclosure are used to treat cancer. In some embodiments, the methods, cells, and induction media of this disclosure are used to treat tumors. In some embodiments, the methods, cells, and induction media of this disclosure are used to enhance cancer treatment. In some embodiments, the cancer is adult acute lymphoblastic leukemia; childhood acute lymphoblastic leukemia; adult acute myeloid leukemia; childhood acute myeloid leukemia; adrenocortical carcinoma; AIDS-related cancer; AIDS-related lymphoma; anal cancer; appendiceal cancer; astrocytoma; atypical teratoma / band tumor; basal cell carcinoma; bile duct cancer, extrahepatic; bladder cancer; bone cancer, osteosarcoma, and malignant fibrous histiocytoma; brainstem glioma; brain tumor; central nervous system embryonal tumor; astrocytoma; craniopharyngioma; ependymoblastoma; brain tumor, ependymoma; medulloblastoma; medullary epithelial tumor; intermediately differentiated pineal tumor; supratentorial primitive neuroectodermal tumor. Tumors and pineal blastoma; brain and spinal cord tumors; breast cancer; male breast cancer; bronchial tumors; Burkitt lymphoma; carcinoid tumors; atypical teratomas / band tumors of the central nervous system; embryonal tumors of the central nervous system; central nervous system (CNS) lymphomas; primary cervical cancer; cervical cancer; childhood cancers; chordoma; chronic lymphocytic leukemia; chronic myeloid leukemia; chronic myeloproliferative disorders; colon cancer; colorectal cancer; craniopharyngioma; cutaneous T-cell lymphoma; embryonal tumors of the central nervous system; endometrial cancer; ependymoblastoma; ependymoma; esophageal cancer; sensory neuroblastoma; Ewing sarcoma family tumors; extracranial germ cell tumors; extragonadal tumors. Germ cell tumors; extrahepatic bile duct carcinoma; ocular cancer, intraocular melanoma; ocular cancer, retinoblastoma; gallbladder cancer; gastric (stomach) cancer; gastrointestinal carcinoid tumors; gastrointestinal stromal tumors (GIST); germ cell tumors, extracranial; germ cell tumors, extragonadal; germ cell tumors, ovarian; gestational trophoblastoma; glioma; hairy cell leukemia; head and neck cancer; cardiac cancer; adult hepatocellular carcinoma (primary); hepatocellular carcinoma; histiocytosis, Langerhans cell; adult Hodgkin lymphoma; childhood Hodgkin lymphoma; hypopharyngeal cancer; intraocular melanoma; islet cell tumor (endocrine pancreas); Kaposi's sarcoma; renal (renal cell) carcinoma; renal cancer; Langerhans cell tissue Polycythemia vera; Laryngeal cancer; Childhood laryngeal cancer; Leukemia, acute lymphoblastic leukemia, adult; Leukemia, acute lymphoblastic leukemia, child; Leukemia, acute myeloid leukemia, adult; Leukemia, acute myeloid leukemia, child; Chronic lymphocytic leukemia; Chronic myeloid leukemia; Hairy cell leukemia; Lip and oral cancer; Primary liver cancer in adults; Liver cancer; Non-small cell lung cancer; Small cell lung cancer; Lymphoma associated with AIDS; Burkitt lymphoma; Cutaneous T-cell lymphoma; Adult Hodgkin lymphoma; Childhood Hodgkin lymphoma; Adult non-Hodgkin lymphoma; Childhood non-Hodgkin lymphoma; Primary central nervous system (CNS) lymphoma; Waldenström macroglobulinemia;Malignant fibrous histiocytoma and osteosarcoma of bone; medulloblastoma; medullary epithelioma; melanoma; intraocular (ocular) melanoma; Merkel cell carcinoma; adult malignant mesothelioma; mesothelioma; occult primary metastatic squamous neck carcinoma; oral cancer; multiple endocrine neoplasia syndrome; multiple myeloma / plasmocytoma; fungal diseases; myelodysplastic syndrome; myelodysplastic / myeloproliferative neoplasms; chronic myeloid leukemia; adult acute myeloid leukemia; childhood acute myeloid leukemia; multiple myeloma; chronic myeloproliferative disorders; nose Carcinoma of the nasal cavity and paranasal sinuses; nasopharyngeal carcinoma; neuroblastoma; non-Hodgkin lymphoma, adult; non-Hodgkin lymphoma, child; non-small cell lung cancer; oral cancer; oral cavity cancer, lip and oropharyngeal cancer; osteosarcoma and malignant fibrous histiocytoma of bone; ovarian cancer; ovarian epithelial carcinoma; ovarian germ cell tumors; low-grade malignant potential tumors of the ovary; pancreatic cancer; islet cell pancreatic cancer tumors; papillomatosis; carcinoma of the paranasal sinuses and nasal cavity; parathyroid carcinoma; penile cancer; pharyngeal carcinoma; intermediately differentiated pineal adenoma; pituitary adenoma; plasmacytoma / multiple myeloma; pleural pulmonary blastoma. Pregnancy and breast cancer; primary central nervous system (CNS) lymphoma; prostate cancer; rectal cancer; renal cell carcinoma; transitional cell carcinoma of the renal pelvis and ureter; respiratory tract cancer with chromosome 15 variation; retinoblastoma; rhabdomyosarcoma; salivary gland carcinoma; salivary gland cancer; Ewing sarcoma family sarcoma; Kaposi's sarcoma; adult soft tissue sarcoma; childhood soft tissue sarcoma; uterine sarcoma; Cezary syndrome; skin cancer (non-melanoma); skin cancer; skin cancer (melanoma); Merkel cell skin cancer; small cell lung cancer; small bowel cancer; soft tissue cancer; Histiosarcoma, adult; soft tissue sarcoma, child; squamous cell carcinoma; metastatic occult primary squamous neck carcinoma; gastric (stomach) cancer; supratentorial primitive neuroectodermal tumor; T-cell lymphoma, skin; testicular cancer; laryngeal cancer; thymoma and thymic carcinoma; thyroid cancer; transitional cell carcinoma of the renal pelvis and ureter; gestational trophoblastic tumor; cancer of unknown primary site; transitional cell carcinoma of the ureter and renal pelvis; urethral cancer; uterine cancer, endometrium; uterine sarcoma; uveal melanoma; vaginal cancer; vulvar cancer; Waldenström macroglobulinemia or nephroblastoma.
[0076] In some embodiments, the methods, cells, and induction media of this disclosure are used to administer to subjects requiring treatment for cancer, autoimmune diseases, or inflammatory conditions. In some embodiments, the methods, cells, and induction media of this disclosure include different routes of administration. In some embodiments, the route of administration is subcutaneous, intramural, intramuscular, intravenous, intratumoral, intraocular, intraretinal, intravitreal, or intracranial.
[0077] In some embodiments, the methods, cells, and induction media of this disclosure are used to administer to subjects requiring treatment for cancer, autoimmune diseases, or immune-mediated inflammatory diseases. In some embodiments, the methods, cells, and induction media of this disclosure include different dosing frequencies. In some embodiments, the cells and drugs of this disclosure are administered once daily, once weekly, once monthly, or once annually. In some embodiments, the cells and methods of this disclosure are administered twice daily, twice weekly, twice monthly, or twice annually. In some embodiments, the cells and methods of this disclosure are administered three times daily, three times weekly, three times monthly, or three times annually. In some embodiments, the cells and methods of this disclosure are administered four times daily, four times weekly, four times monthly, or four times annually. In some embodiments, after the initial treatment, there is a maintenance dose for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 times per year. In some embodiments, the maintenance dose is sustained for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10, or more years. In some implementations, at least 1x10 is administered per dose. 6 Cells. In some implementations, at least 2 x 103 cells are administered per dose. 6 Cells. In some implementations, at least 3 x 103 cells are administered per dose. 6 Cells. In some implementations, at least 4 x 10 cells are administered per dose. 6 Cells. In some implementations, at least 5 x 10 cells are administered per dose. 6 Cells. In some implementations, at least 6 x 10 cells are administered per dose. 6 Cells. In some embodiments, cells are applied. In some embodiments, at least 7 x 10 cells are applied per dose. 6 Cells. In some implementations, at least 8 x 10 cells are administered per dose. 6 Cells. In some implementations, at least 9 x 10 cells are administered per dose. 6 Cells. In some implementations, at least 1x10 cells are administered per dose. 7 Cells. In some implementations, at least 2 x 103 cells are administered per dose. 7 Cells. In some implementations, at least 3 x 103 cells are administered per dose. 7 Cells. In some implementations, at least 4 x 10 cells are administered per dose. 7 Cells. In some implementations, at least 5 x 10 cells are administered per dose. 7 Cells. In some implementations, at least 6 x 10 cells are administered per dose. 7 Cells. In some implementations, at least 7 x 10 cells are administered per dose. 7 Cells. In some implementations, at least 8 x 10 cells are administered per dose.7 Cells. In some implementations, at least 9 x 10 cells are administered per dose. 7 Cells. In some implementations, at least 1x10 cells are administered per dose. 8 Cells. In some implementations, at least 2 x 103 cells are administered per dose. 8 Cells. In some implementations, at least 3 x 103 cells are administered per dose. 8 Cells. In some implementations, at least 4 x 10 cells are administered per dose. 8 Cells. In some implementations, at least 5 x 10 cells are administered per dose. 8 Cells. In some implementations, at least 6 x 10 cells are administered per dose. 8 Cells. In some implementations, at least 7 x 10 cells are administered per dose. 8 Cells. In some implementations, at least 8 x 10 cells are administered per dose. 8 Cells. In some implementations, at least 9 x 10 cells are administered per dose. 8 Cells. In some implementations, at least 1x10 cells are administered per dose. 9 Cells. In some implementations, at least 2 x 103 cells are administered per dose. 9 Cells. In some implementations, at least 3 x 103 cells are administered per dose. 9 Each cell.
