Detection technology of one-step engineered RPA / CRISPR-Cas and application thereof
By mixing RPA and CRISPR-Cas technologies in a single-tube system and using a combination of normal and mutant primers, the problem of CRISPR-Cas nuclease cutting nucleic acid amplification templates was solved, achieving efficient and sensitive nucleic acid detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NANFANG HOSPITAL OF SOUTHERN MEDICAL UNIV
- Filing Date
- 2024-12-02
- Publication Date
- 2026-06-02
AI Technical Summary
Existing RPA/CRISPR-Cas detection technologies involve CRISPR-Cas nuclease cutting the nucleic acid amplification template in the same system, which affects amplification efficiency and detection sensitivity. Furthermore, the operation is complex and susceptible to aerosol contamination, leading to false positive results.
An engineered one-step method is used to completely mix RPA and CRISPR-Cas technologies in a single-tube system. Normal and mutant primers are used, and the amplification products of the mutant primers are identical or complementary to crRNA. The Cas protein recognizes only the amplification products of the mutant primers, avoiding cleavage of the original template and maintaining high detection activity.
It achieves nucleic acid detection that is simple to operate, highly sensitive, and has good specificity, solves the problem of incompatibility between CRISPR cutting reaction and nucleic acid amplification reaction, and improves detection sensitivity and amplification efficiency.
Smart Images

Figure CN122128469A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological detection, and specifically relates to an engineered one-step RPA / CRISPR-Cas detection technology and its application. Background Technology
[0002] The clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system is a natural immune system found in bacteria and archaea, and is now being used as a tool for gene editing and nucleic acid detection. [1] Nucleic acid detection technology based on the CRISPR-Cas system has shown great promise for next-generation point-of-care molecular diagnostics due to its high sensitivity, specificity, and reliability. [2] The CRISPR-Cas system mainly consists of Cas protein and crRNA. The complex formed by Cas protein and crRNA can bind to targets with PAM motifs (TTTN) or (NGG) to cleave double-stranded DNA or single-stranded RNA, and activate the paracleavage activity of Cas protein. The Cas protein with activated paracleavage activity can cleave single-stranded DNA probes (ssDNA reporters) with fluorescent and quenching groups, producing a significant fluorescent signal. [3] Recombinase polymerase amplification (RPA) is a technique developed by Piepenburg. [4] In 2006, researchers developed a novel isothermal nucleic acid amplification technique using protein recombination and repair derived from cellular DNA synthesis. This technique boasts advantages such as ease of operation, speed, and high sensitivity. The domestically developed Enzymatic Recombinase Amplification (EPA) technique operates on the same principle as RPA and is a variant of RPA technology. By combining RPA pre-amplification, Cas9, Cas12a, and Cas13 nucleases have been used to develop DDACD and DETECTOR, respectively. [5] System and SHERLOCK [6]The system is used for high-sensitivity and specific nucleic acid detection. However, when RPA and CRISPR-Cas systems are used in the same system, CRISPR-Cas nucleases cleave the nucleic acid amplification template, affecting amplification efficiency and detection sensitivity. Therefore, the DETECTOR and SHERLOCK systems employ a two-step method that separates the RPA and CRISPR-Cas reactions. However, this two-step reaction requires opening the reaction cap and transferring the liquid, making it susceptible to aerosol contamination, which may lead to false positive results and increase operational complexity. These platform technologies still face a key bottleneck in application: the incompatibility between CRISPR cleavage and nucleic acid amplification reactions. Currently, there are two main methods: ① Modifying the CRISPR-Cas crRNA with a photosensitive group to inactivate it, and then using light to activate the CRISPR-Cas nuclease activity after nucleic acid amplification; this technology completely solves the problem of CRISPR-Cas nuclease cleavage of template DNA and has the advantage of high sensitivity. [7] However, this method has drawbacks such as high cost and complex operation; ② Selecting a target fragment with a suboptimal PAM sequence or mutating the CRISPR-Cas nuclease can reduce its cleavage activity against the target sequence. [8] However, this method cannot completely prevent CRISPR-Cas from cutting the target, and it also reduces the activity of CRISPR-Cas, resulting in limited improvement in sensitivity.
[0003] [1]PICKAR-OLIVER A,GERSBACH C A.The next generation of CRISPR-Castechnologies and applications[J]. Nat Rev Mol Cell Biol, 2019, 20(8):490-507.
