Application of KLF13 gene regulatory factor in aging of large vessel arteries and veins

Abstract

This invention belongs to the field of biomedical technology and discloses the application of the KLF13 gene regulator in the aging of large blood vessels' arteries and veins. Through systematic analysis of KLF13 gene knockout mice, this invention demonstrates that KLF13 is an important protective factor in maintaining vascular homeostasis. In vitro experiments show that KLF13 knockdown increases DNA damage and decreases proliferation capacity in cells, suggesting that KLF13 plays a protective role against vascular aging. Among vascular cell types, KLF13 knockdown shows the most significant changes in endothelial cells, resulting in decreased arteriovenous endothelial migration and tubular function. This reveals the core role of KLF13 in maintaining vascular homeostasis. These findings not only establish KLF13's status as a key vascular protective factor at the functional level, but also suggest that its dysfunction may be closely related to the occurrence and development of vascular aging and related diseases. This provides a theoretical and practical basis for developing products that identify vascular cell aging.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and more specifically, relates to the application of KLF13 gene regulatory factor in the aging of large blood vessel arteries and veins. Background Technology

[0002] Vascular aging is a core aspect of overall aging, characterized by structural remodeling of the vascular wall (e.g., luminal dilation, decreased elasticity) and functional decline (e.g., increased stiffness, accelerated pulse wave velocity). Aging of large blood vessels (e.g., aorta, portal vein, inferior vena cava) is an independent risk factor for the development of various age-related cardiovascular diseases, including hypertension, atherosclerosis, aneurysms, and venous insufficiency. Currently, clinical assessment of vascular aging relies heavily on macroscopic indicators such as imaging (e.g., ultrasound, MRI measurement of vessel diameter) and functional parameters (e.g., pulse wave velocity measurement), lacking specific molecular markers for early warning and intervention in the early or subclinical stages of aging.

[0003] Krüppel-like factor 13 (KLF13) is a member of the KLF family of transcription factors, known to play roles in cardiac development, immune regulation, and some tumor progressions. However, its specific function in vascular homeostasis, particularly in the aging process of large vessel arteries and veins, remains unknown. Elucidating the role of KLF13 in vascular aging is of great significance for revealing the molecular mechanisms of vascular aging, identifying early diagnostic biomarkers, and developing new intervention targets. Summary of the Invention

[0004] Based on the aforementioned deficiencies in existing technologies, this invention first provides a novel method for identifying vascular aging based on KLF13 as a marker.

[0005] This invention first protects the use of substances for detecting KLF13 gene expression in the preparation of products for identifying and / or assisting in the identification of the aging degree of different vascular cells. The vascular cells are one, two, or more of the following: human arterial endothelial cells, human inferior vena cava endothelial cells, human arterial smooth muscle cells, human inferior vena cava smooth muscle cells, and human arterial fibroblasts.

[0006] Preferably, in the above applications, the vascular cell senescence exhibits at least one of the following characteristics:

[0007] (1) Premature dilation of arterial and venous vessel diameters;

[0008] (2) Increased DNA damage in vascular endothelial cells;

[0009] (3) Decreased proliferative capacity of vascular endothelial cells;

[0010] (4) Decreased migration ability of vascular endothelial cells;

[0011] (5) Decreased tube-forming ability of vascular endothelial cells.

[0012] In identifying or assisting in the identification of different degrees of aging in vascular cells, the aging degree of test vascular cells with low KLF13 expression is higher than that of test vascular cells with high KLF13 expression. The above products can be formulated into reagents or kits.

[0013] Preferably, in the above applications, the substance used to detect KLF13 gene expression is a reagent capable of specifically binding to or recognizing the KLF13 gene nucleic acid sequence or KLF13 protein.

[0014] Specifically, the reagents that can specifically bind to or recognize the KLF13 gene nucleic acid sequence are KLF13 specific primer pairs and KLF13 probes; the reagents that can specifically bind to or recognize the KLF13 protein are KLF13 protein antibodies.

[0015] As one specific implementation method, the sequence of the KLF13 specific primer pair is as follows:

[0016] F: TGCTCATTTGCCCAATGCCT;

[0017] R: CAGGGAGCCTTATGGTACTGTCCA.