[0078] The medicament of the present invention can be in various forms. These forms include, for example, semi-solid and liquid dosage forms, such as lyophilized preparations, liquid solutions or suspensions, injectable and infusionable solutions, etc., and the medicament is preferably injectable.
[0079] In some embodiments, the drug is used to treat or repair damaged tissue (preferably mesenchymal tissue), and / or to treat, modulate, prevent, and / or improve one or more symptoms associated with inflammatory and / or immune conditions. Therefore, the methods and cells of the present invention are used to treat any condition characterized by any or all of the said symptoms. A representative, but not exhaustive, list of such conditions is provided in the definition section. Drugs for treating immune-mediated inflammatory diseases are particularly preferred. Drugs for treating diabetes, rheumatoid arthritis (RA), inflammatory bowel disease (IBD, including Crohn's disease and / or ulcerative colitis), and multiple sclerosis (MS) are further preferred. The present invention also provides use with erythropoietin and a Toll-like receptor (TLR) ligand or TLR ligand inducer in combination with hypoxia or hypoxia mimicry for mesenchymal stem cell culture.
[0080] The specific components and proportions of the culture media, supplements, and compositions of the present invention can be varied according to specific needs and applications. Similarly, the precise steps of the methods of the present invention can be varied according to specific needs and applications. The culture media, supplements, methods, compositions, and uses according to the present invention can be optimized through routine experiments. For example, if the desired outcome is an anti-inflammatory therapeutic effect, the culture media, supplements, or compositions will specifically contain a TLR3 ligand or TLR ligand inducer in combination with erythropoietin and hypoxia or hypoxia mimicry (cobalt chloride or deferoxamine) exposure; conversely, if the desired outcome is an immunomodulatory therapeutic effect, the culture media, supplements, or compositions will specifically contain a TLR4 ligand or TLR ligand inducer in combination with erythropoietin and hypoxia or hypoxia mimicry exposure. The amount of each of the components described herein can be optimized independently of the other components through routine optimization, or one or more components can be added or removed. The ability of a culture medium to support the induction, activation, or initiation of mesenchymal stem cells can be tested by testing the culture medium together with or in lieu of known culture media or methods. The culture media, supplements, methods, compositions, and uses of the present invention are described in more detail below.
[0081] The induction medium of the present invention comprises a Toll-like receptor (TLR) ligand or a TLR ligand inducer in combination with erythropoietin and exposure to hypoxia or a hypoxia mimic. In one aspect, the induction medium of the present invention comprises a Toll-like receptor (TLR) ligand or a TLR ligand inducer. Alternatively, the induction medium of the present invention comprises erythropoietin and exposure to hypoxia or a hypoxia mimic. In a further aspect, the induction medium of the present invention comprises a Toll-like receptor (TLR) ligand or a TLR ligand inducer in combination with erythropoietin and exposure to hypoxia or a hypoxia mimic. In some embodiments, the TLR ligand is a TLR4 ligand. In some embodiments, the TLR ligand is a TLR3 ligand.
[0082] The induction medium of the present invention may contain two or more, three or more, four, five, six, seven, eight, nine, ten or more combinations of Toll-like receptor (TLR) ligands or TLR ligand inducers with erythropoietin (EPO) and hypoxia or hypoxia mimic exposure.
[0083] The induction medium of the present invention may contain about 0.10 picomonas (pM) to about 100 mmol (mM) of a combination of erythropoietin (EPO) at a concentration of about 0.5 mU / mL to about 100 mU / mL and a TLR ligand or TLR ligand inducer at a concentration of about 0.5% to about 2% oxygen conditions (hypoxia) or a hypoxia mimic such as cobalt chloride or deferoxamine at a concentration of about 10 μmol to about 1 mM, or any other combination of the above TLR ligand or TLR ligand inducer, erythropoietin and hypoxia.
[0084] The TLR3 ligand used in the induction medium can be IL4, IL13, poly(A:U), poly(I:C), or combinations thereof, and can be delivered by incubation, transfection, transduction by a carrier molecule, or by a combination thereof. Preferably, the TLR3 ligand or agonist is poly(I:C).
[0085] The TLR4 ligand used in the induction medium can be aminoalkylglucosinolate 4-phosphate, interferon, TNF-α, GM-CSF, lipopolysaccharide (LPS), or combinations thereof, and can be delivered by incubation, transfection, transduction by a carrier molecule, or by a combination thereof. Preferably, the TLR4 ligand or agonist is LPS.
[0086] TLR3 ligands or agonists may be provided in amounts of about 10 pg / mL to about 100 μg / mL, about 100 pg / mL to about 100 μg / mL, about 1 ng / mL to about 100 μg / mL, about 5 ng / mL to about 100 μg / mL, about 10 ng / mL to about 100 μg / mL, about 100 ng / mL to about 100 μg / mL, about 0.1 μg / mL to about 50 μg / mL, about 0.1 μg / mL to about 10 μg / mL, about 0.25 μg / mL to about 7.5 μg / mL, about 0.5 μg / mL to about 5 μg / mL, about 1 μg / mL to about 2.5 μg / mL, and preferably about 1 μg / mL to about 1.5 μg / mL, in the culture medium or supplement described above.
[0087] In some embodiments, the TLR3 ligand is poly(I:C) and is provided in amounts of about 10 pg / mL to about 100 μg / mL, about 100 pg / mL to about 100 μg / mL, about 1 ng / mL to about 100 μg / mL, about 5 ng / mL to about 100 μg / mL, about 10 ng / mL to about 100 μg / mL, about 100 ng / mL to about 100 μg / mL, about 0.1 μg / mL to about 50 μg / mL, about 0.1 μg / mL to about 10 μg / mL, about 0.25 μg / mL to about 7.5 μg / mL, about 0.5 μg / mL to about 5 μg / mL, about 1 μg / mL to about 5 μg / mL, and about 1 μg / mL to about 2.5 μg / mL. In some embodiments, poly(I:C) is provided in an amount of about 1 μg / mL. In some embodiments, poly(I:C) is provided at a level of about 2 μg / mL. In some embodiments, poly(I:C) is provided at a level of about 3 μg / mL. In some embodiments, poly(I:C) is provided at a level of about 4 μg / mL. In some embodiments, poly(I:C) is provided at a level of about 5 μg / mL. In some embodiments, poly(I:C) is provided at a level of about 6 μg / mL. In some embodiments, poly(I:C) is provided at a level of about 7 μg / mL. In some embodiments, poly(I:C) is provided at a level of about 8 μg / mL. In some embodiments, poly(I:C) is provided at a level of about 9 μg / mL. In some embodiments, poly(I:C) is provided at a level of about 10 μg / mL. In some embodiments, poly(I:C) is provided at a level of less than about 100 ng / mL. In some embodiments, poly(I:C) is provided at a level of less than about 50 ng / mL. In some embodiments, the poly(I:C) is provided in amounts below about 20 ng / mL. In some embodiments, the poly(I:C) is provided in amounts below about 10 ng / mL. In some embodiments, the poly(I:C) is provided in amounts below about 50 ng / mL.
[0088] TLR4 ligands or agonists may be provided in amounts of about 10 pg / mL to about 10 μg / mL, about 100 pg / mL to about 10 μg / mL, about 1 ng / mL to about 1 μg / mL, about 5 ng / mL to about 1 μg / mL, about 10 ng / mL to about 1 μg / mL, about 100 ng / mL to about 1 μg / mL, preferably about 5 ng / mL to about 50 ng / mL, and even more preferably about 5 ng / mL to about 25 ng / mL in the culture medium or supplement described above.
[0089] In some embodiments, the TLR4 ligand is LPS. In some embodiments, LPS is present in amounts of about 10 pg / mL to about 10 μg / mL, about 100 pg / mL to about 10 μg / mL, about 1 ng / mL to about 1 μg / mL, about 5 ng / mL to about 1 μg / mL, about 10 ng / mL to about 1 μg / mL, about 100 ng / mL to about 1 μg / mL, preferably about 5 ng / mL to about 50 ng / mL, and even more preferably about 5 ng / mL to about 25 ng / mL. In some embodiments, LPS is present at a concentration of about 5 ng / mL. In some embodiments, LPS is present at a concentration of about 10 ng / mL. In some embodiments, LPS is present at a concentration of about 15 ng / mL. In some embodiments, LPS is present at a concentration of about 20 ng / mL. In some embodiments, LPS is present at a concentration of about 25 ng / mL. In some embodiments, LPS is present at a concentration of about 30 ng / mL. In some embodiments, LPS is present at a concentration of about 35 ng / mL. In some embodiments, LPS is present at a concentration of about 40 ng / mL. In some embodiments, LPS is present at a concentration of about 45 ng / mL. In some embodiments, LPS is present at a concentration of about 50 ng / mL. In some embodiments, LPS is present at a concentration below about 100 ng / mL. In some embodiments, LPS is present at a concentration below about 50 ng / mL. In some embodiments, LPS is present at a concentration below about 20 ng / mL. In some embodiments, LPS is present at a concentration below about 10 ng / mL.
[0090] In some embodiments, the induction medium of the present invention comprises incubation in a hypoxic or oxygen-depleted environment. In some embodiments, the hypoxic environment has less than 2% oxygen. In some embodiments, the hypoxic environment has less than 1.5% oxygen. In some embodiments, the hypoxic environment has less than 1.0% oxygen. In some embodiments, the hypoxic environment has less than 0.5% oxygen. In some embodiments, the hypoxic environment has virtually 0% oxygen. In some embodiments, the hypoxic environment has 0.5% to 2.0% oxygen. In some embodiments, the hypoxic environment has 0.5% to 1.5% oxygen. In some embodiments, the hypoxic environment has 0.5% to 1.0% oxygen. In some embodiments, the hypoxic environment has 1.0% to 2.0% oxygen. In some embodiments, the hypoxic environment has 1.5% to 2.0% oxygen.
