A SNP molecular marker related to grape terpenoid aroma substances, a detection method and application thereof
By identifying SNP sites in the promoter region of the VvGGPPS1 gene in grape germplasm, the problems of insufficient universality and resolution of molecular markers for grape aroma traits in existing technologies have been solved, enabling early and precise molecular breeding selection and improving breeding efficiency and accuracy.
Patent Information
- Application Number
- CN202610609166.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-06
- Publication Date
- 2026-06-02
AI Technical Summary
Existing technologies for molecular markers of grape aroma traits suffer from poor universality, low resolution, and one-sided trait definitions, making it difficult to achieve efficient and precise breeding selection.
SNP sites located in the promoter region of the VvGGPPS1 gene were identified in 115 grape germplasms using genome-wide association analysis (GWAS). The direct positive regulatory role of these sites on terpene synthesis was verified through cross-species transgenic functional validation, providing an early and precise molecular marker-assisted selection method.
It enables early and efficient screening of aroma traits in grape seedlings, significantly shortens the breeding cycle, improves selection efficiency and accuracy, and is applicable to breeding materials with different genetic backgrounds.
Smart Images

Figure CN122128468A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant molecular breeding technology, specifically relating to an SNP molecular marker related to grape terpenoid aroma substances, its detection method and its application. Background Technology
[0002] The information disclosed in this background section is intended only to enhance some understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art.
[0003] The aroma of grapes, especially the floral and fruity aromas contributed by terpenoid compounds (such as linalool and geraniol), is a core trait that determines the quality and commercial value of table grapes and wine grapes. However, this trait is a complex quantitative trait, regulated by multiple genes, and is easily affected by environmental factors (light, temperature, and water) and cultivation management practices, which poses a significant challenge to traditional breeding methods.
[0004] Currently, the genetic improvement of grape aroma traits mainly relies on the following two traditional strategies: 1) Phenotypic selection: After the fruit matures, aroma components are determined by sensory evaluation or instrumental methods such as gas chromatography-mass spectrometry (GC-MS). This method has an extremely long cycle (usually 8-12 years from hybridization to stable identification of fruit traits), is costly, and the phenotypic data is significantly affected by the climate conditions of that year, resulting in poor repeatability and low selection efficiency.
[0005] 2) Hybridization and progeny selection: Large-scale selection is carried out in the progeny population through hybridization between parents with excellent aroma. This not only requires a huge amount of field land and manpower and resources, but also, due to the complex genetic background of aroma traits, the frequency of excellent genotypes appearing in segregating populations is low, the breeding process is slow and has a great deal of blindness.
[0006] With the development of molecular biology, marker-assisted selection (MAS) is considered a revolutionary technology to solve the aforementioned bottlenecks. The core of MAS is to find DNA markers (such as SNPs) that are closely linked to or directly causally related to the target trait, so as to screen individuals for genotypes at the seedling stage or even the seed stage, without waiting for them to flower and bear fruit. This can shorten the breeding cycle by several years and greatly improve the accuracy and efficiency of selection.
[0007] Therefore, developing molecular markers that are closely related to key aroma traits of grapes and have clearly defined functions has become a key technical problem that urgently needs to be solved in the field of modern grape genetics and breeding.
[0008] In developing molecular markers for grape aroma traits, existing similar technical solutions are mainly based on two strategies, but both have obvious limitations: 1. QTL-based linkage tagging Technical Description: Segregating hybrid populations (e.g., F1 or F2 populations) are constructed using parents with aroma differences. Aroma phenotypic data for each individual plant in the population are measured, and combined with genetic linkage maps, quantitative trait loci (QTLs) controlling aroma content or composition are located. Molecular markers (e.g., SSRs or SNPs) developed within QTL intervals can be used for selection assistance.
[0009] Representative approaches: For example, in a hybrid population of “Muscat Hamburg” and “Crimson Seedless”, researchers located the major QTL region controlling monoterpene content and developed the corresponding SSR markers.
[0010] Existing defects: Low resolution: QTL intervals are usually very wide, containing hundreds or thousands of genes, making it difficult to pinpoint the actual functional genes or sites.
[0011] Population dependence: The effectiveness of markers is highly dependent on the specific hybrid population used for mapping. In breeding materials with other genetic backgrounds, the association between markers and traits may be lost (i.e., linkage disequilibrium is broken), resulting in poor universality.
[0012] Most associations are "passive": the marker and the target gene may only be "neighbors" in physical location, rather than functional variations themselves, thus reducing reliability when applied across populations.
[0013] 2. Markers based on eGWAS (eGWAS) Technical Description: Transcriptome sequencing is performed on samples from natural populations. Gene expression levels are used as a "molecular phenotype" and associated with genome-wide SNPs to identify key cis-regulatory sites (eQTLs) that regulate gene expression. These eQTLs can serve as candidate functional markers.
[0014] Representative approach: In natural grape populations, eQTLs regulating the expression level of a certain terpene synthase (TPS) gene were identified by eGWAS analysis of grape peel tissue.
[0015] Existing defects: Tissue and developmental stage specificity: Gene expression has a high degree of spatiotemporal specificity. An eQTL identified in a certain tissue (such as the pericarp) or a certain developmental stage may not function stably in other tissues or stages of interest for breeding (such as leaves used for early screening).
[0016] Association does not equal functional validation: eGWAS still finds statistical associations. Even if the SNP is located in the gene promoter region, there is a lack of direct experimental evidence as to whether it truly affects gene function or the content of final metabolites. This makes the effectiveness of the marker uncertain, and the strength and stability of patent protection weak.
[0017] Summary of solutions most similar to this invention: Among existing technologies, the closest is the paper "Identification of Molecular Markers Related to Monoterpenoids in Grapes Based on Genome-Wide Association Analysis." Genome-wide association analysis (GWAS) was performed on the F1 generation of a cross between a typical aromatic grape variety ('Muscat of Alexandria') and a non-aromatic grape variety ('Christmas Rose'). Single nucleotide polymorphisms (SNPs) significantly associated with monoterpenoids were identified. While this approach utilizes a single hybrid population and can obtain markers with a certain resolution, it still has the following limitations: 1. Limited genetic diversity: Based on only a single hybrid population, it fails to fully utilize the broader genetic variation in natural populations, raising questions about the applicability of the markers in diverse germplasm; 2. Narrow phenotypic definition: Relying solely on monoterpenoids to represent complex overall aroma traits fails to comprehensively reflect the multidimensional composition of aroma quality, affecting the practicality of the markers in improving overall aroma.
[0018] This invention not only identified a promoter region SNP associated with rose aroma in a natural population (115 germplasm accessions) using GWAS, but also conclusively demonstrated the biological function of this gene and its locus through cross-species transgenic functional verification (overexpression of the VvGGPPS1 gene in tomato and grape callus tissues significantly increased terpene compound content). This SNP is highly associated with the rose aroma trait and can be used as a molecular marker for selection assistance.
[0019] Based on the analysis of existing similar technical solutions, their main drawbacks can be summarized into the following two aspects: 1. Limited versatility and scope of application: Population dependence: Markers developed based on QTL mapping of specific hybrid populations (such as F1 and F2) are highly dependent on the genetic background of that population. They are easily invalidated in other varieties or breeding materials due to linkage disequilibrium, resulting in poor universality.
[0020] Temporal and spatial limitations: Markers identified based on specific tissue (such as pericarp) or developmental stage data (such as maturity) (such as eQTL) may not be effective when used for early screening (such as seedling leaves), which limits their convenient application in breeding practice.
[0021] 2. Insufficient resolution and one-sided definition of traits: Low positioning accuracy: QTL positioning can usually only locate the target trait to a broad chromosomal region containing a large number of genes, making it difficult to accurately locate the true functional genes or functional nucleotide variations, resulting in low efficiency of marker-assisted selection.