[0018] This invention evaluated the role of KLF13 in endothelial cell migration using a scratch assay. The results showed that KLF13 knockdown significantly reduced the scratch healing rate of arterial endothelial cells. A tube-forming assay assessed the role of KLF13 in endothelial cell angiogenesis, revealing that KLF13 knockdown significantly reduced the number of nodes formed by HIVCEC cells and significantly shortened the total branch length, indicating severely impaired vascular network formation ability. In summary, this analysis demonstrates that KLF13 knockdown has the most significant impact on endothelial cells among vascular cell types, leading to decreased arterial and venous endothelial migration and tube-forming function.

[0019] Therefore, this invention also protects the use of substances that inhibit KLF13 gene expression in the preparation of products that inhibit the migration of vascular endothelial cells in vitro.

[0020] This invention also protects the use of substances that inhibit KLF13 gene expression in the preparation of products that inhibit the tube-forming ability of vascular endothelial cells in vitro.

[0021] Preferably, in the above applications, the substance that inhibits KLF13 gene expression is a small interfering RNA that interferes with KLF13 expression.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] This invention utilizes a specific cleavage of the second exon of the Klf13 gene on mouse chromosome 7 to effectively disrupt gene function, successfully constructing a reliable Klf13 gene knockout mouse model. Systematic analysis of these Klf13 knockout mice, from both structural and functional perspectives, demonstrates that Klf13 is a crucial protective factor for maintaining vascular homeostasis. This model also provides a valuable experimental basis for further exploring the specific mechanisms of Klf13 in age-related vascular diseases.

[0024] In vitro experiments showed that KLF13 knockdown increased DNA damage and decreased proliferation in cells, suggesting that KLF13 plays a protective role against vascular aging. Among vascular cell types, KLF13 knockdown resulted in the most significant changes in endothelial cells, leading to decreased arteriovenous endothelial migration and tubular function. This reveals the core role of KLF13 in maintaining vascular homeostasis. These findings not only establish KLF13 as a key vascular protective factor at the functional level, but also suggest that its dysfunction may be closely related to the development and progression of vascular aging and related diseases. This provides a theoretical and practical basis for developing products that identify vascular cell aging. Attached Figure Description

[0025] Figure 1 The expression level of KLF13 was significantly reduced during the vascular aging process in humans and mice; (A) Schematic diagram of the number of single-cell transcriptome samples collected and analyzed from large blood vessels in mice and humans; (B) Annotation map of single-cell transcriptomes from large blood vessels in mice and humans; (C) Expression level of KLF13 during the aging process in mice and humans.

[0026] Figure 2 The study shows significant changes in vascular aging phenotypes in Klf13 knockout mice starting at 7 months of age; (A) Schematic diagram of gene targeting strategy in Klf13 knockout mice; (B) Immunoblotting showing Klf13 protein levels in wild-type, homozygous, and heterozygous Klf13 knockout mice; n = 3, independent biological replicates; (C) Immunofluorescence staining of Klf13 in wild-type and homozygous Klf13 knockout mice; (D) Wild-type and Klf13 levels in mice at 7 and 24 months of age. - / - Magnetic resonance imaging of the aorta, inferior vena cava, and portal vein lumens in 7-month-old mice; (E) Statistical analysis of the aorta, inferior vena cava, and portal vein lumens in wild-type and Klf13- / - mice aged 7 and 24 months; (F) Statistical analysis of PWV in wild-type, heterozygous, and homozygous Klf13 knockout mice aged 7 months; Data are presented as mean ± standard deviation; ns, not significant, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001;

[0027] Figure 3Immunofluorescence staining showing DNA damage and proliferation function of the main vascular cell types after KLF13 knockdown; (A) Immunoblotting showing the Klf13 protein level in human arterial endothelial cells (HAEC) transfected with negative control siRNA (siNC) and KLF13 siRNA (siKlf13); (B) Immunofluorescence staining of γH2AX and Ki67 and the percentage of positive cells in human arterial endothelial cells (HAEC) and human inferior vena cava endothelial cells (HIVCEC) transfected with negative control siRNA (siNC) and KLF13 siRNA (siKlf13); γH2AX (green); Ki67 (green); cell nuclei counterstained with DAPI (blue), scale bar at 200um; (C) Immunofluorescence staining of vascular cells (HASMC human arterial smooth muscle cells, HIVCSMC human inferior vena cava smooth muscle cells, HAF human arterial fibroblasts) transfected with negative control siRNA (siNC) and KLF13 siRNA. Immunofluorescence staining of γH2AX and Ki67 after siRNA (siKlf13) administration: γH2AX (green); Ki67 (green); cell nuclei counterstained with DAPI (blue), scale bar at 200 μm; (D) Statistical analysis of the percentage of γH2AX and Ki67 positive cells in major vascular cells; Statistical analysis was performed using one-way ANOVA, and the data are presented as mean ± standard deviation; ns, not significant, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001;