[0091] In some embodiments, the induction medium of the present invention comprises cobalt chloride. In some embodiments, the cobalt chloride is at about 50... μMIt exists at a concentration of [missing information]. In some embodiments, cobalt chloride is present at approximately 100 [missing information]. μM The concentration of cobalt chloride present is as follows: In some embodiments, cobalt chloride is present at a concentration of about 200 μM. In some embodiments, cobalt chloride is present at a concentration of about 300 μM. In some embodiments, cobalt chloride is present at a concentration of about 400 μM. In some embodiments, cobalt chloride is present at a concentration of about 500 μM. In some embodiments, cobalt chloride is present at a concentration of about 600 μM. In some embodiments, cobalt chloride is present at a concentration of about 700 μM. In some embodiments, cobalt chloride is present at a concentration of about 800 μM. In some embodiments, cobalt chloride is present at a concentration of about 900 μM. In some embodiments, cobalt chloride is present at a concentration of about 1 mM. In some embodiments, cobalt chloride is present at a concentration of about 10 μM to about 1 mM. In some embodiments, cobalt chloride is present at a concentration of about 10 μM to about 800 μM. In some embodiments, cobalt chloride is present at a concentration of about 10 μM to about 500 μM. In some embodiments, cobalt chloride is present at a concentration of about 10 μM to about 400 μM. In some embodiments, cobalt chloride is present at a concentration of about 10 μM to about 300 μM. In some embodiments, cobalt chloride is present at a concentration of about 50 μM to about 300 μM. In some embodiments, cobalt chloride is present at a concentration of about 100 μM to about 300 μM. In some embodiments, cobalt chloride is present at a concentration of about 150 μM to about 300 μM.
[0092] In some embodiments, the induction medium of the present invention comprises deferoxamine. In some embodiments, deferoxamine is present at a concentration of about 50 μM. In some embodiments, deferoxamine is present at a concentration of about 200 μM. In some embodiments, deferoxamine is present at a concentration of about 300 μM. In some embodiments, deferoxamine is present at a concentration of about 400 μM. In some embodiments, deferoxamine is present at a concentration of about 500 μM. In some embodiments, deferoxamine is present at a concentration of about 600 μM. In some embodiments, deferoxamine is present at a concentration of about 700 μM. In some embodiments, deferoxamine is present at a concentration of about 800 μM. In some embodiments, deferoxamine is present at a concentration of about 900 μM. In some embodiments, deferoxamine is present at a concentration of about 1 mM. In some embodiments, deferoxamine is present at a concentration of about 10 μM to about 1 mM. In some embodiments, deferoxamine is present at a concentration of about 10 μM to about 800 μM. In some embodiments, deferoxamine is present at a concentration of about 10 μM to about 500 μM. In some embodiments, deferoxamine is present at a concentration of about 10 μM to about 400 μM. In some embodiments, deferoxamine is present at a concentration of about 10 μM to about 300 μM. In some embodiments, deferoxamine is present at a concentration of about 50 μM to about 300 μM. In some embodiments, deferoxamine is present at a concentration of about 100 μM to about 300 μM. In some embodiments, deferoxamine is present at a concentration of about 150 μM to about 300 μM.
[0093] In some embodiments, the induction medium of the present invention comprises erythropoietin. In some embodiments, the induction medium of the present invention comprises recombinant erythropoietin. In some embodiments, the induction medium of the present invention comprises human recombinant erythropoietin. In some embodiments, the amount of erythropoietin is from about 0.1 ng / mL to about 1.0 mg / mL. In some embodiments, the amount of erythropoietin is from about 0.1 ng / mL to about 100 ng / mL. In some embodiments, the amount of erythropoietin is from about 0.1 ng / mL to about 50 ng / mL. In some embodiments, the amount of erythropoietin is from about 0.1 ng / mL to about 10 ng / mL. In some embodiments, the amount of erythropoietin is from about 0.1 ng / mL to about 1.0 ng / mL. In some embodiments, the amount of erythropoietin is from about 0.2 ng / mL to about 0.8 ng / mL. In some embodiments, the amount of erythropoietin is from about 0.3 ng / mL to about 0.6 ng / mL. In some embodiments, the amount of erythropoietin is less than 10 mg / mL. In some embodiments, the amount of erythropoietin is less than 5 mg / mL. In some embodiments, the amount of erythropoietin is less than 1 mg / mL. In some embodiments, the amount of erythropoietin is less than 100 ng / mL. In some embodiments, the amount of erythropoietin is less than 30 ng / mL. In some embodiments, the amount of erythropoietin is less than 10 ng / mL. In some embodiments, the amount of erythropoietin is less than 5 ng / mL. In some embodiments, the amount of erythropoietin is less than 4 ng / mL. In some embodiments, the amount of erythropoietin is less than 1 ng / mL. In some embodiments, the amount of erythropoietin is less than 0.8 ng / mL. In some embodiments, the amount of erythropoietin is less than 1 ng / mL. In some embodiments, the amount of erythropoietin is less than 5 U / mL. In some embodiments, the amount of erythropoietin is less than 1 U / mL. In some embodiments, the amount of erythropoietin is less than 0.5 U / mL. In some embodiments, the amount of erythropoietin is less than 0.1 U / mL. In some embodiments, the amount of erythropoietin is less than 0.05 U / mL.
[0094] Cell induction media typically contain a large number of components necessary to support and maintain cultured cells. Therefore, in addition to Toll-like receptor (TLR) ligands or TLR ligand inducers in combination with erythropoietin and hypoxia or hypoxia mimics (cobalt chloride or deferoxamine) exposure, the induction media of the present invention will typically contain many other components. Those skilled in the art can readily formulate suitable combinations of components in light of the following disclosure. The induction media according to the present invention will typically be a nutrient solution containing standard cell culture components described in more detail below, such as amino acids, vitamins, trace metals, inorganic salts, carbon sources, and buffers.
[0095] The induction medium of the present invention may contain serum. The serum contains cellular and non-cellular factors and components necessary for cell viability and expansion. Serum obtained from any suitable source can be used, including fetal bovine serum (FBS), bovine serum (BS), calf serum (CS), fetal bovine serum (FCS), newborn calf serum (NCS), goat serum (GS), horse serum (HS), porcine serum, sheep serum, rabbit serum, rat serum (RS), etc. Also within the scope of the invention, if the MSCs are human, the cell induction medium is supplemented with human serum, preferably autologous. It is understood that if it is deemed necessary to inactivate components of the complement cascade, the serum can be heat-inactivated at 55-65 °C. In the case of using serum substitutes, it can be used at about 2% to about 40% of the volume of the medium according to conventional techniques.
[0096] In other embodiments, the induction medium of the present invention may contain a serum substitute. A variety of different serum substitute formulations are commercially available and known to those skilled in the art, such as, but not limited to, serum albumin, serum transferrin, selenium, and recombinant proteins, including but not limited to insulin, platelet-derived growth factor (PDGF), and basic fibroblast growth factor (bFGF). When using a serum substitute, it can be used at about 2% to about 40% of the medium volume according to conventional techniques. In other embodiments, the induction medium of the present invention may be serum-free and / or serum-substitute-free. A serum-free medium is a medium that does not contain any type of animal serum. A serum-free medium is preferred to avoid possible xenogeneic contamination of stem cells. A serum-substitute-free medium is a medium that has not been supplemented with any commercial serum substitute formulation.
[0097] The induction medium of the present invention is typically prepared in deionized distilled water. The induction medium of the present invention is typically sterilized before use, for example, by ultraviolet light, heating, irradiation, or filtration to prevent contamination. The induction medium may be frozen (e.g., at -20°C or -80°C) for storage or transport. Antimicrobial agents are typically used in the medium to mitigate bacterial, mycoplasma, and fungal contamination. The medium may contain one or more antimicrobial agents or antibiotics to prevent contamination. Typically, the antibiotics or antifungal compounds used are penicillin / streptomycin mixtures, but may also include, but are not limited to, fungizone. ® Ampicillin, gentamicin, bleomycin, hygromacin, kanamycin, mitomycin, etc.
[0098] In one embodiment of the invention, the induction medium is a medium that has been adjusted by adding a Toll-like receptor (TLR) ligand or a TLR ligand inducer in combination with erythropoietin and hypoxia or a hypoxia mimic (cobalt chloride or deferoxamine) exposure. The conditioned medium is produced by culturing a population of said cells in the induction medium for a time sufficient to adjust the medium, followed by harvesting the conditioned medium. When using a conditioned medium, it can be adjusted for mammalian cells, such as mouse cells or human cells. Many different types of mammalian cells can be used to produce conditioned media suitable for mesenchymal stem cell induction.
[0099] The induction medium can be a 1x formulation or a concentrated formulation, for example, a 2x to 250x concentrated medium formulation. In a 1x formulation, each component of the medium is at the concentration used for cell induction. In a concentrated formulation, one or more of the components are present at a higher concentration than used for cell induction. The induction medium can be concentrated using known methods such as salt precipitation or selective filtration. The concentrated medium can be diluted with water (preferably deionized and distilled water) or any suitable solution, such as an aqueous salt solution, an aqueous buffer, or a culture medium, for use.
[0100] Under appropriate conditions, the induction media disclosed herein can induce, activate, or trigger a single passage or population doubling of stem cell populations in a pluripotent, undifferentiated, and proliferative state. Stem cells are considered to be in a pluripotent, undifferentiated, and proliferative state if they exhibit certain characteristics as described in more detail elsewhere herein. Appropriate conditions can be selected by those skilled in the art from those commonly used for mesenchymal stem cell culture.