[0004] [2]YANG H, ZHANG Y, TENG X, et al. CRISPR-based nucleic acid diagnostics for pathogens[J]. TrAC Trends in Analytical Chemistry, 2023,160.
[0005] [3]LI SY, CHENG QX, LIU JK, et al. CRISPR-Cas12a has both cis-andtrans-cleavage activities on single-stranded DNA[J]. Cell Research, 2018, 28(4):491-3.
[0006] [4]PIEPENBURG O, WILLIAMS CH, STEMPLE DL, et al. DNA detection using recombination proteins [J]. PLoS Biol, 2006, 4(7):e204.
[0007] [5]CHEN JS,MAE,HARRINGTON LB,et al.CRISPR-Cas12a target bindingunleashes indiscriminate single-stranded DNase activity[J].Science,2018,360(6387):436-9.
[0008] [6]GOOTENBERG JS,ABUDAYYEH OO,LEE JW,et al.Nucleic acid detection with CRISPR-Cas13a / C2c2[J].Science,2017,356(6336):438-42.
[0009] [7]HU M, LIU R, QIU Z, et al. Light-Start CRISPR-Cas12a Reaction with Caged crRNAEnables Rapid and Sensitive Nucleic Acid Detection[J]. AngewandteChemie International Edition, 2023, 62(23).
[0010] [8]LU S,TONG Summary of the Invention
[0011] The primary objective of this invention is to overcome the shortcomings and deficiencies of the prior art and provide an engineered one-step RPA / CRISPR-Cas detection technology.
[0012] Another object of the present invention is to provide the application of the above-mentioned detection technology.
[0013] Another object of the present invention is to provide a kit for detecting the novel coronavirus.
[0014] Another object of the present invention is to provide a kit for detecting Mycoplasma pneumoniae.
[0015] The objective of this invention is achieved through the following technical solution: an engineered one-step RPA / CRISPR-Cas detection technology, which combines RPA and CRISPR-Cas technologies. The RPA component for nucleic acid amplification and the component for CRISPR-Cas detection are completely mixed in a single-tube system before the reaction begins. The primers in the RPA component for nucleic acid amplification consist of normal primers and mutant primers. The crRNA in the component for CRISPR-Cas detection has a sequence that is identical or complementary to the product amplified by the mutant primers.
[0016] The RPA technology variant mentioned above is EPA.
[0017] The normal primers consist of a normal upstream primer and a normal downstream primer.
[0018] The mutant primer is at least one of a mutant upstream primer and a mutant downstream primer. The relative positions of the normal primer and the corresponding mutant primer in the target nucleic acid sequence generally need to be consistent. The mutation method of the mutant primer relative to the normal primer includes one or more of the following: insertion of at least one base, deletion of at least one base, and substitution of at least one base.
[0019] In the normal primers or the mutant primers, a CRISPR-Cas PAM sequence needs to be present at a position 1-18 bases from the 3' end. The PAM sequence includes TTTN of CRISPR-Cas12a or NGG of CRISPR-Cas9, or the PAM corresponding to other engineered CRISPR-Cas systems.
[0020] The normal primers and the mutant primers are mixed in a molar ratio of 1:99 to 99:1.
[0021] The components used for CRISPR-Cas detection also include Cas proteins with paracleavage activity.
[0022] The Cas protein with paracleavage activity is preferably Cas9, Cas12, or other CRISPRCas proteins with paracleavage activity.
[0023] The Cas9 is preferably at least one of SpyCas9 and FnCas9.
[0024] The Cas12 is preferably at least one of LbCas12a, AsCas12a and FnCas12a.
[0025] The amplification products obtained by crRNA and normal primers in the CRISPR-Cas have inconsistent or non-complementary sequences, resulting in low binding activity to the amplification products obtained by normal primers, thus the Cas protein will not cleave the amplification template; the amplification products obtained by crRNA and mutant primers have consistent or complementary sequences, resulting in high binding activity to the amplification products obtained by mutant primers.
[0026] The above-mentioned engineered one-step RPA / CRISPR-Cas detection technology is applied in the preparation of microbial detection kits.
[0027] The aforementioned microbial detection kits include rapid detection kits for clinical pathogens, kits for food safety testing, kits for agricultural microbiology testing, kits for livestock microbiology testing, or kits for environmental microbiology testing.
[0028] The pathogens mentioned include bacteria or viruses that cause respiratory infections and diarrhea.