[0022] Incomplete phenotypic association: Some studies use only a single or a few metabolites (such as a certain type of monoterpene) as phenotypic representatives of complex aroma traits, failing to fully cover the overall aroma metabolism spectrum related to the final sensory quality, resulting in limited guidance of markers for improving comprehensive aroma traits. Summary of the Invention
[0023] To address the shortcomings of existing technologies in terms of functional basis, versatility, and precision, this invention aims to provide a novel molecular marker and its applications that have a clear functional basis, broad applicability, and can be used for efficient molecular breeding. The specific objectives are as follows: (1) Providing a molecular marker closely related to the target trait: The primary objective of this invention is to provide a specific SNP site located in the promoter region of the grape VvGGPPS1 gene. This site is not only significantly associated with the characteristic aroma of grapes (rose aroma) through GWAS analysis, but more importantly, through transgenic overexpression in tomato and grape callus tissues, it has been conclusively demonstrated that the VvGGPPS1 gene has a direct positive regulatory effect on the synthesis of terpenoid compounds. This provides functional support for the association between this SNP and the aroma trait.
[0024] (2) This invention provides a widely applicable molecular marker and its application method: Based on GWAS analysis of a natural population containing 115 accessions, this invention fully utilizes the extensive genetic diversity of grape germplasm. This results in a higher probability and stability of the identified marker loci in materials with different genetic backgrounds. The purpose of this invention is to provide this marker and its detection method, enabling it to be widely applied across different breeding populations and varieties in molecular-assisted breeding of grape aroma traits, overcoming the problem of strong population dependence of traditional QTL markers.
[0025] (3) A method for achieving early, precise, and efficient selection: This invention aims to establish a molecular marker-assisted selection (MAS) method that utilizes the aforementioned molecular markers to perform genotypic screening of aroma traits during the grape seedling stage or early developmental stage (without waiting for flowering and fruiting). This method can directly target key functional gene loci for aroma synthesis, with high resolution and precision, effectively shortening the breeding cycle (by several years), and significantly improving the selection efficiency and accuracy of complex aroma traits, thereby accelerating the breeding process of high-quality new grape varieties.
[0026] The technical solution adopted in this invention is as follows: In a first aspect, the present invention provides an SNP molecular marker related to grape terpenoid aroma substances, characterized in that the SNP molecular marker is located in the promoter region of the VvGGPPS1 gene, corresponding to the 103rd base from the 5′ end of the sequence shown in SEQ ID NO.1 being C or T.
[0027] Preferably, when the genotype of the SNP molecular marker is CC, the grapevine does not have a rose fragrance; when the genotype is CT or TT, the grapevine has a rose fragrance.
[0028] Secondly, the present invention provides a primer pair for detecting the above-mentioned SNP molecular markers, characterized in that the primer pair has nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3.
[0029] Thirdly, the present invention provides a method for detecting the above-mentioned SNP molecular markers, characterized by comprising the following steps: (1) Extract genomic DNA from the grape plants to be tested; (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using the primer pair shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain a DNA fragment containing the target SNP site; (3) Sequencing the PCR amplification product obtained in step (2) and analyzing the nucleotide type of the 103rd base from the 5′ end of the sequence shown in SEQ ID NO.1.
[0030] Optionally, the sequencing described in step (3) is Sanger sequencing.
[0031] Fourthly, the present invention provides a kit for auxiliary selection of grape aroma traits, characterized in that it comprises the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3.
[0032] Furthermore, the kit also contains reagents for PCR amplification.
[0033] Fifthly, the present invention provides the application of the above-mentioned SNP molecular markers, primer pairs, detection methods or kits in early screening of grape aroma traits or molecular marker-assisted breeding.
[0034] In this invention, the "terpenoid aroma substances" include, but are not limited to, monoterpenoid compounds (such as linalool, geraniol, etc.) and sesquiterpenoid compounds. The "rose aroma" refers to the typical rose-like aroma characteristics of grape berries.
[0035] Sixthly, the present invention provides a molecular marker-assisted selection method for grape aroma traits, characterized by comprising the following steps: (1) The method described above was used to detect the SNP molecular marker genotype of the grape plants to be tested; (2) If the test result is CC homozygous, the plant is determined not to have a rose fragrance; (3) If the test result is CT heterozygous or TT homozygous, the plant is determined to have a rose fragrance.
[0036] This invention is based on the following research findings: The inventors used 115 grape varieties with or without the Muscat phenotype (Table 1) as experimental materials and performed whole-genome resequencing and genome-wide association analysis (GWAS). The GWAS analysis results showed that chromosome 5 was a significant locus associated with the Muscat phenotype in grapes. Figure 1 Further analysis of the genome sequence of grape chromosome 5 revealed several significant SNPs in grape varieties with and without Muscat aroma.
[0037] A single SNP site (corresponding to position 103 from the 5′ end of SEQ ID NO. 1) exists in the upstream promoter region of the VIT_205s0020g01240 gene (VvGGPPS1). As shown in Table 1, this site is C (homozygous CC) in all non-rose-scented varieties; in all rose-scented varieties, except for 'RedItalia' which is TT homozygous, the other sites are Y (indicating heterozygous CT). This result indicates that the T allele is highly associated with the rose-scented trait, while C allele homozygosity (CC) is completely associated with the absence of the rose-scented trait. This SNP site is highly associated with the rose-scented trait in grapes and can serve as a molecular marker for grape aroma traits.
[0038] To further verify the function of this gene, the inventors constructed a VvGGPPS1 overexpression vector and stably overexpressed it in grape callus and tomato fruit, respectively.
[0039] In grape callus tissue (Tables 4 and 5), overexpression of VvGGPPS1 significantly increased the content of 58 volatile compounds. Among them, hydrocarbon content increased by 1.19 times, aromatic compounds by 1.86 times, alcohols by 1.62 times, and esters by 1.33 times. In particular, the content of (E)-2-heptenal, which has a strong rose aroma, increased by 1.98 times.
[0040] In tomato fruits (Tables 6 and 7), overexpression of VvGGPPS1 increased the content of terpenoid compounds by 42.04%–45.45%. Among them, the content of pinocalcinone increased by 5.77 times, and the content of trans-β-ionone increased by 3.70 times.
[0041] The above results indicate that the VvGGPPS1 gene directly and positively regulates the synthesis of terpenoids, and the SNP sites in its promoter region are highly associated with the rose aroma trait in grapes, and can serve as functional markers for molecular marker-assisted selection of grape aroma traits.
[0042] Definition of rose scent: The 'rose aroma' mentioned in this invention refers to the aroma characteristics of grapes confirmed by the following method: Sensory evaluation method: An evaluation group consisting of no less than 5 trained sensory evaluators conducts an olfactory evaluation of the grapes, in which no less than 80% of the evaluators determine that the fruit has typical rose aroma characteristics.
[0043] In the phenotypic data collection of Example 1, the above-mentioned sensory evaluation method (evaluation group ≥ 5 people, consistency rate ≥ 80%) was used to determine the rose aroma of 115 grape varieties. All varieties with 'rose aroma' passed the evaluation criteria.
[0044] The core technical features of this invention are: 1. Specific molecular marker site: The core lies in a specific SNP located in the promoter region of the grape VvGGPPS1 gene. This site is a key variant identified through GWAS analysis of 115 natural populations, which is significantly associated with the aroma trait of Muscat grapes. The T allele is associated with Muscat aroma.
[0045] 2. A complete and rigorous chain of evidence for association-function verification: The association between this SNP and the target trait is based on a natural population with rich genetic diversity, rather than a hybrid population with a narrow genetic background, which enhances its general significance; Overexpression of the VvGGPPS1 gene in grape callus tissue directly leads to a significant increase in the content of terpenoids, providing direct experimental evidence of the function of this gene and this site in regulating aroma synthesis.