[0028] Figure 4 The scratch and tube formation experiments of arteriovenous endothelial cells after KLF13 knockdown are shown; (A) Scratch experiment and scratch healing statistics of human arterial endothelial (HAEC) and human inferior vena cava endothelial (HIVCEC) cells transfected with Klf13 siRNA (siKlf13) or negative control siRNA (siNC); orange lines represent the initial scratch and the incision 24 h after scratching; the scale bar for HAEC is 200 μm; the scale bar for HIVCEC is 1 mm; (B) Tube formation experiment of human inferior vena cava endothelial (HIVCEC) cells and statistics of the number of cell nodes and total branch length; Statistical analysis was performed using one-way ANOVA, and the data are presented as mean ± standard deviation, ns, not significant, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Detailed Implementation

[0029] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below with reference to specific drawings and embodiments. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.

[0030] Experimental methods

[0031] I. Construction of KLF13 knockout mice

[0032] Three-week-old B6 / JGpt Klf13-KO mice were purchased from a laboratory animal supplier and bred to produce Klf13 mice. + / - ×Klf13 + / - Five batches were used; two batches were raised to 18 months, and the remaining batches underwent vascular aging phenotype testing at 3, 6, and 12 months, respectively. Throughout the period, mouse weight and survival were continuously monitored. The knockout mouse model was constructed by specifically cutting the second exon of the Klf13 gene on mouse chromosome 7, thereby effectively disrupting gene function.

[0033] Breeding route:

[0034] 1. Animal Acquisition and Establishment of the Foundation Population: Purchase 3-week-old B6 / JGpt-Klf13 animals with a C57BL / 6J genetic background from the laboratory animal supplier. em1Cd Heterozygote (Klf13) + / - Mice were used as the founding population.

[0035] 2. Offspring reproduction and genotyping: using Klf13 + / - Heterozygous mice were interbred to produce offspring. Genotyping was performed on weaned offspring (approximately 3 weeks old) to obtain homozygous knockout mice (Klf13). - / - KO), heterozygote (Klf13) + / - HET) and wild type (Klf13) + / + WT mice.

[0036] 3. Experimental Cohort Establishment: The identified mice were grouped according to genotype and housed in a standardized SPF-grade environment. Mouse weight and survival status were monitored throughout the experiment. The cohort is as follows:

[0037] Long-term aging observation cohort: A portion of WT and Klf13 were included. - / - Mice were raised to 18 months of age (n≥6 / genotype) and their natural aging process was observed.

[0038] Multi-point dynamic detection queue: Include the remaining WT and Klf13 + / - and Klf13 - / - Mice were subjected to vascular aging-related phenotype detection at 3, 6, and 12 months of age (n≥5 / genotype / time point).

[0039] II. Western blotting of proteins

[0040] Protein extraction: Cells were collected by trypsin digestion and centrifuged at 4°C and 1000 rpm for 5 min, and the supernatant was discarded. Pre-cooled lysis buffer containing protease inhibitors and phosphatase inhibitors was added, and lysis was performed on ice for 30 min. Subsequently, the cells were centrifuged at 4°C and 12000 rpm for 15 min, and the supernatant was collected as the total protein sample.