[0101] As described elsewhere herein, the present invention also provides an airtight container containing the induction medium of the present invention. The airtight container is preferably used for transporting or storing the induction medium to prevent contamination. The container can be any suitable container, such as a bioreactor, flask, culture plate, bottle, jar, vial, or bag. As described elsewhere herein, the present invention also provides a method for preparing an induction medium, comprising the steps of: (a) obtaining the medium; and (b) adding a Toll-like receptor (TLR) ligand or TLR ligand inducer in combination with erythropoietin (EPO) and hypoxia or hypoxia mimicry (cobalt chloride or deferoxamine) exposure. Various different methods for preparing the induction medium are conceivable depending on the specific components contained therein. For example, a method for preparing an induction medium may include the steps of: (a) obtaining the medium; and (b) adding a TLR ligand or TLR ligand inducer in combination with erythropoietin (EPO) and hypoxia or hypoxia mimicry (cobalt chloride or deferoxamine) exposure. In one embodiment, a method for preparing an induction medium may include the steps of: (a) obtaining a medium; and (b) adding a TLR ligand, EPO, and cobalt chloride to the medium.
[0102] The induction medium of the present invention can be used to induce, activate, or induce populations of mesenchymal stem cells. Therefore, the present invention provides the use of any induction medium as disclosed herein for inducing, activating, or inducing populations of mesenchymal stem cells into a discrete, homogeneous phenotype for cell-based therapies.
[0103] In some embodiments, the induction medium disclosed herein induces or reduces the expression of certain genes, which can be measured by methods known to those skilled in the art, including but not limited to PCR, qPCR, qRT-PCR, semi-quantitative RT-PCR, digital PCR, Northern blotting, mRNA-SEQ, microarrays, etc. In some embodiments, the induction medium disclosed herein increases or decreases protein levels, which can be measured by methods known to those skilled in the art, including but not limited to antibody-based assays, enzyme-linked immunosorbent assays (ELISA), immunoblotting or Western blotting, flow cytometry, mass spectrometry, etc. In some embodiments, the induction medium disclosed herein induces activation or attenuation of cell signaling pathways, which can be measured by methods known to those skilled in the art, including but not limited to kinase assays, protein phosphorylation / dephosphorylation measurements, protein ubiquitination / deubiquitination measurements, protein acetylation / deacetylation measurements, protein degradation / stability measurements, measurements of second messengers such as calcium or diacylglycerol, or monitoring of cleavage from inactive to active forms.
[0104] In some embodiments, the induction medium disclosed herein results in measurable changes in gene expression, protein levels, or cell signaling pathways in a cell population. In some embodiments, this change is an increase in gene expression, protein levels, or cell signaling. In some embodiments, this change is any statistically significant change between the unstimulated or control sample and the stimulated or test sample. In some embodiments, the change between the unstimulated or control sample and the stimulated or test sample is an increase of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times. In some embodiments, the change between the unstimulated or control sample and the stimulated or test sample is an increase of at least 100 or more times. In some embodiments, the change between the unstimulated or control sample and the stimulated or test sample is a decrease of at most 1 / 2, 1 / 3, 1 / 4, 1 / 5, 1 / 6, 1 / 7, 1 / 8, 1 / 9, 1 / 10, or less. In some implementations, the change between the unstimulated or control sample and the stimulated or test sample is reduced to at most 1 / 100 or less.
[0105] In some embodiments, an induction medium containing a TLR3 ligand induces at least a 2-fold increase in mRNA expression of any of the following genes compared to an unstimulated cell population: CXCL9, EGFR, IRF1, A2M, FAS, IL2RG, MMP3, GBP1, ISG15, FCGR1, NFKB1, NOS2A, USF1, YY1, JAK2, STA2, STAT4, STAT5, SOCS1, or IRF1. In some embodiments, an induction medium containing a TLR3 ligand reduces mRNA expression of any of the following genes by up to half compared to an unstimulated cell population: EPOR, F2R, STAM, PDGFRA, PIAS2, MYC, SH2B1, or CSF2RB. In some embodiments, the induction medium containing TLR3 ligand induces at least 10-fold mRNA expression of any of the following genes compared to an unstimulated cell population: CXCL9, GBP1, ISG15, SOCS1, MMP3, JAK2, or IRF1. In some embodiments, the induction medium containing TLR3 ligand induces at least 20-fold mRNA expression of any of the following genes compared to an unstimulated cell population: CXCL9, GBP1, ISG15, or SOCS1. In some embodiments, the induction medium containing TLR3 ligand induces at least 100-fold mRNA expression of CXCL9 compared to an unstimulated cell population.
[0106] In some implementations, induction medium containing TLR4 ligand induces [the cell population] compared to an unstimulated cell population. TNFSF10 ( TRAIL The mRNA expression of ) is at least 2-fold, 10-fold, 100-fold, or 1000-fold.
[0107] The present invention also provides an in vitro method for inducing, activating or initiating a population of mesenchymal stem cells, comprising: (a) providing a population of mesenchymal stem cells; (b) providing an induction medium as disclosed herein; (c) contacting the stem cells with the induction medium; and (d) culturing the stem cells under appropriate conditions.
[0108] In some embodiments, the in vitro methods disclosed herein for inducing, activating, or triggering mesenchymal stem cell populations induce or reduce the expression of certain genes, which can be measured by methods known to those skilled in the art, including but not limited to PCR, qPCR, qRT-PCR, semi-quantitative RT-PCR, digital PCR, Northern blotting, mRNA-SEQ, microarrays, etc. In some embodiments, the induction medium disclosed herein increases or decreases protein levels, which can be measured by methods known to those skilled in the art, including but not limited to antibody-based assays, enzyme-linked immunosorbent assays (ELISA), immunoblotting or Western blotting, flow cytometry, mass spectrometry, etc. In some embodiments, the in vitro methods disclosed herein for inducing, activating, or triggering mesenchymal stem cell populations induce activation or attenuation of cell signaling pathways, which can be measured by methods known to those skilled in the art, including but not limited to kinase assays, protein phosphorylation / dephosphorylation measurements, protein ubiquitination / deubiquitination measurements, protein acetylation / deacetylation measurements, protein degradation / stability measurements, measurements of second messengers such as calcium or diacylglycerol, or monitoring of cleavage from inactive to active forms.
[0109] In some embodiments, the ex vivo methods disclosed herein for inducing, activating, or triggering mesenchymal stem cell populations result in measurable changes in gene expression, protein levels, or cell signaling pathways within the stem cell population. In some embodiments, this change is an increase in gene expression, protein levels, or cell signaling. In some embodiments, this change is any statistically significant change between a measured unstimulated or control sample and a stimulated or test sample. In some embodiments, the change between the unstimulated or control sample and the stimulated or test sample is an increase of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times. In some embodiments, the change between the unstimulated or control sample and the stimulated or test sample is an increase of at least 100 or more times. In some embodiments, the change between the unstimulated or control sample and the stimulated or test sample is a decrease of at most 1 / 2, 1 / 3, 1 / 4, 1 / 5, 1 / 6, 1 / 7, 1 / 8, 1 / 9, 1 / 10, or less. In some implementations, the change between the unstimulated or control sample and the stimulated or test sample is reduced to at most 1 / 100 or less.
[0110] In some embodiments, the in vitro methods disclosed herein for inducing, activating, or triggering mesenchymal stem cell populations, including a TLR3 ligand, induce at least a 2-fold increase in mRNA expression of any of the following genes compared to an unstimulated cell population: CXCL9, EGFR, IRF1, A2M, FAS, IL2RG, MMP3, GBP1, ISG15, FCGR1, NFKB1, NOS2A, USF1, YY1, JAK2, STA2, STAT4, STAT5, SOCS1, or IRF1. In some embodiments, the in vitro methods disclosed herein for inducing, activating, or triggering mesenchymal stem cell populations, including a TLR3 ligand, reduce mRNA expression of any of the following genes to at most half compared to an unstimulated cell population: EPOR, F2R, STAM, PDGFRA, PIAS2, MYC, SH2B1, or CSF2RB. In some embodiments, the in vitro methods disclosed herein for inducing, activating, or triggering mesenchymal stem cell populations, including a TLR3 ligand, induce at least 10-fold mRNA expression of any of the following genes compared to an unstimulated cell population: CXCL9, GBP1, ISG15, SOCS1, MMP3, JAK2, or IRF1. In some embodiments, the in vitro methods disclosed herein for inducing, activating, or triggering mesenchymal stem cell populations, including a TLR3 ligand, induce at least 20-fold mRNA expression of any of the following genes compared to an unstimulated cell population: CXCL9, GBP1, ISG15, or SOCS1. In some embodiments, the in vitro methods disclosed herein for inducing, activating, or triggering mesenchymal stem cell populations, including a TLR3 ligand, induce at least 100-fold mRNA expression of CXCL9 compared to an unstimulated cell population.
[0111] In some embodiments, the ex vivo methods disclosed herein for inducing, activating, or triggering mesenchymal stem cell populations, including TLR4 ligands, induce [the population] compared to an unstimulated cell population. TNFSF10 (TRAIL) The mRNA expression was at least 2-fold, 10-fold, 100-fold, or 1000-fold.
[0112] The present invention also provides a cell therapy method comprising: (a) providing a population of mesenchymal stem cells; (b) providing the induction medium of the present invention; (c) contacting the stem cell population with the induction medium; and (d) culturing the cells under appropriate conditions.
[0113] The methods of the present invention may include culturing the cells in contact with a solid surface as described elsewhere herein. For example, the present invention provides a method comprising: (a) providing a population of mesenchymal stem cells; (b) providing an induction medium as disclosed herein; (c) contacting the stem cells with the induction medium; and (d) culturing the cells under suitable conditions and contacting them with a solid surface. The present invention also provides the use of the induction medium and solid surface as disclosed herein for expanding a population of mesenchymal stem cells. The mesenchymal stem cells may adhere to, attach to, or be seeded onto the support. Typically, the cells are seeded at a desired density, such as about 100 cells / cm², before inducing, activating, or triggering the stem cells. 2 Approximately 100,000 cells / cm² 2 (e.g., approximately 500 cells / cm) 2 Approximately 50,000 cells / cm 2 Or more specifically, approximately 1,000 cells / cm² 2 Approximately 20,000 cells / cm 2 In a specific embodiment, the cell density is 200-10,000 cells / cm². 2 .
