Use of yap in preparation of drugs for preventing or treating retinal ganglion cell injury
By using YAP expression promoters such as GA-017 to promote YAP expression or activity, the problems of oxidative stress and neuroinflammation in retinal ganglion cells are solved, thus protecting retinal ganglion cells and providing a new treatment method for traumatic optic neuropathy and glaucoma.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- XIEHE HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI & TECH UNIV
- Filing Date
- 2026-04-27
- Publication Date
- 2026-06-05
AI Technical Summary
In the prior art, oxidative stress and neuroinflammatory responses of retinal ganglion cells are not effectively controlled in optic nerve injury, leading to irreversible vision loss, and the role of YAP in the retina is unclear.
By using YAP expression promoters, such as YAP activator GA-017 or its pharmaceutically acceptable salts, to promote YAP expression or activity, drugs can be prepared to reduce retinal oxidative stress levels, inhibit neuroinflammatory responses, and reduce retinal ganglion cell death.
It significantly reduces retinal oxidative stress levels, inhibits neuroinflammatory responses, reduces retinal ganglion cell death, and protects nerve function, providing a new therapeutic target for traumatic optic neuropathy and glaucoma.
Smart Images

Figure CN122140678A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of optic nerve injury treatment drugs, specifically providing the application of YAP in the preparation of drugs for the prevention or treatment of retinal ganglion cell injury. Background Technology
[0002] Optic nerve injury is a leading cause of irreversible vision loss in traumatic optic neuropathy and glaucoma, characterized by progressive degeneration of retinal ganglion cells (RGCs) and permanent interruption of visual signal transmission. Following axonal injury, RGCs undergo metabolic stress, ischemia, and neuroinflammatory damage, all of which contribute to neuronal dysfunction and cell death. At the heart of this degenerative cascade is oxidative stress, specifically the accumulation of excessive reactive oxygen species (ROS) in the damaged retina, which damages cellular macromolecules and accelerates RGC degeneration. Although endogenous antioxidant processes can mitigate optic nerve injury, the specific molecular regulatory mechanisms linking oxidative stress to RGC degeneration remain unclear.
[0003] Neuronal susceptibility to oxidative and inflammatory stress depends on multiple factors, such as the activation of endogenous stress response signaling pathways. Yes-associated protein (YAP), a key effector molecule in the Hippo pathway, regulates cell survival, redox homeostasis, and tissue repair in various organs. Besides its roles in growth and stress responses, YAP is also thought to be involved in the regulation of antioxidant defense, mitochondrial function, and inflammatory signaling. In the central nervous system, YAP plays a role in the maintenance of neural stem cells, glial cell activation, and neuronal survival; however, its role in the retinal response to optic nerve injury remains unclear. The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) is a core regulator of retinal cell redox homeostasis, controlling gene networks and downstream detoxification enzymes involved in detoxification and cell protection. Although Nrf2 activity is classically regulated by Kelch-like ECH-associated protein 1 (Keap1)-dependent degradation and redox-sensitive nuclear translocation, evidence suggests that upstream signaling pathways can further regulate Nrf2 expression and activity. It is worth noting that reports have shown that YAP can affect Nrf2-related antioxidant programs in extraocular tissues, which raises the possibility that YAP may play a role in the antioxidant regulation of the retina after injury through a mechanism involving Nrf2. Summary of the Invention
[0004] This invention proposes the application of YAP in the preparation of drugs for the prevention or treatment of retinal ganglion cell damage, providing a new option for the relief or treatment of traumatic optic neuropathy and glaucoma.
[0005] The technical solution of this invention is implemented as follows:
[0006] The first aspect of the present invention is to provide the use of a YAP expression promoter in the preparation of a medicament for the prevention or treatment of retinal ganglion cell damage.
[0007] A second aspect of the invention is to provide the use of YAP expression promoters in the preparation of medicaments for the prevention or treatment of traumatic optic neuropathy.
[0008] A third aspect of the invention is to provide the use of a YAP expression promoter in the preparation of a medicament for the prevention or treatment of glaucoma.