[0046] 3. Technical problems solved: This technical solution directly addresses the three major shortcomings of existing molecular markers for aroma traits: unclear functional basis, poor universality, and lack of functional verification. It provides a molecular breeding tool with clear function, strong universality, and can be used for early and precise selection.
[0047] Compared with the related technologies known to the inventors, one of the technical solutions of the present invention has the following beneficial effects: (1) Clear association and sufficient verification: This invention not only identified a promoter region SNP related to rose aroma in natural populations through GWAS, but more importantly, through cross-species transgenic functional verification (overexpression of the VvGGPPS1 gene in tomato and grape callus tissue), it conclusively proved the direct positive regulatory role of this gene in the synthesis of terpenoids. This SNP is closely linked to the target trait and can be used as a reliable molecular marker for auxiliary selection.
[0048] (2) This invention has significant advantages in terms of genetic basis and universality. Existing methods are usually based on specific hybrid populations with narrow genetic backgrounds, and the obtained markers are prone to failure in other breeding materials. This invention is based on GWAS of a natural population containing 115 germplasms, which captures the genetic variations that are widely present in grape germplasm, making the identified SNP markers more universal and stable, and enabling them to be effectively applied across diverse breeding populations and varieties.
[0049] (3) The present invention is more reasonable in terms of the comprehensiveness of the trait definition. Existing schemes often use a single category of compounds (such as monoterpenes) to represent complex overall aromas, which has limited guiding significance. The phenotypic correlation of the present invention targets a more comprehensive "rose aroma", which is closer to the final sensory quality target. Therefore, it has higher guiding value for the improvement of comprehensive traits and helps to breed new varieties with harmonious aromas and balanced quality.
[0050] (4) Achieve early, precise and efficient selection: This invention can perform genotyping of aroma traits during the grape seedling stage or early development stage (without waiting for flowering and fruiting), directly select key functional gene loci for aroma synthesis, with high resolution and high precision, effectively shorten the breeding cycle (by several years), greatly improve the selection efficiency and accuracy of complex aroma traits, and thus accelerate the breeding process of high-quality new grape varieties. Attached Figure Description
[0051] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0052] Figure 1 The diagram shows the results of the genome-wide association analysis (GWAS) of this invention, which indicates that chromosome 5 is a significant locus associated with the Muscat grape trait. Detailed Implementation
[0053] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0054] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments of the present invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, and / or combinations thereof.
[0055] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0056] Example 1: Discovery and Validation of SNP Sites in the VvGGPPS1 Promoter Region 1.1 Experimental Materials 115 grape varieties with known fruit phenotypes that have or do not have the Muscat phenotype were selected, including 90 varieties without the Muscat phenotype and 25 varieties with the Muscat phenotype (see Table 1 for specific data).
[0057] 1.2 Whole-genome resequencing and GWAS analysis Whole-genome resequencing was performed on 115 grape varieties to obtain genomic SNP data. Genome-wide association analysis (GWAS) was conducted using the Muscat grape phenotype as the trait. The results are as follows: Figure 1 As shown, chromosome 5 contains a signal peak that is significantly associated with the rose-scented trait.
[0058] 1.3 Candidate SNP Site Analysis Fine localization of the associated region on chromosome 5 revealed a SNP site (corresponding to position 103 from the 5′ end of SEQ ID NO. 1) in the upstream promoter region of the VIT_205s0020g01240 gene (VvGGPPS1, https: / / phytozome-next.jgi.doe.gov / report / protein / Vvinifera_v2_1 / VIT_205s0020g01240.1). As shown in Table 1, this SNP site is highly associated with the rose-scented phenotype: in all non-rose-scented varieties, this site is C (homozygous CC), while in all rose-scented varieties, except for 'RedItalia' which is TT homozygous, the other sites are Y (heterozygous CT).
[0059] 1.4 Conclusion These results indicate that the SNP sites in the VvGGPPS1 promoter region are highly associated with the rose aroma trait in grapes and can serve as molecular markers for grape aroma traits.
[0060] Table 1. Correspondence between Muscat grape variety phenotype and SNP locus genotype variety Phenotype genotype variety Phenotype genotype 8611 Rose-free C Beiguohong Rose-free C 95232 Rose-free C beiguolantaian Rose-free C 97130 Rose-free C Beta Rose-free C afrodite Rose-free C BezsemenaB Rose-free C Australia RubySeedless Rose-free C BlackBanana Rose-free C autumnking Rose-free C BlueFrench Rose-free C Baijiamei Rose-free C Bouchet Rose-free C beibinghong Rose-free C BrownSeedlessBeijing Rose-free C BrownSeedlessTaian Rose-free C Burgundy Rose-free C CabernetFranc Rose-free C Carignan Rose-free C Concord Rose-free C crimsonseedlessB Rose-free C EmeraldSeedless Rose-free C flameseedlss Rose-free C gaibeiputao Rose-free C GoldFinger Rose-free C GoldFingerJinan Rose-free C Gongniang Rose-free C guoliyihao Rose-free C Heihuxiang Rose-free C Hongbaladuo Rose-free C hongfushi Rose-free C hongxiayin Rose-free C hongyidou Rose-free C huozhouheiyu Rose-free C huozhouziyu Rose-free C hupeierhao Rose-free C hutaibahao Rose-free C ITUM12 Rose-free C ITUM9 Rose-free C jingdajing Rose-free C jingya Rose-free C jingzaojing Rose-free C jinhong Rose-free C jintian0608 Rose-free C JinxingSeedless Rose-free C jinxingseedless Rose-free C jufengjinan Rose-free C jufengtaian Rose-free C kismis Rose-free C KVA Rose-free C lakemont Rose-free C marooseedless Rose-free C meirenzhi Rose-free C mizhi Rose-free C MoldovaJinan Rose-free C MoldovaTaian Rose-free C Niagara Rose-free C PetitVerdot Rose-free C qiuhong Rose-free C Qiumi Rose-free C RedBanana Rose-free C RedStar Rose-free C Rizamat Rose-free C RubySeedlessJinan Rose-free C RuiduSeedless Rose-free C ruifengwuhe Rose-free C Sapphire Rose-free C Scarlotta Rose-free C ScarlottaSeedless Rose-free C Seedless5 Rose-free C seedlesser Rose-free C SH21 Rose-free C spartanseedless Rose-free C Sudanrose Rose-free C SummerBlackBJ Rose-free C SummerBlackTaian Rose-free C SweetSapphire Rose-free C ThompsonSeedless Rose-free C Vd Rose-free C wuhesan Rose-free C wuhesi Rose-free C wuheyi Rose-free C xiazhihong Rose-free C xileseedlessBj Rose-free C xileTaian Rose-free C xinongdaseedless Rose-free C yuexiuwuhe Rose-free C zitianwuhe Rose-free C zuijinxiang Rose-free C 871 It has a rose scent. Y aishenmeigui It has a rose scent. Y Benitaka It has a rose scent. Y Brazil It has a rose scent. Y canadamuscat It has a rose scent. Y chenxiang It has a rose scent. Y DEMIRKAPIJAA It has a rose scent. Y fenghuang51 It has a rose scent. Y Italia82 It has a rose scent. Y jumeiguijinan It has a rose scent. Y jumeiguitaian It has a rose scent. Y MidknightBBJ It has a rose scent. Y MuscatJinan It has a rose scent. Y MuscatofAlexandria It has a rose scent. Y NeoMuscat It has a rose scent. Y Ruiduhongmei It has a rose scent. Y Ruiduhongyu It has a rose scent. Y Ruiduxiangyu It has a rose scent. Y Ruiduzaohong It has a rose scent. Y Tamina It has a rose scent. Y TetraploidMidknightB It has a rose scent. Y zaomeogui It has a rose scent. Y ZaoxiaMuscat It has a rose scent. Y zixiangwuhe It has a rose scent. Y RedItalia It has a rose scent. T Note: C represents the CC homozygous genotype (without rose scent), Y represents the CT heterozygous genotype (with rose scent), and T represents the TT homozygous genotype (with rose scent).