[0041] Immunoblot: Protein quantification was performed using the BCA method. Proteins were denatured at 98°C for 10 min after mixing with 5× Loading Buffer. Separation was then performed by SDS-PAGE gel electrophoresis (80 V for 30 min, then 120 V for 70 min). Subsequently, a wet transfer method was used, transferring proteins to a methanol-activated PVDF membrane at a constant current of 250 mA under ice bath conditions for 2 h. The transferred PVDF membrane was blocked with 5% skim milk at room temperature for 1 h, then incubated overnight at 4°C with a 1:1000 diluted primary antibody, followed by incubation at room temperature for 1 h with a 1:5000 diluted secondary antibody. After each incubation, the membrane was thoroughly washed with TBST. Finally, equal volumes of ECL chemiluminescence reagent A and B were mixed and uniformly added to the PVDF membrane surface. After reacting for 1-2 min, exposure and image acquisition were immediately performed using a Bio-Rad chemiluminescence imaging system.

[0042] III. Immunohistochemical fluorescent staining

[0043] After dewaxing paraffin sections, antigen retrieval was performed (sodium citrate buffer, 95°C, 10 min), followed by blocking of nonspecific binding with 5% BSA. Primary antibody (e.g., CD31, 1:200 dilution) was added and incubated overnight at 4°C. After washing with PBS, fluorescent secondary antibody (e.g., Alexa Fluor 488, 1:500 dilution) was added and incubated at room temperature in the dark for 1 h. Cell nuclei were counterstained with DAPI, and after mounting, the sections were observed under a confocal microscope. Fluorescence intensity was quantified using ImageJ software.

[0044] IV. Magnetic Resonance Imaging (MRI)

[0045] A 7T small animal MRI system, model BioSpec 94 / 30 USER, was used to examine the arteriovenous lumens of large blood vessels in mice. Mice were anesthetized and placed in the scanning chamber, and high-resolution images were acquired using T2-weighted sequences. Scanning parameters: slice thickness 0.5 mm, matrix 256×256, TR / TE 2000 / 30 ms. Image analysis was performed using a 3D slicer and MicroDicom DICOM viewer software to measure arteriovenous lumen diameters and hemodynamic parameters to assess changes in vascular structure and function.

[0046] V. Pulse Wave Velocity (PWV)

[0047] A Vevo LAZE-X ultra-high frequency small animal photoacoustic multimodal imaging system was used to measure the pulse wave velocity (PWV) of the aortic arch in mice to assess vascular stiffness. Mice were mildly anesthetized with 4% isoflurane inhalation, with no spontaneous limb movement and normal respiratory and heart rates, and were fixed to a heating plate to maintain body temperature. Next, the surface of the mouse body, where the thoracic aorta is located, was shaved and an appropriate amount of ultrasound coupling agent was applied. B-mode and M-mode images of the aortic arch were acquired using a high-frequency probe. The propagation time of the pulse wave at two fixed points, namely the ascending aorta and the descending aorta, was measured, and PWV was calculated. PWV = distance / time (m / s). At least 5 mice were measured in each group, and the measurements were repeated 3 times, with the average value taken to reduce error.

[0048] VI. Establishment of cell models (gene knockdown)

[0049] The cells were transfected with a specific small interfering RNA (siKLF13) targeting the human KLF13 gene, and a control group was established by transfecting with a negative control siRNA (siNC).

[0050] Human aortic endothelial cell line HAEC and human umbilical vein endothelial cell line HUVEC were obtained from ScienCell and cultured in ECM. Primary endothelial cells up to passage 10 were selected for experiments. The culture medium was changed every other day, and the cells were passaged by digestion with 0.05% trypsin when they reached 70%-90% confluence. The cells were cultured in an incubator at 37°C (5% CO2, 95% O2). Cells were identified by short tandem repeat (STR) analysis, and were confirmed to be free of mycoplasma contamination before use.

[0051] Cells in good growth condition were digested, counted, and seeded into 6-well plates. When the cell density reached approximately 80%, siRNA transfection was performed. Solutions A and B were prepared in 1.5 mL centrifuge tubes. Solution A: 125 µL Opti-MEM + 6 µL siRNA per well; Solution B: 125 µL Opti-MEM + 6 µL LTX Reagent per well. Solutions A and B were mixed in equal volumes and incubated at room temperature for 15 min. Cell preparation: the culture medium was aspirated, and the cells were washed once with PBS. 1 mL Opti-MEM was added to each well. 250 µL of the A / B mixture was added to the wells and incubated in a cell culture incubator for 6 h. Cell proteins were extracted or cell function experiments were performed 48 h after transfection.