[0029] A kit for detecting the novel coronavirus includes an RPA component for nucleic acid amplification and a component for CRISPR-Cas detection; wherein the RPA component for nucleic acid amplification includes primers, or includes primers and a rehydration buffer; the component for CRISPR-Cas detection includes crRNA, or includes at least one of Cas protein with paracleavage activity, ssDNA and NE buffer and crRNA.
[0030] The primers are shown below:
[0031] RPA-FP-1: 5'-GCGGTGATGCTGCTCTTGCTTTGCTGCTGC-3';
[0032] RPA-RP-1: 5'-CAGATTTCTTAGTGACAGTTTGGCCTTGTT-3';
[0033] RPA-mRP-1: 5'-CAGATTTCTTAGTGACAGTTTGGCCTTGGTT-3';
[0034] The crRNA is shown below:
[0035] mcrRNA-1: 5'-UAAUUUCUACUAAGUGUAGAUGCCUUGGUUGUUGUUGGCCU-3'.
[0036] The preferred composition of the RPA component for nucleic acid amplification is as follows: Rehydration Buffer, 10 μM forward primer RPA-FP-1, 10 μM reverse primer RPA-RP-1, and 10 μM mutant reverse primer RPA-mRP-1 are mixed in a volume ratio of 7.5:1:0.4:0.6.
[0037] The preferred composition of the components used for CRISPR-Cas detection is as follows: 1 μM of Cas protein with paracleavage activity, 1 μM of mcrRNA-1, 10 μM of ssDNA, and NE buffer are mixed in a volume ratio of 1:1:1:1.5.
[0038] The kit for detecting the novel coronavirus also includes instructions for use.
[0039] The method of use includes the following steps: Mix 9.5 μL of RPA component for nucleic acid amplification and 4.5 μL of component for CRISPR-Cas detection evenly, then add 5 μL of sample to be tested and 1 μL of MgOAc at a concentration of 280 mM, and detect at a constant temperature of 39℃ for 40 min.
[0040] A kit for detecting Mycoplasma pneumoniae includes an RPA component for nucleic acid amplification and a component for CRISPR-Cas detection; wherein the RPA component for nucleic acid amplification includes primers, or includes primers and a rehydration buffer; the component for CRISPR-Cas detection includes crRNA, or includes at least one of Cas protein with paracleavage activity, ssDNA and NE buffer and crRNA.
[0041] The primers are shown below:
[0042] RPA-FP-2: 5'-GGATAACGAAAGACCGGGTTTGATGTGGATA-3';
[0043] RPA-RP-2: 5'-TGTCGGAGTCAGCTTCCTTTTGAAAGCCCTGC-3';
[0044] RPA-mRP-2: 5'-GGATAACGAAAGACCGGGTTTGATGTATGGATA-3'.
[0045] The crRNA is shown below:
[0046] mcrRNA-2: 5'-UUAAUUUCUACUAAGUGUAGAUAUGUAUGGAUAACUCUGAAA-3'.
[0047] The preferred composition of the RPA component for nucleic acid amplification is as follows: Rehydration Buffer, 10 μM forward primer RPA-FP-2, 10 μM reverse primer RPA-RP-2, and 10 μM mutant reverse primer RPA-mRP-2 are mixed in a volume ratio of 7.5:1:0.2:0.8.
[0048] The preferred composition of the components used for CRISPR-Cas detection is as follows: 1 μM of Cas protein with paracleavage activity, 1 μM of mcrRNA-2, 10 μM of ssDNA, and NE buffer are mixed in a volume ratio of 1:1:1:1.5.
[0049] The kit for detecting Mycoplasma pneumoniae also includes instructions for use.
[0050] The method of use includes the following steps: Mix 9.5 μL of RPA component for nucleic acid amplification and 4.5 μL of component for CRISPR-Cas detection evenly, then add 5 μL of sample to be tested and 1 μL of MgOAc at a concentration of 280 mM, and detect at a constant temperature of 39℃ for 40 min.