[0061] Example 2: Genotyping of SNPs in the VvGGPPS1 promoter region of grapevines 2.1 Experimental Materials Select young leaves from the grapevines to be tested.
[0062] 2.2 Genomic DNA Extraction Genomic DNA was extracted using a modified CTAB method. DNA integrity was assessed by 1% agarose gel electrophoresis, and DNA concentration and purity were determined by UV spectrophotometry. The DNA concentration was adjusted to 50 ng / μL and stored at -20℃ for later use.
[0063] 2.3 PCR Amplification Using the extracted genomic DNA as a template, PCR amplification was performed using the following primers: Upstream primer (SEQ ID NO.2): TAATAATTTTTTACTATTTTCATTCATTTTCGAATGACTGTC; Downstream primer (SEQ ID NO.3): CGACACCACCTTACAAACCAACG; The PCR reaction system includes: Table 2 50 µL Reaction System Components volume 2×Phanta Max Buffer 25.0 μL Phanta Max DNA Polymerase 1.0 μL d NTP Mix (2.5 mM) 4.0 μL Upstream primer (10 μM) 1.0 μL Downstream primer (10 μM) 1.0 μL cDNA template x μL <![CDATA[RNase Free ddH2O]]> up to 50 μL The PCR amplification procedure is as follows: Table 3 PCR amplification program Loop steps temperature time Cycle number Pre-variation 95℃ 5 min 1 transsexual 95℃ 20 s 35 annealing 56-62℃ 20 s extend 72℃ 30-60 s / kb Complete extension 72℃ 10 min 1 save 12℃ 60 min PCR amplification was performed using the method described above to obtain DNA fragments containing the target SNP sites.
[0064] 2.4 Sequencing Analysis After purification, the PCR product was subjected to Sanger sequencing. The sequencing peak diagram was analyzed to determine the nucleotide type (C or T) of the 103rd base from the 5′ end of the sequence shown in SEQ ID NO.1.
[0065] 2.5 Results and Applications The genotype of the plant to be tested is determined based on the sequencing results: if the locus is homozygous (CC), the plant is predicted not to have a rose aroma; if the locus is heterozygous (CT) or homozygous (TT), the plant is predicted to have a rose aroma. This method allows for early prediction of aroma traits in grape seedlings.
[0066] Example 3: MAS (Material-Assisted Selection) in Grape Breeding Using SNP Molecular Markers in the VvGGPPS1 Promoter Region 3.1 Parental selection and hybridization A variety carrying a high-aroma allele (CT heterozygous at VvGGPPS1-103 locus) was selected as the female parent and crossed with a variety possessing other excellent agronomic traits (such as disease resistance and high yield) but with average aroma (CC homozygous at VvGGPPS1-103 locus) as the male parent. F1 hybrid seeds were obtained.
[0067] 3.2 F1 Generation Population Creation and Early Screening F1 generation hybrid seeds were sown and seedlings were raised. When the seedlings grew to the 3-5 leaf stage, tender leaves of all F1 generation individual plants were collected and genotyped using the method described in Example 2. The genotype of each individual plant at the VvGGPPS1-103 locus was detected.
[0068] 3.3 Selection of Superior Individual Plants Based on the typing results, F1 generation plants carrying superior alleles (CT heterozygous) were selected, while plants carrying unfavorable alleles (CC homozygous) were eliminated.
[0069] 3.4 Field planting and trait verification The selected superior genotype seedlings were transplanted into the field, and after they grew to the fruiting stage, the terpene compound content of their fruits was measured and sensory evaluation was conducted.
[0070] 3.5 Expected Results Compared with traditional random selection without labels, this invention can eliminate about 50% (theoretical value) of individuals with low aroma potential at the seedling stage, reducing the number of plants that need to be cultivated to fruit by half, thereby significantly saving land, labor and time costs, and significantly improving the selection efficiency of high aroma offspring.
[0071] Example 4: Validation experiment of VvGGPPS1 overexpression function (grape callus) This embodiment demonstrates, through transgenic function verification, the direct positive regulatory role of the VvGGPPS1 gene in the synthesis of terpenoids.
[0072] 4.1 Experimental Methods A VvGGPPS1 overexpression vector was constructed and transformed into grape embryogenic callus to obtain overexpressing transgenic callus. Two independent transgenic positive grape callus lines were obtained, named VvGGPPS1-OE1 and VvGGPPS1-OE2, which were used as biological replicates for subsequent detection.
[0073] GC-MS was used to detect free volatile compounds in wild-type callus and overexpression callus.
[0074] 4.2 Experimental Results A total of 91 free volatile compounds were detected in wild-type callus and VvGGPPS1-overexpressing callus, including esters, aldehydes, alcohols, ketones, hydrocarbons, aromatic compounds, and heterocyclic compounds (Table 2). Hydrocarbons were the most abundant, accounting for 58.42% of the total volatile substances, with 33 volatile metabolites detected. In VvGGPPS1-overexpressing callus, the content of 58 substances was significantly increased. Hydrocarbons, aromatic compounds, alcohols, and esters played the main roles, increasing by 1.19, 1.86, 1.62, and 1.33 times, respectively. Furthermore, (E)-2-heptenal, a compound with a strong rose aroma, was significantly increased by 1.98 times through VvGGPPS1 overexpression (Table 5). Therefore, VvGGPPS1 expression increases the content of rose-scented and fruit-scented compounds in grape callus.
[0075] 4.3 Conclusion These results indicate that VvGGPPS1 expression significantly increased the content of rose aroma-related compounds in grape callus, demonstrating that the VvGGPPS1 gene directly and positively regulates the synthesis of terpenoid compounds.