[0052] VII. Assessment of DNA Damage and Proliferation

[0053] Immunofluorescence staining was used to detect the expression and localization of DNA double-strand break marker γH2AX and cell proliferation marker Ki67 in all cell types, and the proportion of positive cells was counted.

[0054] First, cell fixation and permeabilization: Discard the cell culture medium and gently wash the cells once with pre-cooled phosphate-buffered saline (PBS). Add 4% paraformaldehyde fixative and fix at room temperature for 15 min. After fixation, wash thoroughly three times with PBS for 5 min each time. Then, add 0.3% Triton X-100 permeabilization buffer and incubate at room temperature for 10 min to increase cell membrane permeability, followed by three more washes with PBS for 5 min each time. Blocking and primary antibody incubation: Remove the PBS and add blocking buffer containing 5% bovine serum albumin (BSA), and block at room temperature for 30 min to block non-specific binding. After blocking, directly add a primary antibody working solution (rabbit anti-γ-H2AX monoclonal antibody and mouse anti-Ki67 monoclonal antibody) diluted in antibody dilution buffer at an appropriate ratio (e.g., 1:500), ensuring the liquid completely covers the cell sample, and incubate overnight in a humidified chamber at 4°C. The next day, recover the primary antibody and wash three times with PBST containing 0.1% Tween-20 for 5 min each time. Subsequently, the corresponding fluorescent secondary antibody mixed working solution (e.g., Alexa Fluor 488-labeled goat anti-rabbit IgG and Cy3-labeled goat anti-mouse IgG, diluted 1:1000) was added and incubated at room temperature in the dark for 1 h. After incubation, the cells were washed three times with PBST in the dark, 5 min each time. Finally, the cell nuclei were counterstained with DAPI (1 μg / mL) solution, and the process was performed at room temperature in the dark for 5 min, followed by washing three times with PBS. Anti-fluorescence quenching mounting medium was added to the slides before mounting. Images were acquired using a laser confocal microscope, with DAPI (blue), Alexa Fluor 488 (green, γ-H2AX signal), and Cy3 (red, Ki67 signal) excited through 405 nm, 488 nm, and 561 nm laser channels, respectively. The fluorescence colocalization and fluorescence intensity were quantitatively analyzed using ImageJ or similar software.

[0055] 8. Cell migration ability assessment (scratch assay)

[0056] Scratch experiments were performed on HAEC and HIVCEC. Photos were taken at 0h and 24h after scratching to calculate the scratch healing rate and assess the endothelial cell migration ability.

[0057] Both the human aortic endothelial cell line HAEC and the human inferior vena cava endothelial cell line HIVCEC were cultured in EMEM medium containing 10% fetal bovine serum. The next experimental step was performed when the cells reached 70% confluence.

[0058] The treated cells were seeded at an appropriate density in 96-well plates. Once the cells reached near 100% confluence, a uniform scratch was simultaneously created in each well using a sterile 96-well scratcher. The cells were then gently washed three times with PBS to thoroughly remove any detached cells from the scratched areas. After replacing the medium with EMEM containing 2% FBS, the cell culture plates were placed in the IncuCyte live-cell dynamic imaging system for continuous monitoring. The system was programmed to automatically acquire scratch images every 2 hours, for a total of 24 hours. After the experiment, the closure rate of the scratched areas was quantitatively analyzed using the instrument's software to characterize cell migration ability.

[0059] IX. Angiogenesis Capacity Assessment (Tube Formation Experiment)

[0060] In vitro matrix gelation experiments were conducted on HIVCECs to quantitatively analyze the number of nodes and total branch length of the formed capillary-like network and assess its angiogenesis capacity.

[0061] This study employed the Matrigel method. Pre-cooled Matrigel was melted overnight at 4°C and then evenly spread at the bottom of a 96-well plate (50 μL / well). The plate was then incubated at 37°C for 30 min to polymerize and form a solid gel layer. The treated endothelial cells were resuspended in serum-free medium at a density of 1.0 × 10⁶ cells / well. 4 Cells were seeded at a density on polymerized matrix gel. The cells were continuously cultured at 37°C and 5% CO2 for 6–12 h and monitored. Tubular structure formation was observed under an inverted microscope, and the total length, number of branching points, and tubular area of ​​the formed tubular structures in each field of view were calculated.

