Use of non-coding circular RNA circRNA_00285 in the preparation of drugs that promote wound healing

Abstract

The present disclosure relates to the use of non-coding circular RNA circRNA_00285 in the preparation of a drug for promoting wound healing. It also relates to an expression vector in which the non-coding circular RNA circRNA_00285 is inserted, and when the expression vector is transfected into the cells of animal tissues, the inserted non-coding circular RNA circRNA_00285 can be overexpressed in the cells of animal tissues. A method for promoting wound healing, the method comprising: applying a product containing non-coding circular RNA circRNA_00285 at the wound site of an animal, and overexpressing the non-coding circular RNA circRNA_00285 in the cells of animal tissues. By overexpressing the non-coding circular RNA circRNA_00285 in the skin cells of the animal wound, the proliferation and migration of cells can be promoted, and the expression of inflammatory factors can be inhibited, promoting tissue remodeling and improving the healing speed of the wound.

Description

Technical Field

[0001] This disclosure relates to the field of biomedical technology, and more specifically, to the use of non-coding circular RNA circRNA_00285 in the preparation of medicaments that promote wound healing. Background Technology

[0002] Skin wound healing is a complex biological process involving multiple cell types, signaling pathways, and the regulation of gene expression. Recent studies have revealed the important role of circular non-coding RNAs (circRNAs) in skin wound healing, particularly in regulating cell proliferation, migration, and inflammatory responses.

[0003] Previous studies have shown that circRNAs, through their unique circular structure, can bind to miRNAs and act as "miRNA sponges" within cells to exert regulatory functions, thereby affecting the expression of target genes. This mechanism has been validated in many mammals, and some circRNAs have been found to regulate the function of key cells during skin wound healing.For example, upregulation of circRNA-myosin light chain kinase (MYLK) can promote cell proliferation and migration, and induce epithelial-mesenchymal transition (EMT) and angiogenesis in vivo and in vitro, while downregulation of circRNA-MYLK has the opposite effect (Zhong Z, Huang M, Lv M, et al. Circular RNA MYLK as a competing endogenous RNA promotes bladder cancer progression through modulating VEGFA / VEGF R2 signaling pathway [J]. Cancer Lett, 2017, 403: 305-317); silencing circRNA_010567 can upregulate miR-141, downregulate TGF-β1 expression, and inhibit the cleavage of fibrosis-related proteins (Col1, Col3, and α-smooth muscle actin) in fibroblasts. Therefore, upregulation of circRNA_010567 can promote collagen production (Zhou B, Yu JW. A novel identified circular RNA, circRNA_010567, Promotes myocardial fibrosis via suppressing miR-141 by targeting TGF-β1 [J]. Biochem Biophys Res Commun, 2017, 487(4): 769-775; Yang et al. (Yang ZG, Awan FM, Du WW, et al. The Circular RNA Interacts with STAT3, Increasing Its Nuclear Translocation and Wound Repair by Modulating Dnmt3a and miR-17 Function [J]. Mol Ther, 2017, 25(9): 2062-2074) found through animal experiments, polymerase chain reaction and cell migration experiments that the expression of circ-Amotl1 accelerated the proliferation and migration of fibroblasts. Further mechanistic studies found that ectopic circ-Amotl1 can increase the protein levels of signal transduction and transcription activator 3 and DNA methyltransferase 3A, and increase the expression of fibronectin, thereby promoting wound healing.However, existing technologies and research still face some challenges, such as how to precisely regulate circRNA expression to improve therapeutic effects, and how to effectively apply circRNA as a therapeutic strategy to different species, especially in the healing of skin wounds in horses.

[0004] Currently, most research on equine skin wound healing focuses on the application of growth factors, cytokines, and traditional small molecule drugs. Although existing treatments, including drug therapy and cell therapy, can promote wound healing to some extent, they still have the following shortcomings: (1) slow wound healing speed; (2) problems such as side effects and immune responses; and (3) limitations in efficacy. Therefore, there is an urgent need to develop a new treatment strategy, especially a treatment method based on precise regulation at the molecular level. Summary of the Invention

[0005] The purpose of this disclosure is to provide the use of a non-coding circular RNA circRNA_00285 in the preparation of a drug that promotes wound healing. Overexpression of circRNA_00285 in skin cells of an animal wound promotes cell proliferation and migration, inhibits the expression of inflammatory factors, and improves the wound healing rate.

[0006] To achieve the above objectives, the first aspect of this disclosure provides the use of a non-coding circular RNA circRNA_00285 in the preparation of a medicament that promotes wound healing.

[0007] Optionally, the nucleotide sequence of the non-coding circular RNA circRNA_00285 is shown in SEQ ID NO: 1.

[0008] Optionally, the promotion of wound healing is to promote animal wound healing; the promotion of animal wound healing is achieved by overexpressing the non-coding circular RNA circRNA_00285 in the cells of animal tissues.

[0009] Optionally, the cells of the animal tissue include animal dermal fibroblasts; The animals mentioned include: horses and rats.

[0010] Optionally, the drug contains an expression vector that overexpresses the non-coding circular RNA circRNA_00285; The expression vector is selected from at least one of pLC5-ciR, pCircRNA-DUO, pcDNA3.1-ciR, pCMV-ciR, and pCDH-CMV-ciR-EF1-Puro.