[0076] Table 4. Content of various volatile compounds in grape callus overexpressing VvGGPPS1 Compound categories WT(ng / g) VvGGPPS1-OE1(ng / g) VvGGPPS1-OE2(ng / g) Aromatic compounds 135.18 251.02 249.16 alcohols 406.44 657.86 650.43 hydrocarbons 11002.10 13125.01 13041.26 Aldehydes 966.79 728.18 720.48 Ketones 2999.67 1949.40 1935.55 esters 2208.89 2944.82 2968.97 Heterocyclic compounds 1112.35 1087.37 1068.64 Table 5. Changes in the content of major volatile compounds in grape callus overexpressing VvGGPPS1. Compound Name Chinese name category WT(ng / g) OE1 (ng / g) OE2 (ng / g) n-Hexane n-Hexane hydrocarbons 1.20 0.79 0.88 Ethyl Acetate Ethyl acetate esters 0.00 2.68 2.70 Hexane, 2-methyl- 2-Methylhexane hydrocarbons 188.61 959.39 961.57 Furan, tetrahydro-2-methyl- Tetrahydro-2-methylfuran Heterocyclic compounds 77.49 78.85 79.57 Hydrazine, 2-butenyl- 2-Butenylhydrazine Heterocyclic compounds 9.23 8.88 8.92 Heptane heptane hydrocarbons 11.83 5.58 5.53 Hexane, 2,5-dimethyl- 2,5-Dimethylhexane hydrocarbons 3.16 16.25 16.28 Hexane, 2,4-dimethyl- 2,4-Dimethylhexane hydrocarbons 0.76 1.39 1.35 1-Butanol, 3-methyl- 3-Methyl-1-butanol alcohols 14.31 301.79 301.25 Di-tert-butyl peroxide Di-tert-butyl peroxide peroxide 57.29 135.44 138.12 1-Hexene, 2,5-dimethyl- 2,5-Dimethyl-1-hexene hydrocarbons 3289.22 3262.34 3263.23 Heptane, 4-methyl- 4-Methylheptane hydrocarbons 2079.75 1659.48 1655.61 Heptane, 2-methyl- 2-Methylheptane hydrocarbons 40.47 106.87 106.85 Toluene Toluene Aromatic compounds 0.00 0.46 0.34 Heptane, 3-methyl- 3-Methylheptane hydrocarbons 2.36 2.00 2.01 1-Pentanol 1-Pentanol alcohols 4.31 24.34 24.29 3-Hexanone 3-Hexanone Ketones 13.63 45.91 45.01 2-Hexanone 2-Hexanone Ketones 2.35 6.99 6.84 Hexanal Hexanal Aldehydes 224.07 16.33 15.21 Hexane, 2,3,5-trimethyl- 2,3,5-Trimethylhexane hydrocarbons 18.18 44.84 44.33 Propanoic acid, 2,2-dimethyl- 2,2-Dimethylpropionic acid fatty acid 8.93 32.38 31.85 Heptane, 2,4-dimethyl- 2,4-Dimethylheptane hydrocarbons 2.64 1.01 1.01 Heptane, 2,6-dimethyl- 2,6-Dimethylheptane hydrocarbons 0.85 0.54 0.52 2,4-Dimethyl-1-heptene 2,4-Dimethyl-1-hepten hydrocarbons 0.52 1.25 1.22 1-Pentanol, 4-methyl- 4-Methyl-1-pentanol alcohols 2.03 1.34 1.43 2-Hexenal, (E)- (E)-2-Hexenal Aldehydes 97.78 30.51 30.19 2-Hexenal 2-Hexenal Aldehydes 188.98 490.09 484.63 Ethylbenzene Ethylbenzene Aromatic compounds 35.57 108.26 106.70 Octane, 4-methyl- 4-Methyloctane hydrocarbons 8.74 181.56 175.78 p-Xylene p-xylene Aromatic compounds 13.81 11.87 11.78 1-Hexanol 1-Hexanol alcohols 0.46 0.39 0.42 n-Butyl ether n-butyl ether ethers 7.69 6.10 6.21 1,3,5,7-Cyclooctatetraene 1,3,5,7-Cyclooctatetraene hydrocarbons 1.29 1.26 1.29 2-Propenoic acid, butylester Butyl acrylate esters 72.91 85.90 85.95 Nonane nonane hydrocarbons 3.13 21.67 21.38 Heptanal heptanal Aldehydes 8.36 6.50 6.23 2-Heptanol 2-Heptanol alcohols 11.40 12.02 11.86 Oxime-, methoxy-phenyl- Methoxyphenyl oxime Aromatic compounds 3.31 7.37 7.18 2-Hexanone oxime 2-hexanone oxime Oxime 744.15 587.34 574.10 Octane, 2,7-dimethyl- 2,7-Dimethyloctane hydrocarbons 6.74 4.44 4.52 Hexanal, O-methyloxime Hexanal O-methyl oxime Oxime 5.87 9.88 9.78 2-Heptenal, (E)- (E)-2-Heptenoal Aldehydes 2.81 5.57 5.46 Nonane, 4-methyl- 4-Methylnonane hydrocarbons 4.65 8.12 7.96 Benzaldehyde benzaldehyde Aldehydes 10.69 18.33 17.90 1-Heptanol 1-Heptanol alcohols 0.57 1.01 0.97 4-Oxo-5-methoxycarbonylthio-3-thiopentanoic acid,methyl ester Methyl 4-oxo-5-methoxycarbonylthio-3-thiovalerate esters 1.29 0.95 0.92 Furan, 2-pentyl- 2-Pentylfuran Heterocyclic compounds 15.12 5.51 5.68 Mesitylene Trimethylbenzene Aromatic compounds 0.00 1.73 1.68 Decane decane hydrocarbons 0.70 1.76 1.73 Octanal Octal Aldehydes 182.14 34.44 34.73 Decane, 5-methyl- 5-Methyldecane hydrocarbons 5.70 11.24 10.94 Nonane, 2,5-dimethyl- 2,5-Dimethylnonane hydrocarbons 28.48 39.33 38.52 Octane, 3,3-dimethyl- 3,3-Dimethyloctane hydrocarbons 19.70 61.53 61.36 1-Hexanol, 2-ethyl- 2-Ethyl-1-hexanol alcohols 15.68 20.82 20.51 Benzyl alcohol benzyl alcohol Aromatic compounds 9.74 19.44 18.97 2,6-Dimethyldecane 2,6-Dimethyldecane hydrocarbons 5.33 15.31 15.16 2-Octenal, (E)- (E)-2-Octenal Aldehydes 215.89 107.33 107.08 1,5-Cyclooctadiene, 1,3-dimethyl- 1,3-Dimethyl-1,5-cyclooctadiene hydrocarbons 36.87 68.66 67.54 2-Octen-1-ol, (E)- (E)-2-Octen-1-ol alcohols 37.86 71.44 70.22 1-Octanol 1-Octanol alcohols 63.03 116.46 113.69 1,6-Dioxaspiro[4.4]nonane, 2-ethyl- 2-Ethyl-1,6-dioxane[4,4]nonane Heterocyclic compounds 12.92 23.59 22.91 Nonanal Nononal Aldehydes 36.06 19.08 19.05 1-Nonanol 1-Nonol alcohols 237.82 84.16 82.20 Levomenthol L-menthol alcohols 18.97 24.10 23.60 Naphthalene Naphthalene Aromatic compounds 8.35 4.27 4.32 Octanoic acid, ethylester Ethyl octanoate esters 94.23 86.74 85.37 Dodecane dodecane hydrocarbons 1.02 0.73 0.75 Pivalic acid vinylester Vinyl neopentanoate esters 1688.65 2235.46 2261.93 Cyclohexane, 1-ethyl-1-methyl- 1-Ethyl-1-methylcyclohexane hydrocarbons 609.20 922.04 906.41 Benzene, 1,3-bis(1,1-dimethylethyl)- 1,3-Di-tert-butylbenzene Aromatic compounds 36.44 73.41 73.94 Dodecane, 2,6,11-trimethyl- 2,6,11-Trimethyldodecane hydrocarbons 9.80 3.76 3.77 3-tert-Butyl-2-pyrazolin-5-one 3-tert-butyl-2-pyrazolin-5-one Heterocyclic compounds 66.04 104.39 102.78 (S)-5-Butyl-5-ethyldihydrofuran-2(3H)-one (S)-5-Butyl-5-ethyldihydrofuran-2(3H)-one Ketones 28.70 40.48 39.72 2-Acetyl-5-methylthiophene 2-Acetyl-5-methylthiophene Heterocyclic compounds 169.14 256.98 253.14 3-Hexanone, 2,5-dimethyl-4-nitro- 2,5-Dimethyl-4-nitro-3-hexanone Ketones 591.10 853.59 841.65 1,8-Naphthalenedione,8a-ethylperhydro 8a-Ethylperhydro-1,8-naphthyldione Ketones 70.56 99.99 98.54 Propanoic acid, 2-methyl-, 3-hydroxy-2,2,4-trimethylpentyl ester 2-Methylpropionic acid-3-hydroxy-2,2,4-trimethylpentyl ester esters 51.63 77.86 76.65 Propanoic acid, 2-methyl-, 2-ethyl-3-hydroxyhexyl ester 2-Methylpropionic acid-2-ethyl-3-hydroxyhexyl ester esters 52.22 71.12 69.76 Decanoic acid, ethylester Ethyl decanoate esters 23.27 31.63 31.05 Tetradecane Tetradecane hydrocarbons 309.43 168.61 167.66 2-Allyl-2-methyl-1,3-cyclopentanedione 2-Allyl-2-methyl-1,3-cyclopentanedione Ketones 2293.33 902.44 903.79 Caryophyllene Caryophyllene hydrocarbons 854.03 1331.47 1332.49 Bicyclo[3.1.1]hept-2-ene, 2,6-dimethyl-6-(4-methyl-3-pentenyl)- 2,6-Dimethyl-6-(4-methyl-3-pentenyl)bicyclo[3.1.1]hept-2-ene hydrocarbons 3176.11 3883.67 3831.52 Humulene Humulusene hydrocarbons 66.57 69.12 68.24 Pentadecane pentadecane hydrocarbons 195.24 242.96 238.69 Phenol, 3,5-bis(1,1-dimethylethyl)- 3,5-Di-tert-butylphenol Aromatic compounds 27.96 24.22 24.26 2,2,4-Trimethyl-1,3-pentanedioldiisobutyrate 2,2,4-Trimethyl-1,3-pentanediol diisobutyrate esters 128.39 239.24 239.87 Caryophyllene oxide Caryophyllene oxide Heterocyclic compounds 12.38 11.96 11.75 Heptadecane heptadecane hydrocarbons 19.81 26.03 25.17 Ethyl tridecanoate Ethyl tridecanoate esters 81.61 98.92 100.68 Hexadecanoic acid, ethyl ester Ethyl palmitate esters 14.69 14.32 14.10 Example 5: VvGGPPS1 overexpression function verification experiment (tomato fruit) 5.1 Experimental Methods A VvGGPPS1 overexpression vector was constructed and transformed into tomatoes to obtain stable overexpressing transgenic plants. Two independent transgenic positive tomato plant lines were obtained, named VvGGPPS1-OE1 and VvGGPPS1-OE2, which were used as biological replicates for subsequent detection.