[0062] 10. Single-cell transcriptome analysis

[0063] In the R language environment, Seurat software was used for quality control, dimensionality reduction, and clustering. Quality control conditions: (1) cells>3; (2) genes>300; (3) nFeature_RNA>300; (4) percent.mt<20. To remove double cells, i.e., cells generated by two or more cells being encapsulated in the same droplet, we used the DoubleFinder package to predict and remove double cells based on the sample size, which is usually 5%-10%. At the same time, by checking the expression level of ribosomal protein genes, and further removing cells that may be contaminated with high levels of environmental background RNA using the SoupX package, high-quality cells were retained for downstream analysis.

[0064] Example 1: KLF13 expression level significantly decreased during vascular aging in humans and mice.

[0065] We constructed a single-cell transcriptome atlas of large vessel aging in humans and mice, collecting a total of 48 tissue samples from four types of mice at 1, 3, 6, 12, 18, and 24 months of age: aorta (AO), aortic arch (AOAR), inferior vena cava (IVC), and portal vein (PV). Simultaneously, we included 38 abdominal aorta (AA) and inferior vena cava (IVC) samples from 42 individuals aged 20-29, 30-39, 40-49, 50-59, and 60-69 years. Figure 1 A). Through analysis, we identified the main cell types in large blood vessels, including endothelial cells, smooth muscle cells, fibroblasts, and immune cells, etc. Figure 1 B). Klf13 expression levels were significantly decreased in both the arteries and veins of aged mice. Figure 1 C).

[0066] Based on this, we conducted further research on the functionality of Klf13.

[0067] Example 2: Klf13 knockout mice exhibited premature vascular aging phenotypes.

[0068] By specifically cutting the second exon of the Klf13 gene on mouse chromosome 7, gene function was effectively disrupted, and a reliable Klf13 gene knockout mouse model was successfully constructed. Figure 2 A). To confirm the effectiveness of gene knockout at the protein level, we performed detection using Western blotting and immunofluorescence staining, respectively. Western blot results showed that Klf13 protein was absent in the aorta of homozygous knockout mice, and the protein level was significantly reduced in heterozygotes (A). Figure 2 B); Immunofluorescence staining further confirmed the absence of Klf13 in the blood vessels of knockout mice in situ on the tissue. Figure 2 C). Next, we used magnetic resonance imaging (MRI) to non-invasively measure the luminal diameter of the major blood vessels (C). Figure 2 D), to investigate the effects of Klf13 deficiency on macroscopic vascular structure. Results showed that in 7-month-old Klf13 homozygous knockout mice, the diameter of the aorta and portal vein had already expanded to a level comparable to that of 24-month-old wild-type mice, while the inferior vena cava also showed moderate dilation. Figure 2 E). To assess the impact of Klf13 deficiency on vascular function, we measured aortic arch pulse wave velocity using ultrasound imaging. Notably, 7-month-old homozygous Klf13 knockout mice showed significantly elevated PWV, even exceeding that of age-matched wild-type mice, while heterozygotes showed a moderate increase. Figure 2F). Through systematic analysis of Klf13 knockout mice, this study demonstrates, from a structural to a functional perspective, that Klf13 is an important protective factor for maintaining vascular homeostasis. This model also provides a valuable experimental basis for further exploring the specific mechanisms of Klf13 in age-related vascular diseases.

[0069] In summary, under normal circumstances, mice begin to exhibit the above phenotypic changes at 12 months of age. Klf13 knockout mice show significant vascular aging phenotypic changes starting at 7 months of age, specifically including increased luminal diameter and pulse wave velocity in the aorta, portal vein (PV), and inferior vena cava (IVC).

[0070] Example 3: Immunofluorescence staining of DNA damage and proliferative function after KLF13 knockdown of major vascular cell types