[0009] Furthermore, in any of the applications of the first to third aspects above, the drug includes at least one of the following uses: 1) Protects nerve function; 2) Reduce retinal oxidative stress levels; 3) Inhibits neuroinflammatory responses; 4) Reduce the number of dead retinal ganglion cells.
[0010] Furthermore, in any of the first to third aspects above, the YAP expression promoter includes a protein activity or protein level promoter, or an mRNA level promoter.
[0011] Preferably, the mRNA level promoter comprises YAP-overexpressing adeno-associated virus.
[0012] Furthermore, in any of the first to third aspects above, the YAP expression promoter is YAP activator GA-017 or a pharmaceutically acceptable salt thereof.
[0013] YAP activator GA-017 has the CAS number 2351906-74-4 and the molecular formula C. 18 H 21 N3O4, structural formula: .
[0014] The term "pharmaceutically acceptable salt" includes, but is not limited to, salts formed by the combination of an acid with an imine, or salts formed by the combination of a base with a phenolic hydroxyl group; the reagents that can be used include, but are not limited to: pharmaceutically acceptable acid addition salts, such as: salts of inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, metaphosphoric acid, nitric acid, and sulfuric acid, and salts of organic acids such as acetic acid, ethanesulfonic acid, benzenesulfonic acid, benzoic acid, citric acid, fumaric acid, gluconic acid, glycolic acid, hydroxyethanesulfonic acid, lactic acid, lactobionic acid, maleic acid, malic acid, methanesulfonic acid, succinic acid, p-toluenesulfonic acid, and tartaric acid; and salts of pharmaceutically acceptable bases selected from ammonium salts, alkali metal salts (such as sodium salts, potassium salts), and alkaline earth metal salts (such as magnesium salts, calcium salts), as well as salts of glycerol (2-amino-2-hydroxymethyl-1,3-propanediol), diethanolamine, lysine, or ethylenediamine.
[0015] Furthermore, in any of the first to third aspects described above, the drug includes pharmaceutically acceptable excipients.
[0016] Preferably, the pharmaceutically acceptable excipients include at least one of diluents, binders, wetting agents, lubricants, disintegrants, solvents, emulsifiers, cosolvents, solubilizers, preservatives, pH adjusters, osmotic pressure adjusters, surfactants, coating materials, antioxidants, antibacterial agents, or buffers.
[0017] Furthermore, in any of the first to third aspects above, the dosage form of the drug is one or more of the following: injection, eye drops, eye wash, ophthalmic cream, ophthalmic gel, oral preparation, microcapsule preparation, or suppository.
[0018] Furthermore, in any of the first to third aspects above, the drug is administered via intravitreal injection.
[0019] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention proposes a novel function of YAP in protecting retinal ganglion cells after optic nerve injury. It demonstrates that upregulating YAP expression or activity can significantly reduce retinal oxidative stress levels, inhibit neuroinflammatory responses, and decrease the number of dead RGCs, thereby effectively protecting nerve function. This provides a novel therapeutic target for traumatic optic neuropathy and glaucoma, diseases characterized by RGC damage. YAP or its expression promoters can be used to prepare drugs for the prevention, alleviation, and / or treatment of these diseases, showing significant clinical application potential. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0021] Figure 1 The results of YAP expression detection in the retinal tissues of sh-YAP and control mice in Example 1 of this invention are shown.
[0022] Figure 2 The results of TUNEL staining and RBPMS staining of mouse retina in Example 1 of this invention are shown.
[0023] Figure 3 The results show the detection levels of reactive oxygen species and Nrf2, SOD-1, SOD-2, and Nqo-1 mRNA in mouse retinal tissue in Example 2 of this invention.
[0024] Figure 4 The results show the mouse retinal IL-1β mRNA level and IBA-1 immunofluorescence staining results in Example 2 of this invention.
[0025] Figure 5 The results are Western blot detection of YAP expression level in mouse retina, as well as RBPMS staining and RGC counting results of retinal patch in Example 3 of the present invention.