[0011] Optionally, the wound-healing promotion includes: (1) Improve wound healing speed; (2) Enhances cellular PCNA gene expression, cell migration ability, and tissue remodeling protein CD31 expression; (3) Inhibit the expression of inflammatory factors TNF-α, IL-10 and IL-6.

[0012] A second aspect of this disclosure provides an expression vector in which a non-coding circular RNA circRNA_00285 is inserted, and when the expression vector is transfected into cells of an animal tissue, the inserted non-coding circular RNA circRNA_00285 is overexpressed in the cells of the animal tissue.

[0013] Optionally, the expression vector is selected from at least one of pLC5-ciR, pCircRNA-DUO, pcDNA3.1-ciR, pCMV-ciR, and pCDH-CMV-ciR-EF1-Puro; The cells in the animal tissue include animal dermal fibroblasts; The animals mentioned include: horses and rats.

[0014] A third aspect of this disclosure provides a method for promoting wound healing, the method comprising: applying a product containing non-coding circular RNA circRNA_00285 to a wound site in an animal, and overexpressing the non-coding circular RNA circRNA_00285 in the cells of the animal tissue.

[0015] Optionally, the cells of the animal tissue include animal dermal fibroblasts; The animals mentioned include: horses and rats.

[0016] Using the above-mentioned technical solution, when the non-coding circular RNA circRNA_00285 is applied to equine skin wounds, it can regulate cell proliferation, migration, and tissue remodeling during wound healing, thus effectively promoting wound healing. It can also regulate the inflammatory response in the wound area, reducing excessive inflammation and improving healing outcomes, while avoiding the adverse effects of chronic inflammation on wound healing. This approach not only effectively accelerates the healing speed of equine skin wounds but also demonstrates high safety and specificity, laying the foundation for research on drugs that promote equine wound healing.

[0017] Other features and advantages of this disclosure will be described in detail in the following detailed description section. Attached Figure Description

[0018] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings: Figure 1 This is a map of the pLC5-ciR vector overexpressing circRNA_00285.

[0019] Figure 2 The results are from the sequencing of bacterial cultures that have constructed and overexpressed the circRNA_00285 vector.

[0020] Figure 3 This is the result of comparing the sequencing results of the vector bacterial culture with the sequence of circRNA_00285.

[0021] Figure 4 The results are from agarose gel electrophoresis of RNA extracted after transfection with the 293T transfection vector overexpressing circRNA_00285.

[0022] Figure 5 This is the quantification result of circRNA_00285 after transfection with the 293T transfection vector overexpressing circRNA_00285.

[0023] Figure 6 The circRNA_00285 adapter sequence was obtained by sequencing the 293T transfection overexpressing circRNA_00285 vector.

[0024] Figure 7 The expression of green fluorescent protein in horse dermal fibroblasts after transfection with the vector overexpressing circRNA_00285 (left image is NC, right image is circRNA_00285).

[0025] Figure 8 This is the quantitative result of cell proliferation-related genes in equine dermal fibroblasts after transfection with the vector overexpressing circRNA_00285.

[0026] Figure 9 The results of EdU cell viability assay after transfecting equine dermal fibroblasts with overexpression of circRNA_00285 vector.

[0027] Figure 10 The results of the scratch assay were obtained from horse dermal fibroblasts transfected with the vector overexpressing circRNA_00285.

[0028] Figure 11 The results of transwell experiments on horse dermal fibroblasts transfected with the vector overexpressing circRNA_00285 are as follows.

[0029] Figure 12 This describes the wound healing status of a horse trauma model after injection of a vector overexpressing circRNA_00285.

[0030] Figure 13 This is the HE staining result of wound tissue sections from a horse trauma model on day 21 of healing.

[0031] Figure 14 The results show the expression of circRNA_00285, PCNA gene, and CD31 protein in wound tissue on day 21 of equine trauma model healing.

[0032] Figure 15 This study investigated the serum inflammatory factor levels and trends during wound healing in a horse trauma model. Detailed Implementation

[0033] The specific embodiments of this disclosure will be described in detail below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit this disclosure.

[0034] The first aspect of this disclosure provides the use of a non-coding circular RNA, circRNA_00285, in the preparation of a medicament that promotes wound healing.

[0035] In this disclosure, the inventors have surprisingly discovered that the non-coding circular RNA circRNA_00285 can regulate cell proliferation, migration, and tissue remodeling during wound healing, effectively promoting the healing of animal skin wounds, especially those in horses. It can also regulate the inflammatory response in the wound area, reducing excessive inflammation and thus improving healing outcomes while avoiding the adverse effects of chronic inflammation on wound healing. Overexpression of circRNA_00285 can significantly shorten wound healing time and improve the recovery of skin structure and function after wound healing. This demonstrates the broad application potential of non-coding circular RNA circRNA_00285 in animal skin wound healing, particularly for equine skin wounds. Furthermore, the regulatory effect of non-coding circular RNA circRNA_00285 is more precise than traditional growth factors or drug treatments, and it can regulate key processes of wound healing at the molecular level, resulting in higher therapeutic efficacy and a longer duration of therapeutic effect.