[0051] This invention develops a novel one-step isothermal amplification combined with CRISPR-Cas technology that exhibits no target cleavage activity while maintaining high-efficiency CRISPR-Cas detection activity. Named the engineered RPA / CRISPR-Cas one-step method, all components used for nucleic acid amplification and CRISPR-Cas detection are completely mixed in a single-tube system. The principle is as follows: Figure 1 As shown: When normal and mutated primers are added to the RPA system simultaneously, the normal primer participates in RPA amplification first, ensuring the detection performance of RPA. Then, the mutated primer is incorporated into the amplification system to produce mutated amplification products. The amplification products obtained by the crRNA mutated primer have the same or complementary sequences. After the amplification products obtained by the mutated primer bind to crRNA, they are recognized by the Cas protein. Therefore, the Cas protein is only active for the amplification products of the mutated primer and cannot cleave the original template molecule. The normal amplification products continue to participate in amplification, ensuring amplification efficiency and detection sensitivity.
[0052] The present invention has the following advantages and effects compared with the prior art:
[0053] This invention has the advantages of simple and rapid operation, high sensitivity and good specificity, and effectively solves the problem of low sensitivity when CRISPR cleavage reaction and nucleic acid amplification reaction are in the same system. Attached Figure Description
[0054] Figure 1 This is a schematic diagram of the engineered one-step RPA / CRISPR-Cas12a.
[0055] Figure 2 This is a graph showing the sensitivity results of a conventional one-step method for detecting the novel coronavirus.
[0056] Figure 3 This is a graph showing the sensitivity results of an engineered one-step method for detecting the novel coronavirus.
[0057] Figure 4 This refers to the activity of the mutated CRISPR-Cas 12a system against the DNA template of the novel coronavirus in a one-step engineered process.
[0058] Figure 5 This is a graph showing the specific results of an engineered one-step method for detecting the novel coronavirus.
[0059] Figure 6 This is a graph showing the sensitivity results of the conventional one-step method for detecting Mycoplasma pneumoniae.
[0060] Figure 7 This is a graph showing the sensitivity results of an engineered one-step method for detecting Mycoplasma pneumoniae.
[0061] Figure 8 This refers to the activity of the mutant CRISPR-Cas 12a system against the DNA template of Mycoplasma pneumoniae in a one-step engineered process.
[0062] Figure 9 This is a diagram showing the specific results of an engineered one-step method for detecting Mycoplasma pneumoniae. Detailed Implementation
[0063] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0064] The primers used in this invention are shown in Table 1:
[0065] Table 1
[0066] name Sequence (5'-3') RPA-FP-1 GCGGTGATGCTGCTCTTGCTTTGCTGCTGC RPA-RP-1 CAGATTTCTTAGTGACAGTTTGGCCTTGTT crRNA-1 UAAUUUCUACUAAGUGUAGAUGCCUUGUUGUUGUUGGCCUU RPA-mRP-1 CAGATTTCTTAGTGACAGTTTGGCCTTGGTT mcrRNA-1 UAAUUUCUACUAAGUGUAGAUGCCUUGGUUGUUGUUGGCCU RPA-FP-2 GGATAACGAAAGACCGGGTTTGATGTGGATA RPA-RP-2 TGTCGGAGTCAGCTTCCTTTTGAAAGCCCTGC crRNA-2 UAAUUUCUACUAAGUGUAGAUAUGUGGAUAACUCUGAAAC RPA-mFP-2 GGATAACGAAAGACCGGGTTTGATGTATGGATA mcrRNA-2 UUAAUUUCUACUAAGUGUAGAUAUGUAUGGAUAACUCUGAAA
[0067] Example 1: Detection of the novel coronavirus
[0068] (1) The specific operation procedure of the conventional one-step method is as follows: Add 7.5 μL of rehydration buffer, 1 μL of 10 μM forward primer RPA-FP-1, and 1 μL of 10 μM reverse primer RPA-RP-1, and mix well to prepare RPA reagent; add 1 μL of 1 μM LbaCas 12a, 1 μL of 1 μM crRNA-1, 1 μL of 10 μM ssDNA, and 1.5 μL NE buffer, and mix well to prepare CRISPR reagent. Mix RPA reagent and CRISPR reagent, add 5 μL of sample to be tested and 1 μL of MgOAc (from ERA kit, concentration 280 mM, kit from Suzhou Xianda Gene Technology Co., Ltd.), and use a PCR instrument to detect at 39℃ for 40 min.