[0026] Figure 6 The results of immunofluorescence staining of reactive oxygen species, Nrf2 protein and mRNA expression levels, SOD-2, Nqp-1 mRNA expression levels, IL-10 mRNA expression levels, and IBA-1 in mouse retinal tissue in Example 3 of this invention are as follows.
[0027] Figure 7 The results of immunofluorescence staining of primary retinal ganglion cells and the effects of sh-YAP AAV2 virus and GA-017 intervention on YAP expression levels in Example 4 of this invention are shown.
[0028] Figure 8 The results show the cell viability detection and Thy-1 and Tuj-1 staining of primary retinal ganglion cells after intervention in Example 4 of this invention.
[0029] Figure 9 The results show the levels of reactive oxygen species and Nrf2 and YAP proteins in primary retinal ganglion cells after intervention in Example 4 of this invention. Detailed Implementation
[0030] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0031] In one embodiment, C57BL / 6 mice were used as experimental subjects. YAP knockdown and activation models were constructed using sh-YAP AAV2 virus and the YAP activator GA-017, respectively, to establish a mouse ONC model. The relationship between YAP and RGC damage was investigated. The results showed that YAP knockdown significantly enhanced retinal oxidative stress and neuroinflammation in mice, leading to increased RGC damage, while YAP activation had the opposite effect. Furthermore, primary RGC cells were infected with sh-YAP AAV2 virus, and an oxidative damage model was constructed using H2O2. The results showed that YAP inhibition promoted H2O2-induced primary RGC cell damage and oxidative stress, while YAP activation inhibited these processes.
[0032] These results indicate that YAP reduces retinal oxidative stress, inhibits neuroinflammation, and decreases the number of dead retinal globulins (RGCs) in the ONC model. Given YAP's ability to inhibit RGC damage, it can be applied in the preparation of drugs for the prevention, mitigation, and / or treatment of diseases primarily characterized by RGC damage (such as traumatic optic neuropathy and glaucoma), providing a theoretical and clinical basis for researching new targets and strategies for the prevention, mitigation, and / or treatment of traumatic optic neuropathy and glaucoma.
[0033] (1) Establishment of the ONC model
[0034] Male C57BL / 6 mice aged 6-8 weeks were selected for the experiment. All mice were housed at the SPF Animal Experiment Center of Huazhong University of Science and Technology. Housing conditions: room temperature 22-24℃, humidity 40-70%, 12-hour light-dark cycle, free access to water and food.
[0035] Modeling process:
[0036] ① Mouse anesthesia: 1% sodium pentobarbital solution was taken at a body weight of 40 mg / kg, fixed, and then injected intraperitoneally for anesthesia.
[0037] ②Preoperative preparation: The mouse was fixed in the right lateral decubitus position (with the left eye as the surgical eye), the eyelashes of the mouse's left eye were cut off, and local anesthesia was performed with oxybuprocaine hydrochloride eye drops.
[0038] ③ Expose the optic nerve: Gently cut open the conjunctival sac and perform blunt dissection to expose the optic nerve. Hold the exposed optic nerve with crossed forceps for 3 seconds at a distance of about 2 mm from the root of the optic nerve. Observe the pupil gradually dilate and then reposition the eyeball.
[0039] ④ Treatment of the contralateral eye: Separate the optic nerve of the contralateral eye using the same method, without clamping.
[0040] ⑤ Postoperative management: Administer 1 drop of levofloxacin eye drops to prevent infection. Observe the mice for 3 days postoperatively. If no infection, cataract, or retinal hemorrhage occurs, they will be included in the experiment.
[0041] (2) Injection of sh-YAP AAV2 virus and YAP activator GA-017
[0042] The construction process of sh-YAP AAV2 virus is as follows: shRNA targets were designed based on the transcripts of the Mouse Yap1 gene, and primers were synthesized. Single-stranded primers were annealed into double-stranded oligo sequences, ligated into a double-digested linearized RNA interference vector, replacing the original ccdB virulence gene. Transformants were screened by colony PCR, and positive clones were sequenced for verification. After sequencing verification, high-purity plasmids were extracted and packaged to obtain the sh-YAP AAV2 virus.