[0077] Free volatile compounds were detected in mature fruit using GC-MS.
[0078] 5.2 Experimental Results A total of 106 free volatile compounds were detected in ripe fruits of wild-type and VvGGPPS1-overexpressing tomatoes, including esters, aldehydes, alcohols, ketones, hydrocarbons, aromatic compounds, and heterocyclic compounds (Table 6). Aldehydes were the most abundant, accounting for 54.21% of the total volatile compounds, with 10 volatile metabolites detected. Hydrocarbons were the most numerous, with 34 volatile metabolites detected. The content of 53 substances was significantly increased in ripe fruits of VvGGPPS1-overexpressing tomatoes, with 1-Hexanol showing the largest change, reaching 8.16 times that of wild-type tissues. The rose aroma of the fruit was mainly influenced by the content of terpenoid compounds. The detected terpenoid compounds (1-ethynyl-1-cyclohexene, methoxyphenyl oxime, α-pinene, 3-ethyl-1,5-octadiene, p-cymene, D-limonene, 1-methyl-4-(1-methylethylidene)cyclohexene, linalool, 5-isopropenyl-2-methyl-7-oxabicyclo[4.1.0]heptane-2-ol, α-terpineol, 5-isopropenyl-2-methylcyclopent-1-en-1-carboxaldehyde, 2,6,6-trimethyl-1-cyclohexen-1-carboxaldehyde, (E)-3,7- Total amounts of dimethyl-2,6-octadienal, 4,11-dimethyl-8-(prop-2-yl)-5,12-dioxatricyclo[9.1.0.04,6]dodecane-7-ol, (E)-1-(2,6,6-trimethyl-1,3-cyclohexadien-1-yl)-2-buten-1-one, α-camphorenal, rosinone, and trans-β-ionone were statistically analyzed. The results showed that overexpression of VvGGPPS1 increased the content of terpenoids by 42.04–45.45%. Among them, the contents of rosinone and trans-β-ionone changed the most, by 5.77 times and 3.70 times that of WT, respectively (Table 7).
[0079] The above results indicate that the expression of VvGGPPS1 significantly increases the content of terpenoid compounds in tomato fruits, thereby enhancing the rose aroma characteristics of the fruits.
[0080] 5.3 Conclusion This result further demonstrates that the expression of VvGGPPS1 significantly increases the content of rose-scented compounds in tomato fruit, and cross-species verification of the positive regulatory role of the VvGGPPS1 gene in the synthesis of terpenoids.
[0081] Table 6. Content of various volatile compounds in tomato fruits overexpressing VvGGPPS1 Compound categories WT(ng / g) VvGGPPS1-OE1(ng / g) VvGGPPS1-OE2(ng / g) Aromatic compounds 51.62 50.81 50.35 alcohols 364.05 305.33 305.04 hydrocarbons 443.91 544.78 547.80 Aldehydes 3917.14 2925.56 2948.54 Ketones 1405.91 1485.44 1523.76 esters 89.75 102.49 105.24 Heterocyclic compounds 953.48 1051.31 1048.01 Table 7. Changes in the content of major terpenoid compounds in tomato fruits overexpressing VvGGPPS1. Compound Name Chinese name category WT(ng / g) OE1 (ng / g) OE2 (ng / g) n-Hexane n-Hexane hydrocarbons 172.70 205.75 199.97 Ethyl Acetate Ethyl acetate esters 34.91 23.78 23.25 1,3-Cyclopentadiene, 2-methyl- 2-Methyl-1,3-cyclopentadiene hydrocarbons 2.60 2.08 2.13 1,3-Cyclopentadiene, 1-methyl- 1-Methyl-1,3-cyclopentadiene hydrocarbons 2.55 2.05 2.03 Butanal, 3-methyl- 3-Methylbutanal Aldehydes 1.20 2.00 2.05 1-Penten-3-one 1-Penten-3-one Ketones 61.74 104.50 115.70 Cyclohexanol, 4-methyl- 4-Methylcyclohexanol alcohols 9.31 10.45 10.83 Hexane, 2,5-dimethyl- 2,5-Dimethylhexane hydrocarbons 4.78 6.55 6.72 Hexane, 2,4-dimethyl- 2,4-Dimethylhexane hydrocarbons 1.45 1.67 1.69 1-Butanol, 3-methyl- 3-Methyl-1-butanol alcohols 4.40 9.80 9.69 Di-tert-butyl peroxide Di-tert-butyl peroxide peroxide 64.36 61.57 65.56 Pentane, 1-chloro- 1-Chloropentane Halogenated products 1.91 1.09 1.20 2-Pentenal, (E)- (E)-2-pentenal Aldehydes 21.21 19.49 21.50 Heptane, 2-methyl- 2-Methylheptane hydrocarbons 9.98 15.43 15.90 Toluene Toluene Aromatic compounds 17.32 21.53 21.29 1-Pentanol 1-Pentanol alcohols 46.50 28.47 29.65 2-Penten-1-ol, (Z)- (Z)-2-penten-1-ol alcohols 11.72 6.03 6.19 3-Hexanone 3-Hexanone Ketones 1.18 0.96 0.93 Hexanal Hexanal Aldehydes 1622.47 1247.03 1244.32 Hexane, 2,3,5-trimethyl- 2,3,5-Trimethylhexane hydrocarbons 1.26 1.98 2.04 Heptane, 2,4-dimethyl- 2,4-Dimethylheptane hydrocarbons 21.71 33.03 34.12 2,4-Dimethyl-1-heptene 2,4-Dimethyl-1-hepten hydrocarbons 0.30 0.53 0.56 2-Hexenal, (E)- (E)-2-Hexenal Aldehydes 36.67 25.01 25.16 2-Hexenal 2-Hexenal Aldehydes 1704.58 1147.14 1158.82 p-Xylene p-xylene Aromatic compounds 9.42 11.29 11.09 1-Hexanol 1-Hexanol alcohols 6.28 51.23 49.57 1-Cyclohexene, 1-ethynyl- 1-Ethynyl-1-cyclohexene hydrocarbons 3.35 4.29 4.28 n-Hexyl acrylate Hexyl acrylate esters 6.23 6.39 6.69 Nonane nonane hydrocarbons 2.37 2.35 2.42 Heptanal heptanal Aldehydes 18.14 16.26 16.55 Oxime-, methoxy-phenyl- Methoxyphenyl oxime Aromatic compounds 18.29 10.25 10.02 2,4-Hexadienal, (E,E)- (E,E)-2,4-hexadienal Aldehydes 48.95 44.19 44.34 1-Butanol, 3-methyl-,nitrate 3-Methyl-1-butanol nitrate esters 1.88 3.23 3.41 Octane, 2,7-dimethyl- 2,7-Dimethyloctane hydrocarbons 0.77 1.13 1.16 α-Pinene α-pinene Terpenes 28.06 28.26 28.55 3-Ethyl-1,5-octadiene 3-Ethyl-1,5-Octadiene hydrocarbons 0.95 1.35 1.31 Oxirane, hexyl- Hexyl ethylene oxide hydrocarbons 1.13 1.57 1.52 2-Heptenal, (E)- (E)-2-Heptenoal Aldehydes 79.14 45.09 48.35 Benzaldehyde benzaldehyde Aldehydes 5.07 5.10 5.16 2-Butene, 1,4-diethoxy- 