[0114] It is understood that the steps of the methods disclosed herein may be performed in any order or at the same time as appropriate, and need not be performed in the order listed herein. For example, in the methods described above, the step of providing a population of mesenchymal stem cells may be performed before, after, or simultaneously with the step of providing the induction culture medium.
[0115] The methods and uses of this invention may include any induction culture medium or supplement as described herein. Therefore, in some embodiments, the methods of this invention may be methods in the absence of serum and / or serum substitutes. In some embodiments, the methods of this invention may be used to induce cells without contact with the feeder cell layer.
[0116] The preferred methods and uses of the present invention are for inducing, activating or triggering a population of mesenchymal stem cells when the cells have been expanded and before cryopreservation and use in cell-based therapies.
[0117] Preferably, the stem cell population is of adult origin, and more preferably, the cells are mesenchymal stem cell populations (such as those in bone marrow-derived or adipose-derived cells).
[0118] The conditions for stem cell culture are known to those skilled in the art. Preferably, the culture is carried out in the presence of a solid support suitable for the adhesion of mesenchymal stem cells.
[0119] The preparation method may optionally further include the steps of: (a) passage the cells to a culture medium as disclosed herein; (b) further culturing the cells under appropriate conditions; and (c) inducing, activating or triggering the cells.
[0120] It has been demonstrated that in vitro expansion of MSCs without induced differentiation can be carried out over a long period, for example, using large quantities of specially selected suitable serum (such as fetal bovine serum or human serum). Methods for measuring viability and yield are known in the art (e.g., trypan blue exclusion method).
[0121] If necessary, any steps and procedures for isolating the cell populations of the present invention can be performed manually. Alternatively, the process of isolating such cells can be facilitated and / or automated by one or more suitable devices, examples of which are known in the art.
[0122] The present invention can be carried out using any suitable cell culture container as a support. Cell culture containers (e.g., flasks, single-well or multi-well culture plates, single-well or multi-well trays, bottles, jars, vials, bags, bioreactors) made of a variety of different materials (e.g., plastic, glass) and in various shapes and sizes are known in the art. Those skilled in the art can easily select a suitable cell culture container.
[0123] This invention also provides a culture medium induction supplement that can be used to produce culture induction media as disclosed herein. A “culture medium induction supplement” is a mixture of multiple components that cannot support mesenchymal stem cells on their own, but can enable or improve mesenchymal stem cell culture when combined with other cell culture medium components. Therefore, this supplement can be used to produce suitable culture medium formulations by combining it with other cell culture components, thereby producing the functional cell culture media of this invention. The use of culture medium supplements is well known in the art. This invention provides a culture medium induction supplement comprising the addition of a TLR ligand or TLR ligand inducer in combination with erythropoietin (EPO) and hypoxia or a hypoxia mimic (cobalt chloride or deferoxamine) exposure. The supplement may contain any of the ligands disclosed herein. The supplement may also contain one or more additional cell culture components, for example, one or more cell culture components selected from amino acids, vitamins, inorganic salts, trace elements, carbon sources, and buffers.
[0124] The culture medium induction supplement can be a concentrated liquid supplement (e.g., a 2x to 250x concentrated liquid supplement) or a dry supplement. Both liquid and dry types of supplements are well known in the art. The supplement can be lyophilized.
[0125] The culture medium induction supplements of the present invention are typically sterilized before use, for example, by ultraviolet light, heating, irradiation, or filtration, to prevent contamination. The culture medium induction supplements may be frozen (e.g., at -20°C or -80°C) for storage or transport.
[0126] The present invention also provides an airtight container containing the culture medium supplement of the present invention. The airtight container is preferably used for transporting or storing the culture medium supplement disclosed herein to prevent contamination. The container can be any suitable container, such as a bioreactor, flask, culture plate, bottle, jar, vial, or bag.
[0127] Various materials have been used as surfaces for adhering stem cell cultures, and technicians can easily select suitable materials. Preferably, the solid surface includes plastic, but may alternatively include glass, extracellular matrix, etc. The surface can be planar, tubular, or in the form of a scaffold, beads, or fibers.
[0128] As described elsewhere herein, the compositions of the present invention may contain serum, or may be serum-free and / or serum-free alternatives.
[0129] The mesenchymal stem cells used in this invention can be obtained using known methods (see below). It is conceivable that various types of mesenchymal stem cells can be used in conjunction with this invention, whether obtained from embryos, fetuses or adult tissues, but preferably from adult tissue sources.
[0130] The induction medium disclosed herein can be used to culture mammalian stem cells, particularly human adult stem cells. Mesenchymal stem cells are preferred for use in conjunction with this invention. Mouse or primate stem cells may also be used. In a preferred embodiment, the stem cells are human bone marrow-derived stem cells (MSCs).
[0131] Mesenchymal stem cells can be identified by their ability to differentiate into cells of all three germ layers, for example, by measuring their ability to differentiate into cells that exhibit detectable expression of markers specific to all three germ layers. Unless the context requires otherwise, references to the singular (e.g., "a cell" and equivalent references) include the plural (e.g., "multiple cells").
[0132] The induction medium of the present invention can be used to induce, activate, or induce populations of mesenchymal stem cells. Therefore, the present invention provides the use of any induction medium disclosed herein for inducing, activating, or inducing populations of mesenchymal stem cells into discrete, homogeneous phenotypes for cell-based therapy. These discrete and homogeneous phenotypes may be an anti-inflammatory MSC phenotype (MSC2) and a homogeneous and discrete pro-immunoantitumor MSC phenotype (MSC1).
[0133] The preferred method for inducing a homogeneous and discrete anti-inflammatory MSC phenotype (MSC2) is to incubate MSCs with a medium containing a Toll-like receptor 3 (TLR3) ligand such as polyinosine:polycytidylic acid (or poly(I:C); 1 µg / mL) in combination with erythropoietin (1 mU / mL or 5 ng / mL) and hypoxia (1% oxygen) or hypoxia mimics (cobalt chloride or deferoxamine, both 200 µM) for 1 hour when 70-90% confluence growth is achieved.
[0134] The preferred method for inducing a homogeneous and discrete pro-immunotumor MSC phenotype (MSC1) is to incubate MSCs with a medium containing a Toll-like receptor 4 (TLR4) ligand such as lipopolysaccharide (10 ng / mL LPS, endotoxin) in combination with erythropoietin (1 mU / mL or 5 ng / mL) and hypoxia (1% oxygen) or hypoxia mimics (cobalt chloride or deferoxamine, both 200 µM) for 1 hour when 70-90% confluence growth is achieved.
[0135] TLR ligands, in combination with erythropoietin and hypoxia or hypoxia mimics (cobalt chloride or deferoxamine) exposure, are added to fresh culture medium or incubated with the cells for 1 hour as a culture supplement. Following this induction step, the MSCs are washed twice in a TLR-free medium or a suitable buffered salt solution to remove cell and culture debris. Not wishing to be bound by theory, short incubation times (< 1 hour) at the above (or lower) concentrations and minimal TLR ligand exposure are important for obtaining the desired phenotype, and further, this protocol mimics the gradient of danger signals encountered and responded to by endogenous MSCs at a distance from the site of injury. Upon washing, induced, activated, or triggered MSCs can be harvested by conventional methods such as trypsin and EDTA at 37°C for 5 seconds to 15 minutes, or using trypsin alternatives (e.g., TrypLE from Invitrogen), collagenases, dispersants, accutases, or other reagents known to those skilled in the art. After cell harvesting, induced, activated, or deactivated MSCs can be cryopreserved using standard methods.
[0136] TLR3 or TLR4 agonists may be delivered by incubation, transfection, transduction by a carrier molecule, or by other techniques known to those skilled in the art.
[0137] The cells can be incubated with TLR ligands or agonist ligands (in combination with erythropoietin (EPO) and hypoxia or hypoxia mimics (cobalt chloride or deferoxamine) exposure) for about 1 minute to about 480 minutes, about 5 minutes to about 475 minutes, about 10 minutes to about 470 minutes, about 15 minutes to about 400 minutes, about 20 minutes to about 120 minutes, about 25 minutes to about 90 minutes, about 30 minutes to about 80 minutes, about 35 minutes to about 70 minutes, about 40 minutes to about 65 minutes, about 45 minutes to about 60 minutes, about 55 minutes to about 60 minutes, and preferably about 60 minutes.
[0138] Example
[0139] Example 1 - Induction of MSC2 gene expression marker from human primary MSCs
[0140] For this experiment, primary human MSCs were incubated in serum-free medium containing 2 μg / mL poly(I:C) at 37°C and 5% CO2 for 6 hours. Cells were then washed twice, and RNA was extracted using the RNeasy Mini kit (Qiagen, Valencia, CA), followed by treatment with the TURBO DNA-free kit (Ambion, Austin, TX). RNA was reverse transcribed, and the resulting cDNA was used on an iCycler iQ5 real-time PCR detection system (Bio-Rad, Hercules, CA) in a JAK / STAT signaling pathway RT2 Profiler™ PCR array (SuperArray Bioscience, Frederick, MD) according to the manufacturer's instructions. Raw data from both untreated and treated groups were analyzed using GEarray Analyzer software (SuperArray Inc., Bethesda, MD). This array measured the RNA expression levels of 84 different genes in the JAK / STAT signaling pathway. Results are shown in... Figure 1 In the diagram, genes that are induced 2-fold or more are shown in gray boxes, genes that are reduced to 1 / 2 or less are shown in black boxes, and genes that are induced more than twice and selected for further validation (except for PIAS2, which is reduced to less than 1 / 2) are depicted in thick boxes. Figure 2 Showing selected Figure 1 Further qPCR validation of the gene was performed using SYBR Green Master Mix primers with gene-specific primers via qPCR. Figure 1 The same samples analyzed in the middle were used for verification.