[0036] In one embodiment, the nucleotide sequence of the non-coding circular RNA circRNA_00285 is shown in SEQ ID NO: 1: GAAGACTTGTGGATCAGAATCTGAACAAAATTGGGAAAGATGAAATGCTTCAGATGATTAGACATGGGGCAACACATGTCTTTGCTTCAAAGGAAAGTGAGATTACTGATGAGGATATCGATGGTATTTTGGAAA GAGGTGCAAAGAAGACTGCAGAGATGAATGAAAAGCTCTCCAAGATGGGTGAAAGCTCACTTAGAAACTTTACAATGGATACAGAATCGAGTGTTTATAACTTTGAAGGAGAAGATTATAGAGAAAAACAAAAG.

[0037] In a preferred embodiment, the wound healing promotion is to promote wound healing in animals; The promotion of animal wound healing is achieved by overexpressing the non-coding circular RNA circRNA_00285 in the cells of animal tissues. The cells of the animal tissues include animal dermal fibroblasts; the animals include horses and rats.

[0038] In one embodiment, the drug contains an expression vector that overexpresses the non-coding circular RNA circRNA_00285.

[0039] In this disclosure, overexpression of the non-coding circular RNA circRNA_00285 in animal tissue cells, particularly in horse tissue cells, can accelerate wound healing, reduce inflammatory response, and improve treatment safety.

[0040] In this disclosure, the expression vector may be selected from those conventionally used by those skilled in the art, as long as it enables overexpression of the non-coding circular RNA circRNA_00285. In one embodiment, the expression vector is selected from at least one of pLC5-ciR, pCircRNA-DUO, pcDNA3.1-ciR, pCMV-ciR, and pCDH-CMV-ciR-EF1-Puro.

[0041] In one embodiment, promoting wound healing includes: (1) Improve wound healing speed; (2) Enhances cellular PCNA gene expression, cell migration ability, and tissue remodeling protein CD31 expression; (3) Inhibit the expression of inflammatory factors TNF-α, IL-10 and IL-6.

[0042] In this disclosure, overexpression of the non-coding circular RNA circRNA_00285 in equine tissue cells significantly promotes cell proliferation and migration in the wound area, enhances the function of key cells such as fibroblasts, and thus accelerates the healing process of skin wounds. Compared with traditional treatments, it can significantly shorten wound healing time and improve healing efficiency. It can also regulate the local immune response, inhibit the expression of inflammatory factors TNF-α, IL-10, and IL-6, and reduce excessive inflammatory responses, thereby avoiding the negative impact of inflammation on wound healing. By balancing the inflammatory response and helping to maintain a stable healing environment, it helps improve treatment efficacy and reduce healing delays caused by chronic inflammation.

[0043] A second aspect of this disclosure provides an expression vector in which a non-coding circular RNA circRNA_00285 is inserted, and when the expression vector is transfected into cells of an animal tissue, the inserted non-coding circular RNA circRNA_00285 is overexpressed in the cells of the animal tissue.

[0044] In one specific embodiment, the expression vector is selected from at least one of pLC5-ciR, pCircRNA-DUO, pcDNA3.1-ciR, pCMV-ciR, and pCDH-CMV-ciR-EF1-Puro; The cells in the animal tissue include animal dermal fibroblasts; The animals mentioned include horses and rats.

[0045] A third aspect of this disclosure provides a method for promoting wound healing, the method comprising: applying a product containing non-coding circular RNA circRNA_00285 to a wound site in an animal, and overexpressing the non-coding circular RNA circRNA_00285 in the cells of the animal tissue.

[0046] In one embodiment, the cells of the animal tissue include animal dermal fibroblasts; The animals mentioned include horses and rats.

[0047] The present disclosure will be further illustrated by the following examples, but the present disclosure is not limited thereto.

[0048] All raw materials used in the embodiments can be obtained through commercial purchase.

[0049] Example 1 Cloning of the circRNA00285 gene and construction of a vector for overexpressing circRNA00285: 1. PCR amplification of the target fragment: Total RNA extraction: (1) Digest horse dermal fibroblasts cultured in 10cm dishes with a cell density of more than 90% and collect them in 1.5mL centrifuge tubes. Centrifuge to collect the cell pellet, add 1mL of Trizol, vortex rapidly for 1min, and lyse on ice for 5min. (2) Add 200 μL of chloroform and shake well; (3) Centrifuge at 12000 rpm and 4℃ for 15 min, and transfer the supernatant to a new enzyme-free tube; (4) Add an equal amount of isopropanol, mix by inverting the container, and let stand on the ice plate for 30 minutes; (5) Centrifuge at 4℃ and 12000rpm for 15min, discard the supernatant and keep the precipitate; (6) Add 1 mL of 75% ethanol to wash; centrifuge at 8000 rpm for 5 min at 4℃, and discard the supernatant; (7) Repeat step (6); (8) Place the centrifuge tubes on an ice plate and let them air dry in a fume hood for 5 minutes to allow the ethanol solution to evaporate; (9) Add 30 μL of RNasefree water according to the size of the precipitate, and store at -80℃ for later use.