[0069] (2) The specific operation procedure of the engineered one-step method is as follows: Add 7.5 μL Rehydration Buffer, 1 μL of 10 μM forward primer RPA-FP-1, 0.4 μL of 10 μM reverse primer RPA-RP-1, and 0.6 μL of 10 μM mutant reverse primer RPA-mRP-1, and mix well to prepare the RPA reagent. Add 1 μL of 1 μM LbaCas 12a, 1 μL of 1 μM mutant crRNA (i.e., mcrRNA-1), 1 μL of 10 μM ssDNA, and 1.5 μL NE buffer, and mix well to prepare the CRISPR reagent. Mix the ERA reagent and CRISPR reagent, add 5 μL of the sample to be tested and 1 μL of MgOAc, and incubate at 39℃ for 40 min.
[0070] (3) Sensitivity detection: The sample to be tested in this experiment is a novel coronavirus plasmid, which was obtained by Sangon Biotech (Shanghai) Co., Ltd. by synthesizing the SARS-CoV-2N gene sequence shown below, and then cloning the SARS-CoV-2N gene sequence into the pUC57 vector.
[0071] CGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAG
[0072] ATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAA
[0073] GAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGAC.
[0074] The sensitivity results are as follows Figure 2 and Figure 3 As shown, the detection limit for the conventional one-step method for detecting SARS-CoV-2 RNA is 1000 copies / μL (see...). Figure 2 The engineered one-step method for detecting SARS-CoV-2 RNA has a detection limit of 1 copy number (μL) and a sensitivity that can be improved by 1000 times (see...). Figure 3 ).
[0075] (4) Detection of the activity of mutant CRISPR-Cas 12a against normal template: A 41-base DNA double strand that recognizes the mutant crRNA (i.e., mcrRNA-1) was chemically synthesized as the mutant template. A 41-base DNA double strand that recognizes the normal crRNA (i.e., crRNA-1) was chemically synthesized as the normal template. 1 μL of 1 μM LbaCas 12a, 1 μL of 1 μM mutant crRNA (i.e., mcrRNA-1), 1 μL of 10 μM ssDNA, 2 μL of NE buffer, and 5 μL of sterile enzyme-free water were mixed to prepare the CRISPR reagent. 10 μL of template was mixed with the CRISPR reagent at concentrations of 100 nM, 10 nM, 1 nM, and 100 pM, and the mixture was incubated in a PCR instrument for 20 minutes. The results are shown below. Figure 4 As shown, when the template concentration is 100 pM, the Cas12a activity is only 8% of that of the mutant template, indicating that the mutant CRISPR-Cas12a system has virtually no activity against the normal template and amplification products.
[0076] (5) Specificity Detection: Specificity verification was performed on throat swab samples containing eight common respiratory pathogens. These eight pathogens were obtained from the Department of Laboratory Medicine at Nanfang Hospital and were identified by the hospital as influenza A virus (IVA), respiratory syncytial virus (RSV), parainfluenza virus (PIV), adenovirus (ADV), rhinovirus (RHV), mycoplasma pneumoniae (MP), influenza B virus (IVB), and novel coronavirus (SARS-CoV-2). 5 μL of each sample was tested using engineered one-step reagents, and fluorescence values were detected using a PCR instrument. The results are shown below. Figure 5 As shown, the engineered one-step method produces a highly sensitive fluorescent signal for novel coronavirus samples, but does not produce a signal for other respiratory pathogens.
[0077] Example 2: Detection of Mycoplasma pneumoniae
[0078] (1) The specific operation procedure of the conventional one-step method is as follows: Add 7.5 μL of rehydration buffer, 1 μL of 10 μM forward primer RPA-FP-2, and 1 μL of 10 μM reverse primer RPA-RP-2, and mix well to prepare the RPA reagent; add 1 μL of 1 μM LbaCas 12a, 1 μL of 1 μM crRNA-2, 1 μL of 10 μM ssDNA, and 1.5 μL NE buffer, and mix well to prepare the CRISPR reagent. Mix the RPA reagent and CRISPR reagent, add 5 μL of the sample to be tested and 1 μL of MgOAc, and incubate at 39℃ for 40 min.
[0079] (2) The specific operation procedure of the engineered one-step method is as follows: Add 7.5 μL Rehydration Buffer, 1 μL of 10 μM forward primer RPA-FP-2, 0.2 μL of 10 μM reverse primer RPA-RP-2, and 0.8 μL of 10 μM mutant reverse primer RPA-mRP-2, and mix well to prepare the RPA reagent. Add 1 μL of 1 μM LbaCas 12a, 1 μL of 1 μM mutant crRNA (i.e., mcrRNA-2), 1 μL of 10 μM ssDNA, and 1.5 μL NE buffer, and mix well to prepare the CRISPR reagent. Mix the RPA reagent and CRISPR reagent, add 5 μL of the sample to be tested and 1 μL of MgOAc, and incubate at 39℃ for 40 min.