[0141] Example 2 - Polarization of MSC1 and MSC2 from primary human MSCs
[0142] Primary human MSC donors were polarized to MSC1 or MSC2. The MSCs were tested in the absence of MSC1 or in the presence of 0.5 ng / mL recombinant human erythropoietin and 200 μM cobalt chloride. Human MSCs were polarized using a medium containing 10 ng / mL LPS in the absence of LPS (MSC2) or in the presence of 0.5 ng / mL recombinant human erythropoietin and 200 μM cobalt chloride (MSC2). In this case, human MSC2 cells were polarized using a medium containing 2 μg / mL poly(I:C). The culture supernatant was harvested and chemokine / cytokine expression was then analyzed by bio-plex as described previously. Briefly, MSCs were seeded at a density of 50,000 cells in 24-well culture plates, allowed to adhere overnight, and then induced for 1 hr with a TLR agonist as instructed. After 48 hr, the conditioned medium was collected and analyzed using the Bio-Plex cytokine assay (Human Group I & II; Bio-Rad, Hercules, CA) according to the manufacturer's instructions. These experiments were performed at least three times for three separate MSC donor banks. Formulation-independent MSC1 induction resulted in significant secretion of cytokines, including IL6 and IL8. Figure 3 ), while formulation-independent MSC2 induction led to significant secretion of IP10 (CXCL10) and RANTES (CCL5). Figure 4 The error bar indicates + / - SEM.
[0143] Example 3 - MSC1 and MSC2 polarization are consistent across multiple sources of MSCs.
[0144] Human MSCs from three different commercial sources and up to six different donors were polarized into MSC1. MSC1 was obtained in the absence of MSC1 or in the presence of 0.5 ng / mL recombinant human erythropoietin and 200 μM cobalt chloride. Human MSCs were polarized using a medium containing 10 ng / mL LPS. Total RNA was isolated, purified, and reverse transcribed into cDNA. Quantitative real-time PCR was performed using SYBR GreenMaster Mix. Data were analyzed using quantitative comparison CT to correlate target gene expression with... 18S rRNA Housekeeping genes were normalized and showed a fold increase relative to the untreated control. In all donors, including mixed donors, MSC1 induction showed [further details needed]. Trail Gene expression significantly increased ( Figure 5 The error bars represent the standard error (SEM) of the + / - mean. Human cDNA primers used: Cxcl9Forward - CTT TCCTGG CTA CTC CAT GTT Reverse - GTT GGTCACTGG CTG ATC TAT AA; Trail Forward - CTT CAC AGT GCT CCT GCA GT Reverse - TTA GCC AACTAAAAA GGC CCC; 18S rRNA Forward - GAGGGAGCCTGAGAAACGG, Reverse - GTCGGGAGTGGGTAATTTGC, where the scheme is: 1: 95.0°C for 0:30, 2: 95.0°C for 0:10, 3: 68.0°C for 0:30, read the board, 4: go to 2, 39 times or more.
[0145] Human MSCs from three different commercial sources and up to six different donors were polarized into MSC2. MSC2 was obtained in the absence of MSC2 or in the presence of 0.5 ng / mL human recombinant erythropoietin and 200 μM cobalt chloride. Human MSCs were polarized using a medium containing 2 μg / mL poly(I:C). Total RNA was isolated, purified, and reverse transcribed into cDNA. Quantitative real-time PCR was performed using SYBR Green Master Mix. Data were analyzed using the quantitative comparative CT method to normalize target gene expression relative to 18S rRNA housekeeping genes and show a fold increase relative to untreated controls. In all donors, including mixed donors, MSC2 induction showed... CXCL9 Gene expression significantly increased ( Figure 6 The error bars represent the standard error (SEM) of the + / - mean.
[0146] Example 4 - Time progression of polarization of MSC1 and MSC2.
[0147] Human MSC donors were polarized to MSC1. In the absence of MSC1 or in the presence of 0.5 ng / mL human recombinant erythropoietin and 200 μM cobalt chloride (MSC1), Human MSCs were polarized using medium containing 10 ng / mL LPS. Cells were harvested at different times as instructed. Total RNA was isolated, purified, and reverse transcribed into cDNA. Quantitative real-time PCR was performed using SYBR Green Master Mix. Data were analyzed using the quantitative comparison CT method to normalize target gene expression relative to 18S rRNA housekeeping genes and show an increase relative to the untreated control. Trail gene expression was significantly increased 4 hours after MSC1 induction (…). Figure 7 The error bars represent the standard error (SEM) of the + / - mean.
[0148] Human MSC donors were polarized to MSC2. In the absence of MSC2 or in the presence of 0.5 ng / mL recombinant human erythropoietin and 200 μM cobalt chloride (MSC2), the MSC2 donor was polarized to MSC2. Human MSCs were polarized using a medium containing 2 μg / mL poly(I:C). Cells were harvested at different time points as instructed. Total RNA was isolated, purified, and reverse transcribed into cDNA. Quantitative real-time PCR was performed using SYBR Green Master Mix. Data were analyzed using the quantitative comparative CT method to normalize target gene expression relative to 18S rRNA housekeeping genes and show a fold increase relative to the untreated control. Four hours after MSC2 induction, Cxcl9 gene expression was significantly increased (…). Figure 8 The error bars represent the standard error (SEM) of the + / - mean.
[0149] Example 5 - Biodistribution of MSC1 and MSC2 cells
[0150] An in vivo efficacy study was conducted to determine the difference between polarized MSCs and immature MSCs. For this study, human immature MSCs, MSC1, and MSC2 (1 million cells) were administered to wild-type mice via intraperitoneal injection, and all organs were harvested 4 hours later. Subsequently, the extracted RNA was measured against human GAPDH and compared with mouse GAPDH DNA to determine tissue homing. The results are shown in Table 1 below.
[0151]
[0152] Example 6 - Incubation with erythropoietin and cobalt chloride during MSC polarization increased the migration, proliferation / viability of MSC1 and MSC2 cells.
[0153] To determine the migration ability of MSCs cultured in the presence or absence of erythropoietin and under hypoxic conditions, human juvenile MSCs and MSC1 or MSC2 polarized cells were added to separate Transwell inserts (8 μM wells, 50,000 cells / insertion). Cell migration was assessed in the absence of MSC1 or in the presence of 0.5 ng / mL human recombinant erythropoietin and 200 μM cobalt chloride. MSC1 cells were polarized using a medium containing 10 ng / mL LPS in the absence of LPS (MSC2) or in the presence of 0.5 ng / mL recombinant human erythropoietin and 200 μM cobalt chloride (MSC2). Human MSC2 cells were polarized using a medium containing 2 μg / mL poly(I:C). The membrane was then lowered into a 24-well companion plate containing serum-free medium (SFM) for negative control, serum-containing growth medium (CCM) for positive control, or the corresponding induction medium indicated. After incubation for 16 hours, photomicrographs were taken using a Nikon Eclipse TE300 inverted fluorescence microscope. Figure 9 This displays representative data of migrating MSCs counted from four representative image quadrants from more than three independently conducted triple replicate experiments (n = 3). Error bars indicate SEM.
[0154] Proliferation assays were used to determine the proliferative capacity and viability of MSCs cultured under conditions of erythropoietin presence or absence and hypoxia. The assays were performed in the absence of erythropoietin (MSC1) or in the presence of 0.5 ng / mL recombinant human erythropoietin and 200 μM cobalt chloride (MSC1). Human MSCs were polarized using a medium containing 10 ng / mL LPS in the absence of (MSC2) or in the presence of 0.5 ng / mL recombinant human erythropoietin and 200 μM cobalt chloride (MSC2). Human MSC2 cells were polarized using a medium containing 2 μg / mL poly(I:C). Cells were incubated with the specific medium for 48 hours. Cell proliferation and viability from each sample were measured using CyQUANT assay (Life Technologies, CA) and trypan blue assay, respectively. For cell proliferation, cells were tripled and incubated in 50 μl wells at a concentration of 1 × 10⁻⁶ cells / well. 3 Cells were seeded in 96-well plates and cultured at 37°C, 5% CO2. Samples were harvested at 0, 24, 48, 72, and 96 hours post-treatment and processed according to the manufacturer's (CyQUANT assay, Life Technologies, CA) description. Data are presented relative to the untreated control. Cell proliferation assays were performed in at least three independent experiments, with each sample replicated in eight wells of the 96-well plate (n=3). Error bars indicate SEM. Results are shown in [image / image / etc.]. Figure 10 middle.
[0155] Example 7 - Validation of qPCR assays for CXCL9 and TNFSF10
[0156] Human MSCs were induced into MSC1. Total RNA was isolated, purified, and reverse transcribed into cDNA. Quantitative real-time PCR was performed using SYBR GreenMaster Mix. Data were analyzed using the quantitative comparison CT method to normalize target gene expression relative to 18S rRNA housekeeping genes and show it as a fold increase relative to the untreated control. Trail gene expression was significantly increased after MSC1 induction. Error bars represent the standard error (SEM) of the + / - mean. Primer efficiency and product specificity were determined. Figure 11 ).
[0157] Human MSCs were induced into MSC2. Total RNA was isolated, purified, and reverse transcribed into cDNA. Quantitative real-time PCR was performed using SYBR GreenMaster Mix. Quantitative comparative CT (CT) method was used to analyze the data, normalizing target gene expression relative to 18S rRNA housekeeping genes and showing it as a fold increase relative to the untreated control. Cxcl9 gene expression significantly increased after MSC2 induction. Error bars represent the standard error (SEM) of the + / - mean. The time course of gene expression was determined. Figure 12 A) and product specificity ( Figure 12 B).