[0050] Total RNA quality control: (1) Take 2 μL of total RNA, use NanoDrop 2000 to perform preliminary quantification of total RNA, and detect the absorbance values ​​of RNA at 260 nm and 280 nm to obtain the purity of RNA; (2) 1% agarose gel electrophoresis was used to detect the integrity of total RNA (150V, 20min).

[0051] cDNA synthesis: Using TAKARA's PrimeScript™ RT Master Mix, 1 μg of total RNA was reversed to form 20 μL of cDNA (synthesis system and program). (1) Removal of genomic DNA; Prepare the reaction mixture on ice according to the components in Table 1.

[0052] Table 1

[0053] Program: 42℃, 2min (or room temperature, 5min x 2); 4℃, ∞.

[0054] (2) Reverse transcription reaction: Prepare the reaction solution on ice according to the components in Table 2: Table 2

[0055] Program: 37℃, 15 min; 85℃, 5 sec; 4℃, ∞.

[0056] Target fragment amplification: PCR amplification program: 95℃, 5 min, 38 cycles (98℃, 10 s; 58℃, 30 s; 68℃, 60 s), 68℃, 5 min, 4℃ storage. The reaction system is shown in Table 3. Table 3 PCR amplification reaction system

[0057] Primer sequences: Primer-F: CTCCAAGATGGGTGAAAGCTC; Primer-R: CATGTGTTGCCCCATGTCTAATC.

[0058] 2. Recovery of PCR amplification products: Gel extraction was performed according to the instructions of the agarose gel DNA recovery kit (purchased from Magen). PCR products were stored at -20°C. Detailed steps are as follows: (1) Prepare an agarose gel of appropriate concentration and separate DNA fragments by electrophoresis. After the DNA fragments are separated, place the gel under a UV lamp, quickly cut off the gel containing the target DNA fragment, and remove as much excess gel as possible; (2) Weigh the gel block and transfer it to a 1.5 or 2.0 mL centrifuge tube. Calculate the equivalent volume of 100 mg gel block to 100 µL and add 2 times the volume of Buffer GDP. Incubate in a 55ºC water bath for 15 minutes to allow the gel block to dissolve completely. During the water bath, invert the tube 3 times to accelerate the dissolution process. (3) Collect droplets from the tube wall by brief centrifugation. Place the HiPure DNA Mini Column into a 2 mL centrifuge tube. Transfer ≤700 µL of the sol solution to the column. Centrifuge at 12000 × g for 45 seconds; (4) Discard the filtrate and place the column back into the 2 mL centrifuge tube. Add 300 µL of Buffer GDP to the column. Let stand for 1 minute. Centrifuge at 12000 × g for 45 seconds; (5) Discard the filtrate and put the column back into the 2mL centrifuge tube. Add 600µL BufferDW2 (diluted with anhydrous ethanol); (6) Discard the filtrate and place the column back into the 2mL centrifuge tube. Centrifuge at 12000×g for 2 minutes. Centrifuge at 12000×g for 60 seconds; (7) Place the column into a 1.5 mL centrifuge tube and add 15-30 µL of Elution Buffer to the center of the column membrane. Let stand for 2 minutes. Centrifuge at 12000×g for 1 minute. Discard the column and store the DNA at -20℃.

[0059] 3. Double digestion of empty vector: Double digestion with two restriction enzymes (Fast Digest restriction enzyme, Thermo SICENTIFIC) was performed on the empty vector (pLC5-ciR, purchased from Gisele Biotechnology). The reaction system is shown in Table 4, and the mixture was incubated at 37°C for 1 h. Then, a 1.5% agarose gel was prepared for electrophoresis, and the target band was recovered.

[0060] Table 4. Double enzyme digestion reaction system

[0061] 4. In-Fusion connection: Prepare the ligation reaction solution according to the instructions of the Hieff Clone® Plus One Step Cloning Kit (Shanghai Yisheng), maintain at 50℃ for 20 min, and then perform conversion or store at -20℃. The reaction system is shown in Table 5. The ligation product is shown in... Figure 1 As shown.

[0062] Table 5 Connection Reaction System

[0063] 5. Transformed competent cells (Trans1 T1, purchased from Beijing TransGen): (1) Remove competent cells from the -80℃ freezer and place them on ice to thaw; (2) Under aseptic conditions, take 50 μL of competent cells and place them in a sterilized 1.5 mL centrifuge tube; (3) Add 10 μL of ligation product and place on ice for 30 min; (4) Place at 42℃ for 30 seconds (heat shock), do not shake the centrifuge tube; (5) Quickly transfer the centrifuge tubes to ice and place them for 3 minutes; (6) Add 200 μL of LB liquid medium, mix well by pipetting, spread on LA agar plates, and incubate upside down at 37°C for 16 h.

[0064] 6. Identification: PCR identification of positive colonies: A single colony was picked and inoculated into LA culture medium, and cultured at 37°C and 220 rpm for 4 h. 1 μL of the bacterial culture was then used as a template for PCR amplification. A 1.5% agarose gel was then prepared, and 5 μL of the PCR product was collected for electrophoresis detection.