1,4-Diethoxy-2-butene ethers 6.25 5.17 4.88 Bicyclo[3.1.1]heptane,6,6-dimethyl-2-methylene-, (1S)- (1S)-6,6-dimethyl-2-methylenebicyclo[3.1.1]heptane hydrocarbons 9.27 9.44 9.44 1-Octen-3-ol 1-Octen-3-ol alcohols 198.71 125.81 124.48 5-Hepten-2-one, 6-methyl- 6-Methyl-5-hepten-2-one Ketones 946.47 889.12 874.95 Furan, 2-pentyl- 2-Pentylfuran Heterocyclic compounds 60.58 38.16 43.81 5-Hepten-2-ol, 6-methyl- 6-Methyl-5-hepten-2-ol alcohols 36.72 34.53 33.76 Cyclohexanol, 2-methyl-, cis- cis-2-methylcyclohexanol alcohols 8.33 5.80 6.02 Octanal Octal Aldehydes 7.26 5.41 5.49 1,3-Propanediol, 2-(hydroxymethyl)-2-methyl- 2-Methyl-2-hydroxymethyl-1,3-propanediol alcohols 2.45 2.06 2.22 Octane, 3,3-dimethyl- 3,3-Dimethyloctane hydrocarbons 3.84 3.33 3.38 p-Cymene p-cymene Terpenes 5.11 7.03 7.22 D-Limonene D-Limonene Terpenes 5.32 6.54 6.77 2-Isobutylthiazole 2-Isobutylthiazole Heterocyclic compounds 863.57 982.23 972.20 Bicyclo[3.1.1]heptan-3-ol, 2,6,6-trimethyl-,(1α,2β,3α,5α)- 2,6,6-Trimethylbicyclo[3.1.1]heptane-3-ol alcohols 6.11 6.63 8.33 2-Octene, 2-methyl-6-methylene- 2-Methyl-6-methylene-2-octene hydrocarbons 34.60 32.37 31.84 2,6-Dimethyldecane 2,6-Dimethyldecane hydrocarbons 9.43 7.79 7.82 2-Octenal, (E)- (E)-2-Octenal Aldehydes 62.09 39.98 44.55 2-Furanmethanol, 5-ethenyltetrahydro-α,α,5-trimethyl-, cis- cis-5-vinyl-α,α,5-trimethyltetrahydro-2-furanethanol Heterocyclic compounds 7.21 9.91 9.64 1-Octanol 1-Octanol Alcohols 6.74 3.16 2.76 Cyclohexene, 1-methyl-4-(1-methylethylidene)- 1-Methyl-4-(1-methylethylidene)cyclohexene Terpenes 0.91 2.13 2.12 trans-Linalool oxide(furanoid) trans-Linalool oxide (furanoid) Heterocyclic compounds 2.25 2.91 2.78 Benzene, 1-methyl-4-(1-methylethenyl)- 1-Methyl-4-(1-methylethenyl)benzene Aromatic compounds 2.21 3.32 3.20 2,3'-Bifuran, octahydro- Octahydro-2,3'-bifuran Heterocyclic compounds 7.24 2.98 3.14 Linalool Linalool Terpenes 41.97 60.98 62.35 Nonanal Nonanal Aldehydes 22.24 17.44 17.83 Cyclohexanol, 2,6-dimethyl- 2,6-Dimethylcyclohexanol Alcohols 7.98 6.07 5.83 α-Campholenal α-Campholenal Terpenes 1.23 1.21 1.23 (E)-13-Docosenoic acid (E)-13-Docosenoic acid Fatty acids 4.34 4.03 3.98 2-Nonenal, (E)- (E)-2-Nonenal Aldehydes 12.57 13.92 14.63 Pinocarvone Pinocarvone Terpenes 1.97 11.35 13.08 5-Isopropenyl-2-methyl-7-oxabicyclo[4.1.0]heptan-2-ol 5-Isopropenyl-2-methyl-7-oxabicyclo[4.1.0]heptan-2-ol Alcohols 3.84 3.78 3.67 3,6-Octadienal, 3,7-dimethyl- 3,7-Dimethyl-3,6-octadienal Aldehydes 1.61 1.48 1.52 Azulene Azulene Hydrocarbons 8.60 10.51 10.66 α-Terpineol α-Terpineol Terpenes 17.50 33.90 34.19 Dodecane Dodecane Hydrocarbons 4.84 4.00 4.09 Decanal Decanal Aldehydes 2.25 2.19 2.49 5-Isopropenyl-2-methylcyclopent-1-enecarboxaldehyde 5-Isopropenyl-2-methylcyclopent-1-enecarboxaldehyde Aldehydes 1.94 1.89 2.00 1-Cyclohexene-1-carboxaldehyde, 2,6,6-trimethyl- 2,6,6-Trimethyl-1-cyclohexene-1-carboxaldehyde Aldehydes 11.37 11.29 11.71 Cyclohexanol, 5-methyl-2-(1-methylethenyl)- 5-Methyl-2-(1-methylethenyl)cyclohexanol Alcohols 0.75 1.12 1.17 Ethanol, 2-(3,3-dimethylcyclohexylidene)-, (Z)- (Z)-2-(3,3-Dimethylcyclohexylidene)ethanol Alcohols 7.73 4.22 4.37 Neral Neral Aldehydes 45.22 49.52 49.45 Benzene, 1,3-bis(1,1-dimethylethyl)- 1,3-Bis(1,1-dimethylethyl)benzene Aromatic compounds 2.21 1.73 1.75 2-Decenal, (E)- (E)-2-Decenal Aldehydes 1.60 1.33 1.41 2,6-Octadienal, 3,7-dimethyl-, (E)- (E)-3,7-Dimethyl-2,6-octadienal (Geranial) Aldehydes 205.42 225.88 226.37 3-tert-Butyl-2-pyrazolin-5-one 3-tert-butyl-2-pyrazolin-5-one Heterocyclic compounds 5.35 7.55 7.88 2,4-Decadienal, (E,Z)- (E,Z)-2,4-decadienal Aldehydes 6.14 3.93 4.84 Cyclopropanemethanol,2-methyl-2-(4-methyl-3-pentenyl)- 2-Methyl-2-(4-methyl-3-pentenyl)cyclopropane-methanol alcohols 3.03 3.74 3.80 3-Nonen-5-yne, 4-ethyl-, (E)- (E)-4-Ethyl-3-nonen-5-yne hydrocarbons 6.51 4.14 5.23 2-Butanone, 4-(2,6,6-trimethyl-2-cyclohexen-1-ylidene)- 4-(2,6,6-trimethyl-2-cyclohexene-1-ylidene)-2-butanone Ketones 2.22 1.73 1.93 2,2,6,7-Tetramethyl-10-oxatricyclo[4.3.0.1(1,7)]decan-5-one 2,2,6,7-Tetramethyl-10-oxatricyclo[4.3.0.1(1,7)]decane-5-one Ketones 37.54 56.57 58.56 Propanoic acid, 2-methyl-, 3-hydroxy-2,2,4-trimethylpentyl ester 2-Methylpropionic acid-3-hydroxy-2,2,4-trimethylpentyl ester esters 14.56 22.40 22.90 2-Buten-1-one, 1-(2,6,6-trimethyl-1,3-cyclohexadien-1-yl)- 1-(2,6,6-trimethyl-1,3-cyclohexadien-1-yl)-2-buten-1-one Ketones 1.46 5.95 6.42 Propanoic acid, 2-methyl-, 2-ethyl-3-hydroxyhexyl ester 2-Methylpropionic acid-2-ethyl-3-hydroxyhexyl ester esters 17.26 28.20 29.46 4,11-Dimethyl-8-(propan-2-yl)-5,12-dioxatricyclo[9.1.0.04,6]dodecan-7-ol 4,11-Dimethyl-8-isopropyl-5,12-dioxatricyclo[9.1.0.04,6]dodecane-7-ol alcohols 3.46 2.41 2.68 2-Buten-1-one, 1-(2,6,6-trimethyl-1,3-cyclohexadien-1-yl)-,(E)- (E)-1-(2,6,6-trimethyl-1,3-cyclohexadien-1-yl)-2-buten-1-one (trans-β-ionone) Ketones 41.18 152.54 159.87 Decanoic acid, ethylester Ethyl decanoate esters 1.76 1.38 1.47 Tetradecane Tetradecane hydrocarbons 3.13 3.69 3.72 5,9-Undecadien-2-one,6,10-dimethyl- 6,10-Dimethyl-5,9-Undecadien-2-one Ketones 244.50 212.98 236.12 trans-β-Ionone trans-β-ionone Terpenes 17.87 16.87 18.53 3-Buten-2-one, 4-(2,2,6-trimethyl-7-oxabicyclo[4.1.0]hept-1-yl)- 4-(2,2,6-trimethyl-7-oxabicyclo[4.1.0]heptan-1-yl)-3-buten-2-one