[0158] This application provides the following implementation scheme:
[0159] 1. An induction medium for generating an immune-polarized mesenchymal stem cell population from an unstimulated mesenchymal stem cell population, the induction medium comprising:
[0160] a. Toll-like receptor 3 (TLR3) ligand,
[0161] b. Erythropoietin, and
[0162] c. 0.5-2% oxygen or hypoxia simulant,
[0163] The immune-polarized mesenchymal stem cell population described therein possesses anti-inflammatory properties marked by the expression of anti-inflammatory or immunosuppressive mediators.
[0164] 2. The induction culture medium according to embodiment 1, wherein the Toll-like receptor 3 (TLR3) ligand is poly(I:C).
[0165] 3. The induction culture medium according to embodiment 1, wherein the Toll-like receptor 3 (TLR3) ligand is poly(A:U).
[0166] 4. The induction culture medium according to embodiment 1, wherein the erythropoietin is present at a concentration of less than 10 ng / mL.
[0167] 5. The induction culture medium according to embodiment 1, wherein the hypoxia mimic is cobalt chloride.
[0168] 6. The induction culture medium according to embodiment 5, wherein the cobalt chloride is present at a concentration of 5 μM to 500 μM.
[0169] 7. The induction culture medium according to embodiment 1, further comprising interleukin-4 (IL-4).
[0170] 8. The induction culture medium according to embodiment 1, further comprising interleukin-13 (IL-13).
[0171] 9. The induction culture medium according to embodiment 1 does not contain serum of human or animal origin.
[0172] 10. The induction culture medium according to Implementation Scheme 1 is a concentrated solution.
[0173] 11. A population of mesenchymal stem cells treated with the induction medium of Implementation Scheme 1.
[0174] 12. Human mesenchymal stem cell population treated with the induction medium of Implementation Scheme 1.
[0175] 13. A population of mesenchymal stem cells from dogs, cats, or horses treated with the induction medium of Implementation Scheme 1.
[0176] 14. A population of mesenchymal stem cells treated with the induction medium of embodiment 1, wherein the mesenchymal stem cells are derived from pluripotent stem cells.
[0177] 15. A population of mesenchymal stem cells treated with the induction medium of Embodiment 1, wherein the cells are characterized by increased CXCL9 mRNA expression compared with an unstimulated population of mesenchymal stem cells.
[0178] 16. A population of mesenchymal stem cells treated with the induction medium of embodiment 1, wherein the cells are characterized by increased OAS1 mRNA expression compared with an unstimulated population of mesenchymal stem cells.
[0179] 17. A population of mesenchymal stem cells treated with the induction medium of Embodiment 1, wherein the cells are characterized by increased ISG15 mRNA expression compared with an unstimulated population of mesenchymal stem cells.
[0180] 18. A composition for treating a disease comprising a population of mesenchymal stem cells treated with the induction medium of embodiment 1, wherein the disease is an inflammatory or autoimmune condition.
[0181] 19. The composition according to embodiment 18, wherein the inflammatory or autoimmune condition is rheumatoid arthritis.
[0182] 20. The composition according to embodiment 18, wherein the inflammatory or autoimmune condition is inflammatory bowel disease.
[0183] 21. The composition according to embodiment 18, wherein the inflammatory or autoimmune condition is acute optic neuritis.
[0184] 22. The composition according to embodiment 18, wherein the inflammatory or autoimmune condition is Clapham disease.
[0185] 23. The composition according to embodiment 18, wherein the inflammatory or autoimmune condition is diabetic retinopathy.
[0186] 24. The composition according to embodiment 18, wherein the inflammatory or autoimmune condition is Crohn's disease.
[0187] 25. The composition according to embodiment 18, wherein the inflammatory or autoimmune condition is acute lung injury.
[0188] 26. An induction medium for generating an immune-polarized mesenchymal stem cell population from an unstimulated mesenchymal stem cell population, the induction medium comprising:
[0189] a. Toll-like receptor 4 (TLR4) ligand,
[0190] b. Erythropoietin, and
[0191] c. 0.5-2% oxygen or hypoxia simulant,
[0192] The immune-polarized mesenchymal stem cell population described therein exhibits pro-inflammatory properties marked by the expression of pro-inflammatory mediators.
[0193] 27. The induction medium according to embodiment 26, wherein the Toll-like receptor 4 (TLR4) ligand is lipopolysaccharide (LPS).
[0194] 28. The induction medium according to embodiment 26, wherein the Toll-like receptor 4 (TLR4) ligand is an aminoalkylglucosinolate 4-phosphate.
[0195] 29. The induction culture medium according to embodiment 26, wherein the erythropoietin is present at a concentration of less than 10 ng / mL.
[0196] 30. The induction culture medium according to embodiment 26, wherein the hypoxia mimic is cobalt chloride.
[0197] 31. The induction culture medium according to embodiment 30, wherein the cobalt chloride is present at a concentration of 5 μM to 500 μM.
[0198] 32. The induction culture medium according to embodiment 26, further comprising interferon.
[0199] 33. The induction culture medium according to embodiment 26, further comprising tumor necrosis factor α (TNFα).
[0200] 34. The induction culture medium according to embodiment 26 does not contain serum of human or animal origin.
[0201] 35. The induction culture medium according to Implementation Scheme 26 is a concentrated solution.
[0202] 36. A population of mesenchymal stem cells treated with the induction medium of implementation scheme 26.
[0203] 37. Human mesenchymal stem cell population treated with the induction medium of Implementation Scheme 26.
[0204] 38. A population of mesenchymal stem cells from dogs, cats, or horses treated with the induction medium of Implementation Scheme 26.
[0205] 39. A population of mesenchymal stem cells treated with the induction medium of embodiment 26, wherein the mesenchymal stem cells are derived from pluripotent stem cells.
[0206] 40. A population of mesenchymal stem cells treated with the induction medium of embodiment 26, wherein the cells are characterized by increased expression of TNFSF10 (TRAIL) mRNA compared with an unstimulated population of mesenchymal stem cells.
[0207] 41. A composition for treating a disease comprising a population of mesenchymal stem cells treated with the induction medium of embodiment 26, wherein the disease is cancer.
[0208] 42. A composition for treating a disease comprising a population of mesenchymal stem cells treated with the induction medium of embodiment 26, wherein the disease is ovarian cancer.
[0209] 43. A composition for treating a disease comprising a population of mesenchymal stem cells treated with the induction medium of embodiment 26, wherein the disease is uveal melanoma.
[0210] 44. A composition for treating a disease comprising a population of mesenchymal stem cells treated with the induction medium of embodiment 26, wherein the disease is a viral condition.
[0211] 45. A composition for treating a disease comprising a population of mesenchymal stem cells treated with the induction medium of embodiment 26, wherein the disease is a bacterial infection.
[0212] 46. An induction medium for generating an immune-polarized mesenchymal stem cell population from an unstimulated mesenchymal stem cell population, the induction medium comprising:
[0213] a. Poly(I:C) at concentrations from 0.1 μg / mL to 100 μg / mL.
[0214] b. Erythropoietin concentrations below 10 ng / mL, and
[0215] c. Cobalt chloride at concentrations ranging from 5 μM to 500 μM.
[0216] The immune-polarized mesenchymal stem cell population described therein possesses anti-inflammatory properties, marked by increased expression of CXCL9, OAS1, and ISG15 mRNA compared to the unstimulated mesenchymal stem cell population.
[0217] 47. An induction medium for generating an immune-polarized mesenchymal stem cell population from an unstimulated mesenchymal stem cell population, the induction medium comprising:
[0218] a. LPS at concentrations from 0.1 ng / mL to 1 μg / mL,
[0219] b. Erythropoietin concentrations below 10 ng / mL, and
[0220] c. Cobalt chloride at concentrations ranging from 5 μM to 500 μM.
[0221] The immune-polarized mesenchymal stem cell population described therein has pro-inflammatory properties, marked by increased TNFSF10 (TRAIL) expression compared to unstimulated mesenchymal stem cell populations.
[0222] 48. A method for generating an immune-polarized mesenchymal stem cell population from an unstimulated mesenchymal stem cell population, the method comprising contacting the unstimulated mesenchymal stem cell population with a composition comprising: a Toll-like receptor 3 (TLR3) ligand, erythropoietin, and exposure to hypoxia or a hypoxia mimic, wherein the immune-polarized mesenchymal stem cell population has anti-inflammatory properties marked by the expression of anti-inflammatory or immunosuppressive mediators.
[0223] 49. The method according to embodiment 48, wherein the Toll-like receptor 3 (TLR3) ligand is poly(I:C).
[0224] 50. The method according to embodiment 48, wherein the Toll-like receptor 3 (TLR3) ligand is poly(A:U).
[0225] 51. The method according to embodiment 48, wherein the erythropoietin is present at a concentration of less than 10 ng / mL.
[0226] 52. The method according to embodiment 48, wherein the hypoxia simulant is cobalt chloride.
[0227] 53. The method according to embodiment 52, wherein the cobalt chloride is present at a concentration of 5 μM to 500 μM.
[0228] 54. The method according to embodiment 48, wherein the composition further comprises interleukin-4 (IL-4).
[0229] 55. The method according to embodiment 48, wherein the composition further comprises interleukin-13 (IL-13).
[0230] 56. The method according to embodiment 48, wherein the composition does not contain serum of human or animal origin.
[0231] 57. The method according to embodiment 48, wherein the composition is a concentrate.
[0232] 58. The method according to embodiment 48, wherein the unstimulated mesenchymal stem cell population is simultaneously contacted with a Toll-like receptor 3 (TLR3) ligand, erythropoietin, and hypoxia or a hypoxia mimic.
[0233] 59. The method according to embodiment 48, wherein the composition is in contact with the unstimulated mesenchymal stem cell population for at least 30 minutes but less than 8 hours.
[0234] 60. The method according to embodiment 48 further includes monitoring CXCL9 expression at the RNA or protein level.
[0235] 61. The method according to embodiment 48 further includes monitoring the expression of OAS1 at the RNA or protein level.
[0236] 62. The method according to embodiment 48 further includes monitoring ISG15 expression at the RNA or protein level.