[0065] Positive bacterial culture sequencing identification: Positive bacterial cultures detected by bacterial culture PCR are sequenced, and the results are analyzed using BLAST sequence comparison to determine whether they represent the target gene. Vector sequencing primers: pC5-seqF:TGTGAATTTGACCCTTAAGA; The sequencing results showed normal peak patterns with no extraneous peaks or overlapping bands. Figure 2 Sequence comparison match ( Figure 3 The gene was identified as circRNA_00285, indicating that circRNA_00285 was successfully inserted into pLC5-ciR, and the overexpression vector was successfully constructed.

[0066] Example 2 Expression vector verification of expression: 1. Endotoxic plasmid extraction: Low endotoxin plasmid extraction was performed according to the instructions of the low endotoxin plasmid mini-extraction kit (purchased from Magen), and the plasmids were stored at -20℃. The experimental steps are as follows: (1) Inoculate the bacterial strain containing plasmid into a culture tube containing 1 mL of LB / antibiotic culture medium and culture in a shaker at 37°C for 16 hours to amplify the plasmid; (2) Centrifuge at 10000×g for 1 minute and collect 5mL of bacterial cells; (3) Discard the culture medium and gently tap the bacteria on absorbent paper to remove any remaining liquid. Add 250µL Buffer E1 / RNaseA and vortex at high speed to fully resuspend the bacteria; (4) Add 250µL Buffer E2 and mix by inverting 8 times; (5) Add 250µL Buffer E3 and immediately invert 10 times; (6) Centrifuge at 13000×g for 10 minutes at room temperature; (7) Carefully transfer the supernatant to a new 2mL centrifuge tube. Add 1 / 3 volume of Buffer EP4 to the supernatant, invert and mix 8 times, and let stand at room temperature for 2 minutes; (8) Place the HiPure EF Mini Column into the collection tube. Transfer 750 µL of the mixture into the column. Centrifuge at 10000 × g for 60 seconds; (9) Discard the filtrate and put the column back into the collection tube. Continue to transfer the mixture into the column and centrifuge at 10000×g for 60 seconds. Repeat this step until all the mixture has been transferred into the column and centrifuged and filtered; (10) Discard the filtrate and put the column back into the collection tube. Add 650µL of Buffer E5 to the column. Centrifuge at 10000×g for 60 seconds; (11) Discard the filtrate and put the column back into the collection tube. Add 650µL of Buffer PW2 (diluted with anhydrous ethanol) to the column. Let stand for 2 minutes, then centrifuge at 10000×g for 60 seconds; (12) Discard the filtrate and put the column back into the collection tube. Add 650µL of Buffer PW2 (diluted with anhydrous ethanol) to the column. Centrifuge at 10000×g for 60 seconds; (13) Discard the filtrate and put the column back into the collection tube. Centrifuge at 10000×g for 2 minutes; (14) Place the column into a sterile 1.5 mL centrifuge tube. Add 100 µL of Buffer TE to the center of the membrane in the column. Let stand for 2 minutes, then centrifuge at 10000 × g for 1 minute to elute the DNA; (15) Discard the column and store the plasmid at -20℃.

[0067] 2. Cell transfection: 293T cells were transfected using Lipofectamine 2000 (purchased from Invitrogen) according to the manufacturer's instructions, into three groups: circRNA_00285, NC (pLC5-ciR), and a control group. Cells were collected 48 hours later for qPCR detection. The specific steps are as follows: (1) The day before transfection, 5×10 5 One cell line was seeded in a 6-well plate with 2 mL of complete culture medium. The cells were confluent at 70-90% before transfection. (2) Add 2 μg of plasmid to 100 μL of serum-free culture medium and mix gently; (3) Mix lipofectamine reagent, dilute 5 μL of lipofectamine reagent with 100 μL of serum-free culture medium, mix gently, and let stand at room temperature for 5 min; (4) Mix the diluted plasmid and lipofectamine reagent, mix gently, and let stand at room temperature for 20 min to form a plasmid-lipofectamine complex; (5) Add 200 μL of plasmid-lipofectamine complex to the cell well containing 800 μL of serum-free medium and gently shake the cell culture plate back and forth. (6) After culturing the cells in a 37°C incubator containing 5% CO2 for 6 hours, remove the transfection medium and replace it with complete medium; (7) 48 hours after transfection, the transfection efficiency was observed under a fluorescence microscope.

[0068] 3. qPCR verification of expression efficiency after transfection: (1) RNA extraction: ① After adding Trizol to the cells, incubate them at room temperature for 5 minutes to allow them to fully lyse; ② Add chloroform at a ratio of 200 μL chloroform / mL Trizol, shake vigorously for 15 seconds, and let stand at room temperature for 5 minutes; ③ Centrifuge at 4℃ and 12000×g for 15 min; ④ Remove the upper aqueous phase and transfer it to another centrifuge tube; ⑤ Add isopropanol at a ratio of 0.5 mL isopropanol / mL Trizol, mix well, and let stand at room temperature for 10 min; ⑥ Centrifuge at 4℃ and 12000×g for 10 min, then discard the supernatant; ⑦ Add 75% ethanol at a ratio of 1 mL 75% ethanol / mL Trizol, gently shake the centrifuge tube, and suspend the precipitate; ⑧ Centrifuge at 4℃ and 7500×g for 5 minutes, and discard the supernatant as much as possible; ⑨ Air dry at room temperature for 10 minutes, then add 20µL of DEPC water to dissolve the precipitate.