Ketones 18.18 14.13 14.80 Pentadecane pentadecane hydrocarbons 11.04 12.17 12.80 Phenol, 3,5-bis(1,1-dimethylethyl)- 3,5-Di-tert-butylphenol Aromatic compounds 2.17 2.69 3.00 2(4H)-Benzofuranone, 5,6,7,7a-tetrahydro-4,4,7a-trimethyl-, (R)- (R)-5,6,7,7a-tetrahydro-4,4,7a-trimethyl-2(4H)-benzofuranone Heterocyclic compounds 7.27 7.56 8.56 2,2,4-Trimethyl-1,3-pentanedioldiisobutyrate 2,2,4-Trimethyl-1,3-pentanediol diisobutyrate esters 13.15 17.11 18.06 Hexadecane hexadecane hydrocarbons 2.55 3.42 3.20 Heptadecane heptadecane hydrocarbons 4.27 5.89 5.74 5,9,13-Pentadecatrien-2-one, 6,10,14-trimethyl-, (E,E)- (E,E)-6,10,14-trimethyl-5,9,13-pentadecatrien-2-one Ketones 51.44 46.96 54.48 Example 6: Gene editing breeding guided by SNP molecular markers in the VvGGPPS1 promoter region 6.1 Target Design Guide RNA (gRNA) for the CRISPR / Cas9 gene editing system was designed targeting the promoter region containing the VvGGPPS1-103 site (103rd position from the 5′ end of SEQ ID NO.1) with the goal of editing unfavorable alleles (C) into favorable alleles (T).
[0082] 6.2 Genetic transformation Embryogenic callus from grape varieties carrying unfavorable alleles (CC at VvGGPPS1-103) was used as material, and a vector containing the above-mentioned editing system was introduced into it using Agrobacterium-mediated transformation.
[0083] 6.3 Editing Plant Selection The regenerated transgenic plants were sequenced at the target site, and plants with the expected editing event (C edited to T) were successfully screened. The genotype of the edited plants was detected using the method described in Example 2. If the homozygous CC was successfully edited to heterozygous CT, the plant was predicted to have high aroma potential.
[0084] 6.4 Significance This embodiment demonstrates that the present invention is not only a selection marker, but can also be used as a precisely designed target to directly improve specific shortcomings of existing superior varieties without the need for a lengthy hybridization and backcrossing process, thus greatly expanding the application value of the invention.
[0085] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A SNP molecular marker associated with grape terpenoid aroma compounds, characterized in that, The SNP molecular marker is located in the promoter region of the VvGGPPS1 gene, corresponding to the 103rd base from the 5′ end of the sequence shown in SEQ ID NO.1 being either C or T.
2. The SNP molecular marker according to claim 1, characterized in that, When the genotype of the SNP molecular marker is CC, the grapevine does not have a rose fragrance; when the genotype is CT or TT, the grapevine has a rose fragrance.
3. A primer pair for detecting the SNP molecular marker of claim 1 or 2, characterized in that, The primer pair has nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.
3.
4. A method for detecting the SNP molecular marker as described in claim 1 or 2, characterized in that, Includes the following steps: (1) Extract genomic DNA from the grape plants to be tested; (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using the primer pair shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain a DNA fragment containing the target SNP site; (3) Sequencing the PCR amplification product obtained in step (2) and analyzing the nucleotide type of the 103rd base from the 5′ end of the sequence shown in SEQ ID NO.
1.
5. The method according to claim 4, characterized in that, The sequencing described in step (3) is Sanger sequencing.
6. A kit for assisted selection of grape aroma traits, characterized in that, It includes the primer pair as described in claim 3.
7. The kit according to claim 6, characterized in that, It also contains reagents for PCR amplification.
8. The application of the SNP molecular marker of claim 1 or 2, the primer pair of claim 3, the method of claim 4 or 5, or the kit of claim 6 or 7 in the early screening of grape aroma traits.
9. The application of the SNP molecular marker of claim 1 or 2, the primer pair of claim 3, the method of claim 4 or 5, or the kit of claim 6 or 7 in marker-assisted breeding of grapes.
10. A molecular marker-assisted selection method for grape aroma traits, characterized in that, Includes the following steps: (1) The method described in claim 4 or 5 is used to detect the SNP molecular marker genotype of the grape plant to be tested; (2) If the test result is CC homozygous, the plant is determined not to have a rose fragrance; (3) If the test result is CT heterozygous or TT homozygous, the plant is determined to have a rose fragrance.
Citation Information
Patent Citations
KASP molecular marker related to rose fragrance of grape fruits and application of KASP molecular marker
CN114107549A
KASP molecular marker primer combination for identifying rose fragrance character of grape fruit and application of KASP molecular marker primer combination
CN120648847A
Application of protein and related biological materials thereof in promoting monoterpene accumulation of grape fruits
CN121653160A
Mutant staphylococcus beta-glucuronidase enzymes with enhanced enzymatic activity
US20160237415A1
Methods and materials for production of terpenoids
WO2015197075A1