[0043] The target sequence for sh-YAP is: TGAGAACAATGACAACCAATA
[0044] The specific primers are as follows: F: ACCGTGAGAACAATGACAACCAATACTCGAGTATTGGTTGTCATTGTTCTCATTTTTTg R: ctagcaaaaaaTGAGAACAATGACAACCAATACTCGAGTATTGGTTGTCATTGTTCTCA
[0045] ①Preoperative preparation: Anesthetize and fix the mice, and use compound tropicamide eye drops to dilate the pupils.
[0046] ② Injection: After the pupil has fully dilated, use toothed ophthalmic forceps under a microscope to grasp the bulbar conjunctiva below the eye and gently pull it outwards to expose 1 mm behind the corneal limbus. Holding a microsyringe, slowly insert the needle perpendicular to the corneal limbus, then tilt it slightly so that the needle tip is visible through the pupil. After insertion, slowly and steadily inject the liquid. After injection, wait 10 seconds and then quickly withdraw the needle. During the injection, keep the mouse's ocular surface moist and avoid damaging the retina and lens during needle insertion. Exclude mice with cataracts or retinal hemorrhage.
[0047] (3) Calculation of the number of retinal ganglion cells in mice
[0048] The number of retinal ganglion cells in mice in each group was counted 7 days after ONC, as follows: Seven days after the end of ONC, mice were euthanized under anesthesia with 1% sodium pentobarbital. Eyeballs were collected and fixed overnight in 4% paraformaldehyde solution or at room temperature for 4 hours. The fixed eyeballs were then transferred to PBS solution. The cornea was grasped with toothed ophthalmic forceps, and the cornea was cut along the edge of the forceps and discarded. The iris, ciliary body, and pigment epithelium were then removed. After separating the retina surrounding the lens, the lens was removed with toothed ophthalmic forceps, and the retinal tissue was cut into a cloverleaf shape. The retina was blocked for 3 hours at room temperature with a blocking solution of 5 ml 3% Triton and 250 μL 5% BSA, and then blocked overnight in primary antibody (RBPMS, Proteintech, 15187-1-AP) diluted with the blocking solution. After washing with PBS, the cells were incubated with secondary antibody (Cy3-conjugated Goat Anti-Rabbit IgG (H+L), Proteintech, SA00009-2) diluted with blocking buffer at room temperature in the dark for 1 h 30 min. Retinal ganglion cell counting was performed using ImageJ version 1.8.0 (National Institutes of Health, USA) and ZEN version 3.10 software (Carl Zeiss AG, DE). For retinal ganglion cell counting in immunofluorescence staining of retinal patches, 1-2 fields of view were selected near the edge of each leaf of the retina cut into a four-leaf clover shape. The counts were performed on the selected fields, and the average of 4-8 fields of view was taken.
[0049] (4) Isolation and culture of primary mouse retinal ganglion cells
[0050] ① Plate coating: Cover 96-well / 24-well / 6-well plates with poly-L-lysine solution and incubate overnight at room temperature. Before use, aspirate the poly-L-lysine solution and rinse 3 times with PBS solution.
[0051] ②Retinal Separation: Pregnant C57BL / 6 mice were anesthetized, and the unborn mice were dissected and placed on ice. They were first immersed in physiological saline for 15 seconds, then in 75% ethanol for 15 seconds. The eyeballs were then quickly enucleated and placed in a culture dish pre-filled with 1 mL of EBSS medium. After complete separation of the eyeballs, the retina was dissected on ice. The separated retina was transferred to a new culture dish containing 1 mL of EBSS medium.
[0052] ③ Digestion and Sieving: After the retina is fragmented, 1 mL of 0.25% trypsin is added to a culture dish for digestion for 20 min. Every 5 min, the culture dish is removed and the retina is dispersed by blowing. Trypsin digestion is stopped using 2 mL of DMEM medium supplemented with fetal bovine serum, and the cells are gently dispersed in the liquid by pipetting. After the cells are fully dispersed, they are filtered through a 40 μm diameter sieve, and the filtered cells are placed in a 50 mL centrifuge tube.