[0237] 63. A population of mesenchymal stem cells treated using the method described in implementation scheme 48.
[0238] 64. Human mesenchymal stem cell population treated using the method described in implementation scheme 48.
[0239] 65. A population of mesenchymal stem cells from dogs, cats, or horses treated using the method described in implementation plan 48.
[0240] 66. A population of mesenchymal stem cells treated by the method of implementation scheme 48, wherein the mesenchymal stem cells are derived from pluripotent stem cells.
[0241] 67. A population of mesenchymal stem cells treated by the method of embodiment 48, wherein the cells are characterized by increased CXCL9 mRNA expression compared with an unstimulated population of mesenchymal stem cells.
[0242] 68. A population of mesenchymal stem cells treated by the method of embodiment 48, wherein the cells are characterized by increased OAS1 mRNA expression compared with an unstimulated population of mesenchymal stem cells.
[0243] 69. A population of mesenchymal stem cells treated by the method of embodiment 48, wherein the cells are characterized by increased ISG15 mRNA expression compared with an unstimulated population of mesenchymal stem cells.
[0244] 70. A method for treating a disease comprising a population of mesenchymal stem cells treated by the method of embodiment 48, wherein the disease is an inflammatory or autoimmune condition.
[0245] 71. The method according to implementation plan 70, wherein the inflammatory or autoimmune condition is rheumatoid arthritis.
[0246] 72. The method according to implementation plan 70, wherein the inflammatory or autoimmune condition is inflammatory bowel disease.
[0247] 73. The method according to implementation plan 70, wherein the inflammatory or autoimmune condition is rheumatoid arthritis.
[0248] 74. The method according to embodiment 70, wherein the inflammatory or autoimmune condition is acute optic neuritis.
[0249] 75. The method according to embodiment 70, wherein the inflammatory or autoimmune condition is Clapham disease.
[0250] 76. The method according to embodiment 70, wherein the inflammatory or autoimmune condition is diabetic retinopathy.
[0251] 77. The method according to embodiment 70, wherein the inflammatory or autoimmune condition is Crohn's disease.
[0252] 78. The method according to implementation plan 70, wherein the inflammatory or autoimmune condition is acute lung injury.
[0253] 79. A method for generating an immune-polarized mesenchymal stem cell population from an unstimulated mesenchymal stem cell population, the method comprising: contacting the unstimulated mesenchymal stem cell population with a composition comprising: a Toll-like receptor 4 (TLR4) ligand, erythropoietin, and exposure to hypoxia or a hypoxia mimic, wherein the immune-polarized mesenchymal stem cell population has pro-inflammatory properties marked by the expression of pro-inflammatory mediators.
[0254] 80. The method according to embodiment 79, wherein the Toll-like receptor 4 (TLR4) ligand is lipopolysaccharide (LPS).
[0255] 81. The method according to embodiment 79, wherein the Toll-like receptor 4 (TLR4) ligand is an aminoalkylglucosinolate 4-phosphate.
[0256] 82. The method according to embodiment 79, wherein the erythropoietin is present at a concentration of less than 10 ng / mL.
[0257] 83. The method according to embodiment 79, wherein the hypoxia simulant is cobalt chloride.
[0258] 84. The method according to embodiment 83, wherein the cobalt chloride is present at a concentration of 5 μM to 500 μM.
[0259] 85. The method according to embodiment 79, wherein the composition further comprises interferon.
[0260] 86. The method according to embodiment 79, wherein the composition further comprises tumor necrosis factor α (TNFα).
[0261] 87. The method according to embodiment 79, wherein the composition does not contain serum of human or animal origin.
[0262] 88. The method according to embodiment 79, wherein the composition is a concentrate.
[0263] 89. The method according to embodiment 79, wherein the unstimulated mesenchymal stem cell population is simultaneously contacted with Toll-like receptor 4 (TLR4) ligand, erythropoietin, and hypoxia or a hypoxia mimic.
[0264] 90. The method according to embodiment 79, wherein the composition is in contact with the unstimulated mesenchymal stem cell population for at least 30 minutes but less than 8 hours.
[0265] 91. The method according to embodiment 79 further includes monitoring the expression of TNFSF10 (TRAIL) at the RNA or protein level.
[0266] 92. A population of mesenchymal stem cells treated using the method described in implementation plan 79.
[0267] 93. Human mesenchymal stem cell populations treated using the method described in implementation plan 79.
[0268] 94. A population of mesenchymal stem cells from dogs, cats, or horses treated using the method described in implementation plan 79.
[0269] 95. A population of mesenchymal stem cells treated by the method of implementation scheme 79, wherein the mesenchymal stem cells are derived from pluripotent stem cells.
[0270] 96. A population of mesenchymal stem cells treated by the method of embodiment 79, wherein the cells are characterized by increased expression of TNFSF10 (TRAIL) mRNA compared with an unstimulated population of mesenchymal stem cells.
[0271] 97. A method for treating a disease, wherein the disease is cancer, includes a population of mesenchymal stem cells treated by the method of embodiment 79.
[0272] 98. A method for treating a disease comprising a population of mesenchymal stem cells treated by the method of embodiment 97, wherein the cancer is ovarian cancer.
[0273] 99. A method for treating a disease comprising a population of mesenchymal stem cells treated by the method of embodiment 97, wherein the cancer is uveal melanoma.
[0274] 100. A method for treating a disease comprising a population of mesenchymal stem cells treated by the method of embodiment 79, wherein the disease is a viral condition.
[0275] 101. A method for treating a disease comprising a population of mesenchymal stem cells treated by the method of embodiment 79, wherein the disease is a bacterial infection.
[0276] While the invention has been described in detail with particular reference to its preferred embodiments, the principles and modes of operation of the invention are also described herein. The invention should not be construed as limited to the specific forms disclosed, which are illustrative rather than restrictive. Modifications, variations, and alterations can be made by those skilled in the art without departing from the spirit and scope of the invention as set forth in the appended claims.
[0277] While preferred embodiments of the invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Many modifications, alterations, and substitutions will occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein can be used to practice the invention. The scope of the invention is intended to be defined by the following claims, and is intended to cover the methods and structures within the scope of these claims and their equivalents.
Claims
1. A method for generating an immune-polarized pluripotent stem cell population, the method comprising: A population of pluripotent stem cells is cultured under hypoxic conditions in a culture medium comprising: (a) Toll-like receptor 3 (TLR3) ligand; and (b) Erythropoietin; The immune-polarized pluripotent stem cell population expressed one or more anti-inflammatory or immunosuppressive molecules.
2. The method according to claim 1, wherein the pluripotent stem cells are obtained from humans.
3. The method according to claim 1, wherein the pluripotent stem cell is a mesenchymal stem cell (MSC).
4. The method of claim 1, wherein the hypoxia condition includes the presence of a hypoxia simulant in the culture medium.
5. The method according to claim 4, wherein the hypoxia mimic is cobalt chloride.
6. The method of claim 5, wherein the cobalt chloride is present at a concentration of 5 μM to 500 μM.
7. The method according to claim 4, wherein the hypoxia mimic is deferoxamine.
8. The method of claim 7, wherein the deferoxamine is present at a concentration of 10 μM to 1 mM.
9. The method of claim 1, wherein the hypoxic conditions comprise culturing the pluripotent stem cells at less than 2% oxygen.
10. The method of claim 9, wherein the hypoxic conditions comprise culturing the pluripotent stem cells at 0.5% to 2% oxygen.
11. The method of claim 1, wherein the TLR3 ligand is poly(I:C) or poly(A:U).
12. The method of claim 11, wherein the concentration of the TLR3 ligand is from 10 pg / ml to 100 µg / ml.
13. The method of claim 1, wherein the culture medium further comprises interleukin-4 (IL-4) and / or interleukin-13 (IL-13).
14. The method of claim 1, wherein the concentration of erythropoietin is from 0.1 ng / ml to 1 mg / ml.
15. The method of claim 1, wherein the anti-inflammatory or immunosuppressive molecule is one or more of CXCL9, OAS1, and ISG15.
16. A method for generating an immune-polarized pluripotent stem cell population, the method comprising: A population of pluripotent stem cells is cultured under hypoxic conditions in a culture medium comprising: (a) Toll-like receptor 4 (TLR4) ligand; and (b) Erythropoietin; The immune-polarized pluripotent stem cell population expressed one or more pro-inflammatory molecules.
17. The method of claim 16, wherein the pluripotent stem cells are obtained from humans.
18. The method of claim 16, wherein the pluripotent stem cell is a mesenchymal stem cell (MSC).
19. The method of claim 16, wherein the hypoxia condition includes the presence of a hypoxia simulant in the culture medium.
20. The method of claim 19, wherein the hypoxia mimic is cobalt chloride.
21. The method of claim 20, wherein the cobalt chloride is present at a concentration of 5 μM to 500 μM.
22. The method of claim 19, wherein the hypoxia mimic is deferoxamine.
23. The method of claim 22, wherein the deferoxamine is present at a concentration of 10 μM to 1 mM.
24. The method of claim 16, wherein the hypoxic conditions comprise culturing the pluripotent stem cells at less than 2% oxygen.
25. The method of claim 24, wherein the hypoxic conditions comprise culturing the pluripotent stem cells at 0.5% to 2% oxygen.
26. The method of claim 16, wherein the TLR4 ligand is lipopolysaccharide (LPS) or aminoalkylglucosinolate 4-phosphate.
27. The method of claim 26, wherein the concentration of the TLR4 ligand is from 10 pg / mL to 10 µg / mL.
28. The method of claim 16, wherein the culture medium further comprises tumor necrosis factor α (TNFα), granulocyte-macrophage colony-stimulating factor (GM-CSF), or interferon.
29. The method of claim 16, wherein the concentration of erythropoietin is from 0.1 ng / ml to 1 mg / ml.
30. The method of claim 16, wherein the pro-inflammatory molecule is TNFSF10 (TRAIL).