[0069] (2) RNA quality and integrity testing: Quantitative RNA measurement by measuring OD value: ① Open the sampling arm, use a pipette to draw 1µL of H2O and add it to the detection platform, then zero the instrument; ② Lower the sampling arm, use a pipette to draw 1µL of sample and add it to the detection platform, then press the "Measure" button; ③ Record the A260 / 280 ratio and RNA concentration; ④ Wipe the samples off the upper and lower testing platforms with clean absorbent paper.

[0070] The results are shown in the table below: Table 6. RNA Extraction Quality

[0071] (3) Agarose gel electrophoresis: ① Prepare a 1% agarose gel using 0.5×TAE electrophoresis buffer (Agarose purchased from Biowest) and melt it in a microwave oven; ② Add Nucleic Acid Stain (purchased from Beijing Dingguo Changsheng) at a ratio of 1:20000, and gently shake to avoid generating bubbles; ③ When the gel has cooled to a temperature that is not too hot to handle, pour it into the container and wait for the agarose gel to solidify completely before loading it onto the container for electrophoresis. ④ After electrophoresis, observe under ultraviolet light and take photos for storage.

[0072] The results are as follows Figure 4 The bands are clear and bright, mainly consisting of three bands, indicating good RNA quality.

[0073] 4. Reverse transcription: Prepare the first-strand cDNA synthesis reaction solution system according to Table 7 of the Geneseed® II First Strand cDNA Synthesis Kit (purchased from Geneseed): Table 7 First-strand cDNA Synthesis Reaction System

[0074] Perform the first-strand cDNA synthesis reaction under the following conditions: Table 8. First-strand cDNA synthesis reaction procedure

[0075] 5. qPCR experiment: Prepare the qPCR reaction system according to Table 9 of the Geneseed® qPCR SYBR® Green Master Mix (purchased from Geneseed) instructions: Table 9 qPCR reaction system

[0076] Set the qPCR reaction program according to Table 10: Table 10 qPCR reaction procedure

[0077] 6. qPCR data processing: According to 2- △△C t The formula is used to calculate the expression level of the target gene for analysis: Let CtA1 be the Ct value of the target gene in sample 1, and CtB1 be the Ct value of the internal reference gene in sample 1; CtA2 be the Ct value of the target gene in sample 2, and CtB2 be the Ct value of the internal reference gene in sample 2. Then, the ratio of the target gene expression levels in samples 1 and 2 can be roughly calculated as (2- △△Ct法 ): △△Ct =(CtA2-CtB2)-(CtA1-CtB1)=X; The expression level of the target gene in sample 2 is 2 times that in sample 1. -X The results are shown in Table 11 and... Figure 5 .

[0078] Table 11 Gene Expression Analysis

[0079] 7. Sequencing of qPCR products: The qPCR products were recovered and Sanger sequencing was performed to verify the circular adapter sites. The sequencing primer sequences are as follows: circRNA_00285-F2: GGTGCAAAGAAGACTGCAGAG; circRNA_00285-R1: CATGTGTTGCCCCATGTCTAATC.

[0080] The results are as follows Figure 6 Compared to the control group, the overexpression fold of the 293T-circRNA_00285 group was 11452. The PCR product sequencing peaks were normal, with no extraneous peaks or overlapping bands, and the sequence matched the reference sequence at the circularization site. These results indicate that circRNA_00285 can successfully overexpress the target circRNA in eukaryotic cells.

[0081] Example 3 Validating the effect of overexpression of circRNA_00285 on equine dermal fibroblasts: 1. Effects on the proliferation capacity of equine dermal fibroblasts: (1) RT-qPCR: Following the same steps as before, horse dermal fibroblasts were transfected into three groups: circRNA_00285, NC (pLC5-ciR), and a control group. After 48 hours, transfection efficiency was observed using a fluorescence inverted microscope. Cells were collected for RT-qPCR to verify expression effects and to detect the proliferation marker genes PCNA and Ki67. Results are as follows: Figure 7 , 8 The expression level of green fluorescent protein was high, and the transfection efficiency was over 60%. After 48 hours of transfection, the expression level of circRNA_00285 was significantly upregulated. Moreover, after overexpression of circRNA_00285, the cell proliferation-related genes PCNA and Ki67 were significantly higher than those in the control group and NC group, indicating that overexpression of circRNA_00285 can significantly enhance the proliferation capacity of horse dermal fibroblasts.