[0053] ④ Centrifugation and Plate Preparation: Transfer the cell suspension from a 50 mL centrifuge tube to a 10 mL centrifuge tube and centrifuge at 4 ℃ and 1500 rpm for 5 min. After centrifugation, discard the supernatant and reselect cells using 1 mL of DMEM medium. Gently disperse the cells and add them to a plate coated with poly-L-lysine solution at the desired density, then place the plate in an incubator.
[0054] ⑤ Change the medium: About 3-4 hours after seeding the plate, once the cells have completely adhered to the bottom of the plate, completely aspirate the culture medium from the well plate and add an appropriate amount of Neurobasal medium (with added B27, BDNF, CTNF and bovine insulin).
[0055] (5) Pathological analysis
[0056] Mice in each group underwent pathological analysis 3 or 7 days after ONC.
[0057] ① Immunofluorescence staining: Mice were euthanized by anesthesia with 1% sodium pentobarbital, and the eyeballs were enucleated and fixed overnight in 4% paraformaldehyde. Frozen sections were prepared, permeabilized with 0.1% Triton X-100 for 15 min, and then blocked with 5% BSA for 30 min. Samples were incubated overnight at 4°C with the following primary antibodies: Iba1 (1:400; Wako; LEE6425), RBPMS (1:400; Proteintech, 15187-1-AP), or YAP (1:400; Santa Cruz Biotechnology; sc-101199). After washing with PBS, secondary antibodies labeled with Alexa Fluor 488 or Cy3 (1:400; RGAM002; Proteintech; SA00009-1, SA00009-2) were added and incubated for 1.5 h. Cell nuclei were counterstained with 4',6-diamidinyl-2-phenylindole (DAPI) (Abcam; ab104139). Images were acquired using a confocal microscope (Leica Microsystems) and processed using ImageJ (National Institutes of Health) and ZEN software (Carl Zeiss AG).
[0058] ②Terminal deoxynucleotidyl transferase-mediated dUTP nickel-terminal labeling (TUNEL) assay: Retinal cell apoptosis was assessed using a TUNEL kit (KTA2010; Abbkin) according to the manufacturer's instructions. TUNEL-positive cells in the ganglion cell layer were quantified by blinded observers in the treatment group.
[0059] ③ Reactive Oxygen Species (ROS) Detection: Intracellular ROS levels were assessed using a reactive oxygen species fluorescence assay kit (Elabscience; E-BC-K138-F). Single-cell suspensions of retinal cells were prepared by digesting them with 0.25% trypsin, while primary retinal ganglion cells were washed with PBS. The cells were then incubated at 37°C with DCFH-DA in the dark for 30 min. After incubation, fluorescence intensity was quantified using a microplate reader (excitation / emission wavelength = 500 / 525 nm) or observed under a fluorescence microscope after DAPI counterstaining.
[0060] ④ Cell viability assay: Primary retinal ganglion cells (5×10⁻⁶) 3 Cells (per well) were treated with 1 μL of sh-YAP AAV2 or GA-017 for 3 days and exposed to H2O2. After 1 h of incubation, the medium was replaced with fresh Neurobasal medium, and the cells were cultured for another 24 h. Cell viability was quantified by measuring absorbance at 450 nm using the CCK-8 reagent (Beijing Lanjieke Technology Co., Ltd.; BS350B).