[0071] To investigate the impact of KLF13 deficiency on vascular homeostasis at the cellular level, we transfected various primary human vascular cells (human arterial endothelial cells HAEC, human inferior vena cava endothelial cells HIVCEC, human arterial smooth muscle cells HASMC, human inferior vena cava smooth muscle cells HIVCSMC, and human arterial fibroblasts HAF) with KLF13-specific siRNA to silence the expression of endogenous KLF13. Western blotting was used to verify the knockdown efficiency of KLF13 siRNA in human arterial endothelial cells HAEC. The results showed that after transfection with siKLF13, the expression level of KLF13 protein in HAEC was significantly lower than that in the siNC group. Figure 3 A). Next, the expression of the DNA damage marker γH2AX and the proliferation marker Ki67 was detected by immunofluorescence staining. It was found that knockdown of KLF13 had the most significant effect on arterial and venous endothelial cells. Specifically, the proportion of γH2AX-positive cells in human arterial endothelial cells (HAEC) and human inferior vena cava endothelial cells (HIVCEC) was significantly increased, while the proportion of Ki67-positive cells was significantly decreased in the siKlf13 transfection group. Figure 3 B). Other quantitative cell analyses showed that the proportion of γH2AXy-positive cells in HAF cells was significantly increased in the siKlf13 group, while the proportion of γH2AXy-positive cells in HASMCs and HIVCSMCs was also increased, but without statistical significance. Regarding cell proliferation, the proportion of Ki67-positive cells in HAF cells and HIVCSMCs in the siKlf13 group was significantly decreased.

[0072] The above analysis shows that KLF13 knockdown increases cell DNA damage and decreases proliferation capacity, suggesting that KLF13 plays a protective role against vascular aging.

[0073] Example 4: Scratch and tube formation experiments of arteriovenous endothelial cells after KLF13 knockdown

[0074] Building upon our confirmation that KLF13 deficiency leads to DNA damage and proliferation in vascular cells, we further investigated its regulation of core vascular cell functions, including angiogenesis and migration. We evaluated the role of KLF13 in endothelial cell migration using a scratch assay. The results showed that KLF13 knockdown significantly reduced the scratch healing rate of arterial endothelial cells. Figure 4 A). Tube formation assays assessed the role of KLF13 in endothelial cell angiogenesis, and the results showed that KLF13 knockdown significantly reduced the number of nodes formed in HIVCEC cells and significantly shortened the total branch length. Figure 4 (B) indicates that its vascular network formation ability is severely impaired. In summary, the above analysis shows that among vascular cell types, KLF13 knockdown has the most significant impact on endothelial cells, leading to decreased arteriovenous endothelial migration and tubular function.

[0075] This study, through in vitro and in vivo functional experiments, revealed the core role of KLF13 in maintaining vascular homeostasis, with a particularly significant impact on endothelial cells. Compared to vascular smooth muscle cells and fibroblasts, endothelial cells exhibited higher sensitivity to KLF13 deficiency. These findings not only establish KLF13's status as a key vascular protective factor at the functional level, but its dysfunction may also be closely related to vascular aging and the development of related diseases.

Claims

1. The application of a substance used to detect KLF13 gene expression in the preparation of products for identifying and / or assisting in the identification of the aging degree of different vascular cells, characterized in that, The vascular cells may be one, two, or more of the following: human arterial endothelial cells, human inferior vena cava endothelial cells, human arterial smooth muscle cells, human inferior vena cava smooth muscle cells, and human arterial fibroblasts.

2. The application according to claim 1, characterized in that, The senescence of vascular cells exhibits at least one of the following characteristics: (1) Premature dilation of arterial and venous vessel diameters; (2) Increased DNA damage in vascular endothelial cells; (3) Decreased proliferative capacity of vascular endothelial cells; (4) Decreased migration ability of vascular endothelial cells; (5) Decreased tube-forming ability of vascular endothelial cells.

3. The application according to claim 1, characterized in that, The substance used to detect KLF13 gene expression is a reagent that can specifically bind to or recognize the KLF13 gene nucleic acid sequence or KLF13 protein.

4. The application according to claim 3, characterized in that, The specific binding or recognition of the KLF13 gene nucleic acid sequence is a KLF13 specific primer pair or a KLF13 probe; the specific binding or recognition of the KLF13 protein is a KLF13 protein antibody.

5. Application of substances that inhibit KLF13 gene expression in the preparation of products that inhibit the migration of vascular endothelial cells in vitro.

6. Application of substances that inhibit KLF13 gene expression in the preparation of products that inhibit the tube-forming ability of vascular endothelial cells in vitro.

7. The application according to claim 5 or 6, characterized in that, The substance that inhibits KLF13 gene expression is a small interfering RNA that interferes with KLF13 expression.

Images