[0080] (3) Sensitivity detection: The sample to be tested in this experiment was Mycoplasma pneumoniae plasmid, which was obtained by Beijing Qingke Biotechnology Co., Ltd. by synthesizing the Mycoplasma pneumoniae mgpA gene sequence as shown below, and then cloning the Mycoplasma pneumoniae mgpA gene sequence into the pUC57 vector.
[0081] GAACTATCCGCCCAGTTGAAGAACGCCCAAGTGAAACCACCACGGTTTGTGGGACTGAAAGGCGCG
[0082] CGATGTTTTGCTCCAAACCACCGGGTTCTTCAACCCGCGCCGCCACCCCGAGTGGTTTGATGGCGGG
[0083] CAGACGGTCGCGGATAACGAAAGACCGGGTTTGATGTGGATAACTCTGAAACACCAAGCAGGGC
[0084] TTTCAAAAGGAAGCTGACTCCGACAAGTCGGCCCCGATCGCCCTCCCGTTTGAAGCGTACTTCGCCA
[0085] ACATTGGCAACCTCACCTGGTTCGGGCAAGCGCTTTTGGTGTTTGGTGGCAATGGCCATGTTACCAAG
[0086] TCGGCCCACACCGCGCCTTTGAGTATAGGTGTCTTTAGGGTGCCGCTATAATGCAACTGGTACCAGTGCTACTGTAACTGGTTGACCATATGCCTTACTG.
[0087] The sensitivity results are as follows Figure 6 and Figure 7 As shown, the detection limit for the conventional one-step method to detect Mycoplasma pneumoniae RNA is 100 copies / μL (see...). Figure 6 The detection limit for the engineered one-step method for detecting Mycoplasma pneumoniae RNA is 1 copy number / μL (see...). Figure 7 The sensitivity can be increased by 100 times.
[0088] (4) Detection of the activity of mutant CRISPR-Cas 12a against normal template: A 42-base DNA double strand that recognizes the mutant crRNA (i.e., mcrRNA-2) was chemically synthesized as the mutant template. A 41-base DNA double strand that recognizes the normal crRNA (i.e., crRNA-2) was chemically synthesized as the normal template. 1 μL of 1 μM LbaCas 12a, 1 μL of 1 μM mutant crRNA (i.e., mcrRNA-2), 1 μL of 10 μM ssDNA, 2 μL of NE buffer, and 5 μL of sterile enzyme-free water were mixed to prepare the CRISPR reagent. 10 μL of template was mixed with the CRISPR reagent at concentrations of 100 nM, 10 nM, 1 nM, and 100 pM, and the mixture was incubated in a PCR instrument for 20 minutes. The results are shown below. Figure 8 As shown, when the template concentration is 10 nM, the Cas12a activity is only 4% of that of the mutant template, indicating that the mutant CRISPR-Cas12a system has virtually no activity against normal templates and amplification products.
[0089] (5) Specificity Detection: Specificity verification was performed on throat swab samples containing eight common respiratory pathogens. These eight pathogens were obtained from the Department of Laboratory Medicine at Nanfang Hospital and were identified by the hospital as influenza A virus, respiratory syncytial virus, parainfluenza virus, adenovirus, rhinovirus, mycoplasma pneumoniae, influenza B virus, and novel coronavirus. 5 μL of each sample was tested using engineered one-step reagents, and fluorescence values were detected using a PCR instrument. The results are shown below. Figure 9 As shown, the engineered one-step method produces a highly sensitive fluorescence signal for Mycoplasma pneumoniae samples, but does not produce a signal for other respiratory pathogens.
[0090] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. An engineered one-step RPA / CRISPR-Cas detection technology, characterized in that: The reaction begins only after the RPA component used for nucleic acid amplification and the component used for CRISPR-Cas detection are completely mixed in a single tube system. The primers in the RPA component used for nucleic acid amplification consist of normal primers and mutant primers. The crRNA used for CRISPR-Cas detection has the same or complementary sequence as the product amplified by the mutant primers.