[0061] (6) Molecular biological detection
[0062] ①Western blot analysis: Retinal tissue and primary retinal ganglion cells were lysed in RIPA lysis buffer (Beyotime; P00138) supplemented with a protease inhibitor cocktail (MedChemExpress; HY-K0010). After sonication and centrifugation (12,000 × g, 10 min, 4℃), the supernatant was collected and quantified using the BCA method. An equal volume of protein was mixed with loading buffer (Biosharp; BL502A), boiled, and then separated by electrophoresis on a 10% SDS-PAGE gel and transferred to a polyvinylidene fluoride membrane. The membrane was blocked for 1 h in Tris-buffered saline containing 5% skim milk or 5% BSA, and then incubated overnight at 4°C with the following primary antibodies: YAP, p-YAP (1:500; Proteintech; 80694-2-RR), large tumor suppressor 1 / 2 (LATS1 / 2) (1:500; Proteintech; 17049-1-AP), p-LATS1 / 2 (1:500; Affinity Biosciences; AF7169), and Nrf2 (1:500; ABclonal; A0674). After incubation with the corresponding HRP-labeled secondary antibodies (1.5 h), protein bands were visualized using an enhanced chemiluminescence reagent. The band intensity was analyzed using ImageJ software (version 1.8.0), and the expression level of the target protein was normalized to the corresponding loading control.
[0063] ②RT-PCR detection: Total RNA was isolated and extracted from tissues and cells using Trizol (Cowin; CW0508S) and Trizol Pal (Lablead; R1200). RNA precipitate was precipitated with isopropanol, washed with 75% ethanol, air-dried, and then dissolved in DEPC-treated water. RNA concentration and purity were assessed using the A260 / A280 ratio. cDNA was obtained by reverse transcription using ABScript III RT MasterMix (ABclonal; RK20429). qRT-PCR reactions were performed on a real-time quantitative PCR system using SYBR Green Master Mix (ABclonal; RK21203) (95℃ 3 min; 95℃ 5 s, 60℃ 30-34 s, 40-45 cycles), followed by melting curve analysis. Gene expression levels were normalized using Actin as an internal control.
[0064] The primer sequences used are shown in the table below: Gene name Primer sequences (5′–3′) Nrf2 GGTTGCCCACATTCCCAAAC-FTATCCAGGGCAAGCGACTCA-R SOD-1 CGGTGAACCAGTTGTGTTGT-FCAGGTCTCCAACATGCCTCTC-R SOD-2 TGGAGAACCCAAAGGAGAGTTG-FCAGGCAGCAATCTGTAAGCG-R YAP1 TGCCATGAACCAGAGGATCAC-FATTCCGTATTGCCTGCCGAA-R Nqo-1 AGAGAGTGCTCGTAGCAGGAT-FCTACCCCCAGTGGTGATAGAAA-R Actin CAGGTCTGAGGCCTCCCTTTT-FGCTGCCTCAACACCTCAACC-R
[0065] The following examples demonstrate experimental verification of the above process, verification results, and conclusions.
[0066] Example 1: Effect of YAP knockdown on retinal ganglion cell survival
[0067] C57BL / 6 mice were divided into four groups: sh-Control-Control, sh-Control-ONC, sh-YAP-Control, and sh-YAP-ONC. Sh-YAP AAV2 was injected intravitreally to knock down YAP expression. The Control group underwent only sham surgery, while the ONC group underwent ONC surgery. RBPMS staining was performed 7 days post-surgery.
[0068] Figure 1 A shows the IBA-1 and RBPMS staining results of retinal patch samples from C57BL / 6 mice infected with sh-YAP AAV2 virus. Figure 1 B shows the RT-PCR results of YAP expression in the retinal tissues of Control and sh-YAP mice. The YAP mRNA level in the retinal tissue of the sh-YAP group was significantly reduced, indicating that YAP expression in the sh-YAP group was inhibited, and the knockdown model was successfully constructed.
[0069] Figure 2 A shows the results of TUNEL staining in the mouse retina. The number of TUNEL-positive cells in the retinal ganglion cell layer of the sh-Control-ONC group and the sh-YAP-ONC group was significantly increased, indicating that RGC apoptosis increased after ONC. Figure 2 Figures B and C show the results of RBPMS staining and RGC counting in mouse retinal patch, indicating that compared with the sh-Control-ONC group, the sh-YAP-ONC group had significantly more RGC deaths (p < 0.0001), indicating increased RGC damage.
[0070] Example 2: Effects of YAP knockdown on inflammatory response and oxidative stress during ONC.