[0082] (2) EdU experiment: Follow the steps outlined in the EdU-555 reagent kit instructions (purchased from Beyotime): ①Inoculate an appropriate number of the three groups of horse dermal fibroblasts that were successfully transfected above into a 6-well plate and culture them overnight in a cell culture incubator until the cells return to normal. ② Dilute EdU (10mM) with complete culture medium at a ratio of 1:500 to obtain 2×EdU working solution (20μM), and preheat the working solution in a water bath at 37℃; ③ Add 1 mL of the prepared 2×EdU working solution to each well of the 6-well plate, dilute the EdU concentration in each well to 1×, and incubate in a 37℃ cell culture incubator for 2 h; ④ Discard the culture medium, add 1 mL of cell tissue fixative to each well, and fix at room temperature for 30 min; ⑤ Discard the fixative, wash the cells 3 times with PBS (5 min each time); discard the PBS, add 1 mL of immunostaining permeabilization buffer to each well, and incubate at room temperature for 15 min; ⑥ Discard the permeabilization solution, wash the cells 3 times with PBS (5 min / time), and discard the PBS solution; ⑦ Prepare EdU Click reaction solution according to Table 12. Add 500µL to each well, gently shake the plate on a shaker to completely cover the sample, and incubate at room temperature in the dark for 30 minutes. Table 12 EdU Click Reaction Solution System

[0083] ⑧ Discard EdU Click reaction solution, wash cells 3 times with PBS (5 min / time), and discard PBS solution; ⑨ Dilute 1000×Hoechst solution with PBS solution at a ratio of 1:1000 to prepare 1×Hoechst solution. Add 1 mL of 1×Hoechst solution to each well and incubate at room temperature in the dark for 10 min. ⑩ Discard the Hoechst solution and wash the cells three times with PBS (5 min each time); under a fluorescence microscope, detect the 555-Azide fluorescence signal using the red excitation channel and observe the Hoechst-labeled nuclear fluorescence using the blue excitation channel.

[0084] Experimental results are as follows Figure 9 The proportion of EdU-positive cells in the circRNA_00285 overexpression group was significantly higher than that in the NC group and the control group, indicating that circRNA_00285 overexpression can significantly enhance the viability of dermal fibroblasts and promote cell proliferation.

[0085] 2. Effects on the migration ability of equine dermal fibroblasts: (1) Cell scratch test: A suitable amount of dermal fibroblasts were seeded into 6-well plates. When the cell density reached over 70%, horse dermal fibroblasts were transfected into three groups: circRNA_00285, NC (pLC5-ciR), and a control group. When the cell density reached 95%, vertical scratches were created on the bottom of the wells using a sterile yellow pipette tip (200µL) along a ruler. Cells were washed three times with PBS to remove floating cells. Low-serum culture medium containing 2% FBS was added, and cell migration images at the same location were photographed under a microscope at 0h, 24h, and 48h after scratch treatment. The experimental results are as follows: Figure 10 The scratch width of the group overexpressing circRNA_00285 was significantly smaller than that of the NC group and the control group, indicating that overexpression of circRNA_00285 can significantly enhance the migration ability of dermal fibroblasts.

[0086] (2) Transwell migration experiment: The 24-well cell migration plates and chambers used in the experiment were purchased from Corning Incorporated. The specific steps are as follows: Dermal fibroblasts in good growth condition after successful transfection were collected using trypsin digestion from the three groups mentioned above. Cell counts were performed, and cells were resuspended in 200 µL of serum-free medium at a rate of 4 × 10⁴ cells / day. 4 One cell was seeded into the upper chamber; Add 700 µL of culture medium containing 20% ​​FBS to the lower chamber; Incubate in a cell culture incubator for 24 hours; Aspirate all culture medium from the upper chamber and wash twice with PBS; The upper chamber was placed in a 24-well plate containing 600 µL of cell fixation medium and fixed for 20 min, then washed twice with PBS. Stain with crystal violet solution for 30 minutes, then wash twice with PBS; Gently wipe away any unmigrated cells in the upper chamber with a cotton swab; Five fields of view were randomly selected and photographed using a 10x scope.

[0087] Experimental results are as follows Figure 11 The number of cells that migrated from the upper chamber to the lower chamber in the circRNA_00285 overexpression group was significantly greater than that in the NC group and the control group, indicating that circRNA_00285 overexpression can significantly enhance the migration ability of dermal fibroblasts.

[0088] Example 4 Step 1: Create a horse skin wound model: To verify the role of circRNA_00285 in skin wound healing, six healthy adult warmblood horses (approximately 550 kg in weight) around 5 years of age were randomly selected to create a standard skin wound model. Two identical circular wounds (approximately 7 mm in diameter) were made on the back of each horse, and they were randomly assigned to two groups: an experimental group (overexpressing circRNA_00285) and a control group (empty vector group). The corresponding vector was injected into the wound site; the experimental group received the overexpressing circRNA_00285 vector, while the control group received the empty vector. Injections were administered weekly, starting from the day of model creation. Step 2: Assess wound healing progress: During the wound healing process, changes in the healing area and thickness were observed and measured on days 0, 3, 7, 14, and 21. The healing progress was assessed at each observation and measurement, and observation continued until complete wound healing (approximately 3 weeks). Healing progress was quantified by photographs. At the end of the experimental period, tissue samples were collected from the healed wound for morphological and pathological analysis; the results are as follows: Figure 12, 13 In morphological observation, the wound healing speed of the experimental group was significantly faster than that of the control group. In HE staining of skin pathology sections, the tissue morphology and structure recovery of the experimental group was significantly better than that of the control group. Therefore, overexpression of circRNA_00285 can significantly improve the healing speed and healing effect of skin wounds in horses.