2. The engineered one-step RPA / CRISPR-Cas detection technology according to claim 1, characterized in that: The normal primers consist of a normal upstream primer and a normal downstream primer; The mutation primer is at least one of a mutation upstream primer and a mutation downstream primer; The mutation methods of the aforementioned mutation primers include one or more of the following: inserting at least one base, deleting at least one base, and replacing at least one base; The normal primers and their corresponding mutant primers are in the same relative position in the target nucleic acid sequence; In the normal primers or the mutant primers described herein, a CRISPR-Cas PAM sequence is required at a position 1-18 bases from the 3' end.
3. The engineered one-step RPA / CRISPR-Cas detection technology according to claim 1, characterized in that: The paracleavage-active protein in the CRISPR-Cas is Cas9, Cas12, or other CRISPR-Cas proteins with paracleavage activity.
4. The engineered one-step RPA / CRISPR-Cas detection technology according to claim 3, characterized in that: The Cas9 mentioned is SpyCas9, FnCas9, or other Cas9 with a side-cutting effect; The Cas12a mentioned is LbCas12a, AsCas12a, FnCas12a or other Cas12a with a side-cutting effect.
5. The application of the engineered one-step RPA / CRISPR-Cas detection technology according to any one of claims 1 to 4 in the preparation of microbial detection kits.
6. The application according to claim 5, characterized in that: The aforementioned microbial detection kit is a rapid detection kit for clinical pathogens, a kit for food safety testing, a kit for agricultural microbiology testing, a kit for livestock microbiology testing, or a kit for environmental microbiology testing.
7. A kit for detecting the novel coronavirus, characterized in that: It includes RPA components for nucleic acid amplification and components for CRISPR-Cas detection; wherein, the RPA components for nucleic acid amplification include primers, or include primers and rehydration buffer; the components for CRISPR-Cas detection include crRNA, or include at least one of Cas protein with paracleavage activity, ssDNA and NE buffer and crRNA. The primers are shown below: RPA-FP-1: 5'-GCGGTGATGCTGCTCTTGCTTTGCTGCTGC-3'; RPA-RP-1: 5'-CAGATTTCTTAGTGACAGTTTGGCCTTGTT-3'; RPA-mRP-1: 5'-CAGATTTCTTAGTGACAGTTTGGCCTTGGTT-3'; The crRNA is shown below: mcrRNA-1: 5'-UAAUUUCUACUAAGUGUAGAUGCCUUGGUUGUUGUUGGCCU-3'.
8. The kit for detecting the novel coronavirus according to claim 7, characterized in that: The RPA component for nucleic acid amplification is composed of the following: Rehydration Buffer, 10 μM forward primer RPA-FP-1, 10 μM reverse primer RPA-RP-1, and 10 μM mutant reverse primer RPA-mRP-1 mixed in a volume ratio of 7.5:1:0.4:0.
6. The components used for CRISPR-Cas detection are as follows: 1 μM of Cas protein with paracleavage activity, 1 μM of mcrRNA-1, 10 μM of ssDNA, and NE buffer are mixed in a volume ratio of 1:1:1:1.
5.
9. A kit for detecting Mycoplasma pneumoniae, characterized in that: It includes RPA components for nucleic acid amplification and components for CRISPR-Cas detection; wherein, the RPA components for nucleic acid amplification include primers, or include primers and rehydration buffer; the components for CRISPR-Cas detection include crRNA, or include at least one of Cas protein with paracleavage activity, ssDNA and NE buffer and crRNA. The primers are shown below: RPA-FP-2: 5'-GGATAACGAAAGACCGGGTTTGATGTGGATA-3'; RPA-RP-2: 5'-TGTCGGAGTCAGCTTCCTTTTGAAAGCCCTGC-3'; RPA-mRP-2: 5'-GGATAACGAAAGACCGGGTTTGATGTATGGATA-3'; The crRNA is shown below: mcrRNA-2: 5'-UUAAUUUCUACUAAGUGUAGAUAUGUAUGGAUAACUCUGAAA-3'.
10. The kit for detecting Mycoplasma pneumoniae according to claim 9, characterized in that: The RPA component for nucleic acid amplification is composed of the following: Rehydration Buffer, 10 μM forward primer RPA-FP-2, 10 μM reverse primer RPA-RP-2, and 10 μM mutant reverse primer RPA-mRP-2 mixed in a volume ratio of 7.5:1:0.2:0.
8. The components used for CRISPR-Cas detection are as follows: 1 μM of Cas protein with paracleavage activity, 1 μM of mcrRNA-2, 10 μM of ssDNA, and NE buffer are mixed in a volume ratio of 1:1:1:1.5.