[0071] C57BL / 6 mice were divided into four groups: sh-Control-Control, sh-Control-ONC, sh-YAP-Control, and sh-YAP-ONC. Sh-YAP AAV2 was injected intravitreally to knock down YAP expression. The Control group underwent sham surgery, while the ONC group underwent ONC surgery. Reactive oxygen species (ROS) detection, RT-PCR, and IBA-1 immunofluorescence staining were performed 3 days later.
[0072] Figure 3 A shows the results of reactive oxygen species detection in mouse retinal tissue. Compared with the sh-Control-ONC group, the reactive oxygen species level in the sh-YAP-ONC group was significantly increased. Figure 3BE was used to detect the mRNA levels of Nrf2, SOD-1, SOD-2, and Nqo-1 in mouse retinal tissue. Compared with the sh-Control-ONC group, the mRNA levels of Nrf2 (p < 0.01) and its downstream antioxidant stress molecules were significantly reduced in the sh-YAP-ONC group. These results indicate that YAP knockdown can increase the oxidative stress response in the mouse retina after ONC.
[0073] Figure 4 A represents the IL-1β mRNA level in the mouse retina. Compared with the sh-Control-ONC group, the IL-1β mRNA level in the sh-YAP-ONC group was significantly increased (p < 0.01). Figure 4 B shows the results of IBA-1 immunofluorescence staining in the mouse retina. Compared with the Control-ONC group, the microglia in the sh-YAP-ONC group were shortened, indicating that YAP knockdown activated microglia. These results suggest that YAP knockdown promotes the inflammatory response during the ONC process.
[0074] Example 3: Effects of YAP overexpression on retinal ganglion cell damage, oxidative stress, and inflammatory response during ONC. Influence
[0075] C57BL / 6 mice were divided into four groups: Vehicle-Control group, Vehicle-ONC group, GA-017-Control group, and GA-017-ONC group. The Control group underwent sham surgery, while the ONC group underwent ONC surgery. Reactive oxygen species (ROS) detection, RT-PCR detection, and IBA-1 immunofluorescence staining were performed 3 days later.
[0076] Figure 5 A and B show the results of Western blot analysis of YAP expression levels in the retina of mice after intervention with the YAP activator GA-017. After GA-017 intervention, the expression level of YAP in the retina increased, while the p-YAP / YAP level decreased (p < 0.05), indicating that GA-017 can activate retinal YAP. Figure 5 C and D are the results of RBPMS staining and RGC counting of mouse retinal patches. They show that compared with the Vehicle-ONC group, the RGC death of mice in the GA-017-ONC group was significantly reduced (p < 0.01), indicating that YAP activation can reduce RGC damage.
[0077] Figure 6 A shows the results of reactive oxygen species (ROS) detection in mouse retinal tissue. Compared with the Vehicle-ONC group, the ROS level in the GA-017-ONC group was significantly reduced (p < 0.001). Figure 6BG detected the levels of Nrf2 protein and mRNA expression, SOD-2 and Nqp-1 mRNA expression in mouse retinal tissue. Compared with the Vehicle-ONC group, the GA-017-ONC group showed significantly increased levels of Nrf2 cytokine expression (p < 0.05), nuclear Nrf2 protein (p < 0.05), and total Nrf2 protein (p < 0.0001), and the expression levels of downstream Nrf2 cytokines were also significantly increased. Figure 6 H and I show the results of IL-10 mRNA expression level detection and IBA-1 immunofluorescence staining in mouse retinal tissue. Compared with the Vehicle-ONC group, the IL-10 mRNA expression level in the GA-017-ONC group was significantly increased (p < 0.05), while the number of retinal microglia decreased and the protrusions were extended. These results indicate that YAP overexpression significantly inhibited ONC-induced retinal oxidative stress and neuroinflammation.
[0078] Example 4: Effects of YAP inhibition and overexpression on primary retinal ganglion cell damage and oxidative stress
[0079] Primary retinal ganglion cells treated with sh-YAP AAV2 virus and GA-017, respectively, were stimulated with H2O2, and then the cells were collected for cell line viability, Western blot analysis, and reactive oxygen species detection.