[0089] Step 3: Assessment of cell proliferation and tissue remodeling: To verify the expression effect of the overexpression vector of circRNA_00285 and the role of overexpression of circRNA_00285 in promoting cell proliferation and migration in skin wound tissue, tissue around the wound was harvested on day 21 of wound healing. qPCR and Western blot were used to detect circRNA_00285, the cell proliferation marker PCNA, and tissue remodeling proteins (such as CD31), evaluating the expression effect of the overexpression vector of circRNA_00285 and its promoting effect on cell proliferation and tissue remodeling. Results are as follows: Figure 14 The expression level of circRNA_00285 in the experimental group was significantly higher than that in the control group, indicating that the expression effect of injecting the overexpression vector of circRNA_00285 was good. In addition, the expression levels of the proliferation marker gene PCNA and the tissue remodeling protein CD31 in the experimental group were significantly higher than those in the control group, indicating that overexpression of circRNA_00285 can significantly enhance the expression of proliferation-related genes and tissue remodeling proteins in wound tissue, thereby promoting wound healing.

[0090] Step 4: Assessment of Inflammatory Response Blood samples were collected from horses on days 0, 3, 7, 14, and 21 of wound healing. Serum inflammatory factor levels, reflecting the expression of inflammatory factors around the wound (such as TNF-α, IL-10, and IL-6), were measured using an ELISA kit (Jianglai Biotechnology). Differences between the experimental and control groups were compared to evaluate the regulatory role of circRNA_00285 in the inflammatory response during wound healing. Results are as follows: Figure 15 The levels of TNF-α, IL-10, and IL-6 in the serum of the experimental group were significantly lower than those in the control group, indicating that overexpression of circRNA_00285 can effectively inhibit the expression of inflammatory factors, thereby suppressing wound inflammation and promoting wound healing.

[0091] Comparison of healing speed: Measurements of wound area and thickness revealed that the experimental group healed significantly faster than the control group after circRNA_00285 injection. By day 7, the wound area in the experimental group had decreased by more than 70%, while the control group's had decreased by only 45%. By day 21, the wounds in the experimental group were almost completely healed (over 90%), while the control group still had noticeable unhealed areas.

[0092] Cell proliferation and tissue remodeling: qPCR and Western blot results showed that PCNA expression was significantly increased in the experimental group, indicating that circRNA_00285 promoted cell proliferation. Furthermore, CD31 protein expression was significantly higher in the experimental group than in the control group, suggesting that circRNA_00285 promoted tissue remodeling in horse wounds.

[0093] Regulation of the inflammatory response: ELISA results showed that the levels of inflammatory factors such as TNF-α, IL-10, and IL-6 in the wound area of ​​the experimental group were significantly lower than those of the control group, indicating that circRNA_00285 effectively regulated the body's inflammatory response while promoting wound healing, thus avoiding excessive inflammatory response that could delay wound healing.

[0094] The preferred embodiments of this disclosure have been described in detail above with reference to the accompanying drawings. However, this disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this disclosure, various simple modifications can be made to the technical solutions of this disclosure, and these simple modifications all fall within the protection scope of this disclosure.

[0095] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.

[0096] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.

Claims

1. Use of non-coding circular RNA circRNA_00285 in the preparation of drugs that promote wound healing.

2. The use according to claim 1, wherein, The nucleotide sequence of the non-coding circular RNA circRNA_00285 is shown in SEQ ID NO:

1.

3. The use according to claim 2, wherein, The term "promoting wound healing" refers to promoting wound healing in animals. The promotion of animal wound healing is achieved by overexpressing the non-coding circular RNA circRNA_00285 in the cells of animal tissues.

4. The use according to claim 3, wherein, The cells in the animal tissue include animal dermal fibroblasts; The animals mentioned include: horses and rats.

5. The use according to claim 3, wherein, The drug contains an expression vector that overexpresses the non-coding circular RNA circRNA_00285; The expression vector is selected from at least one of pLC5-ciR, pCircRNA-DUO, pcDNA3.1-ciR, pCMV-ciR, and pCDH-CMV-ciR-EF1-Puro.

6. The use according to claim 3, wherein, The promotion of wound healing includes: (1) Improve wound healing speed; (2) Enhances cellular PCNA gene expression, cell migration ability, and tissue remodeling protein CD31 expression; (3) Inhibit the expression of inflammatory factors TNF-α, IL-10 and IL-6.

7. An expression carrier, characterized in that, The expression vector contains an inserted non-coding circular RNA circRNA_00285, and when the expression vector is transfected into animal tissue cells, the inserted non-coding circular RNA circRNA_00285 is overexpressed in the animal tissue cells.

8. The expression vector according to claim 7, wherein, The expression vector is selected from at least one of pLC5-ciR, pCircRNA-DUO, pcDNA3.1-ciR, pCMV-ciR, and pCDH-CMV-ciR-EF1-Puro; The cells in the animal tissue include animal dermal fibroblasts; The animals mentioned include: horses and rats.

9. A method for promoting wound healing, characterized in that, The method includes: applying a product containing non-coding circular RNA circRNA_00285 to the wound site of an animal, and overexpressing non-coding circular RNA circRNA_00285 in the cells of the animal tissue.

10. The method according to claim 9, wherein, The cells of the animal tissue include animal dermal fibroblasts; The animals mentioned include: horses and rats.

Images