[0080] Figure 7 A shows the results of Tuj-1 and Thy-1 immunofluorescence staining of isolated primary retinal ganglion cells, indicating that these cells exhibit typical neuronal morphology. Figure 7 BD analysis of the intervention effects of sh-YAP AAV2 virus and GA-017 showed that sh-YAP AAV2 virus can significantly reduce the expression level of YAP in primary retinal ganglion cells, while GA-017 can significantly increase YAP expression.
[0081] Figure 8 A represents cell viability assay, which shows that the cell viability of the sh-YAP AAV2 group was significantly lower than that of the H2O2 group, while the cell viability of the GA-017 group was significantly increased. Figure 8 B shows Thy-1 and Tuj-1 staining of primary retinal ganglion cells after intervention. Compared with the H2O2 group, the sh-YAP AAV2 group had significantly fewer cells and shorter axons (p < 0.0001), while the GA-017 group had more cells and longer axons (p < 0.05). These results indicate that YAP inhibition significantly increased cell damage caused by H2O2 stimulation, while YAP activation had the opposite effect.
[0082] Figure 9A represents the reactive oxygen species (ROS) level in primary retinal ganglion cells after intervention. Compared to the H2O2 group, the sh-YAPAAV2 group showed an increase in positively stained cells, while the GA-017 group showed a decrease in positively stained cells. Figure 9 B, C, and D represent the Nrf2 and YAP protein levels in primary retinal ganglion cells after intervention. Compared to the H2O2 group, the sh-YAP AAV2 group showed decreased YAP expression (p < 0.0001) and decreased Nrf2 expression (p < 0.01), while the GA-017 group showed the opposite. These results indicate that YAP inhibition significantly increased cellular oxidative stress and decreased cellular antioxidant stress, while YAP activation had the opposite effect.
[0083] The results showed that in ONC-induced retinal ganglion cell damage, YAP knockdown mice exhibited significantly increased retinal ganglion cell damage, elevated retinal oxidative stress levels, and enhanced inflammatory responses. YAP overexpression reduced ONC-induced retinal ganglion cell damage in mice, decreased retinal oxidative stress, and reduced neuroinflammation. This indicates that YAP can protect retinal ganglion cells and plays an important protective role in retinal ganglion cell injury models.
[0084] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. Application of YAP expression promoters in the preparation of drugs for the prevention or treatment of retinal ganglion cell damage.
2. Application of YAP expression promoters in the preparation of drugs for the prevention or treatment of traumatic optic neuropathy.
3. Application of YAP expression promoters in the preparation of drugs for the prevention or treatment of glaucoma.
4. The application as described in any one of claims 1-3, characterized in that, The application includes at least one of the following: 1) Protects nerve function; 2) Reduce retinal oxidative stress levels; 3) Inhibits neuroinflammatory responses; 4) Reduce the number of dead retinal ganglion cells.
5. The application as described in any one of claims 1-3, characterized in that, The YAP expression promoters include protein activity or protein level promoters, or mRNA level promoters.
6. The application as described in any one of claims 1-3, characterized in that, The YAP expression promoter is YAP activator GA-017 or a pharmaceutically acceptable salt thereof.
7. The application as described in any one of claims 1-3, characterized in that, The drug includes pharmaceutically acceptable excipients.
8. The application as described in claim 7, characterized in that, The pharmaceutically acceptable excipients include at least one of the following: diluents, binders, wetting agents, lubricants, disintegrants, solvents, emulsifiers, cosolvents, solubilizers, preservatives, pH adjusters, osmotic pressure adjusters, surfactants, coating materials, antioxidants, antibacterial agents, or buffers.
9. The application as described in any one of claims 1-3, characterized in that, The dosage form of the drug is one or more of the following: injection, eye drops, eye wash, ophthalmic cream, ophthalmic gel, oral preparation, microcapsule preparation, or suppository.
10. The application as described in any one of claims 1-3, characterized in that, The drug is administered via intravitreal injection.