CD276-specific binding polypeptides and uses thereof

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a group of polypeptides capable of specifically combining with CD276 protein and application thereof. The amino acid sequence of the polypeptide is shown in any one of SEQ ID NO:1 to SEQ ID NO:9. The application constructs a heptapeptide library and a dodecapeptide library through phage display technology to perform high-throughput screening, and finally obtains polypeptides with high affinity to CD276 through multiple rounds of strict panning and enrichment. The polypeptides can be used for immune detection of the expression level of CD276 protein in biological samples, auxiliary tumor diagnosis and staging, construction of a drug delivery system targeting CD276, and development of an antagonist or agonist of CD276, thereby providing a new molecular tool for accurate diagnosis and treatment of related diseases.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a polypeptide capable of specifically binding to the CD276 protein, a nucleic acid molecule encoding the polypeptide, a vector and host cell containing the nucleic acid molecule, a screening method for the polypeptide, and its application in detecting the expression level of the CD276 protein in biological samples and preparing drugs targeting the CD276 protein. Background Technology

[0002] In recent years, immunotherapy has become a significant breakthrough in cancer treatment, its core being the activation of the immune system to recognize and kill cancer cells. Immune checkpoints play a dual regulatory role in this process: maintaining self-immune tolerance and participating in the immune response against tumors. Inhibition of these molecules has significantly improved the clinical efficacy of various cancers. B7-H3 (CD276) belongs to the B7 immunomodulatory family and is overexpressed on the surface of most cancer cells and some immune cells in the tumor microenvironment, inhibiting the function of cytotoxic T cells and natural killer cells. Further research has shown that CD276 also promotes tumor proliferation and metastasis and is specifically highly expressed in tumor neovascular endothelium. In most solid tumors and their vascular systems, the expression level of CD276 is significantly higher than in normal tissues, making it a potential target for targeted therapy. Currently, CD276-based antibody-drug conjugates and CAR-T therapy have progressed to phase III clinical trials. In addition to the field of oncology, recent research suggests that CD276 also plays a role in the metabolic regulation of adipocyte precursor cells, potentially influencing the development of obesity.

[0003] With a deeper understanding of the role of CD276 in tumors, various targeted therapeutic strategies targeting this molecule have emerged. Current research focuses on monoclonal antibodies and their mediated cytotoxic effects, CAR-T cell therapy, and antibody-drug conjugation technology. Targeted radioimmunotherapy offers another effective approach, delivering therapeutic radionuclides to tumor lesions via specifically bound carriers. This achieves precise local irradiation while minimizing damage to normal tissues. The overexpression of CD276 in tumors and its low expression in normal tissues make it an ideal target for radionuclide targeted therapy, helping to improve efficacy while controlling toxic side effects.

[0004] CD276 is considered an ideal therapeutic target due to its widespread expression in tumor cells, tumor stem cells, tumor vascular endothelium, and stroma. These expression characteristics are closely related to tumor progression, metastasis, and treatment resistance. Studies have found that the expression of CD276 often exhibits a complementary distribution with that of immune checkpoint molecules such as PD-1 / PD-L1, providing a new approach for combined immunotherapy. The significant expression differences create a broad safety window for targeted therapy, making the selective elimination of tumor cells possible. Preclinical experiments have confirmed that various antibody drugs targeting B7-H3 possess definite anti-tumor activity. Currently, multiple clinical trials are actively underway to evaluate the efficacy and safety of different B7-H3 targeting strategies. Summary of the Invention

[0005] The present invention aims to provide a novel polypeptide capable of specifically binding to CD276 and its related applications.

[0006] This invention provides a polypeptide capable of specifically binding to B7-H3 (CD276). The polypeptide is selected from any of the following: (a) A polypeptide comprising the amino acid sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 9; (b) A polypeptide obtained by modifying the amino acid sequence described in (a) above (e.g., chemical modification, post-translational modification simulation, etc.) and retaining the ability to specifically bind to CD276, wherein the affinity constant (KD value) of the polypeptide to CD276 is less than 6 × 10⁻ 4 M; (c) A polypeptide obtained by conserved or non-conserved substitution, deletion, or addition of one or more (e.g., 1-5, preferably 1 or 2) amino acids based on the amino acid sequence described in (a) or (b) above, which retains the ability to specifically bind to CD276. The KD value of this polypeptide for binding to CD276 is also less than 6 × 10⁻ 4 M; (d) A polypeptide having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) sequence identity with the amino acid sequence described in (a), (b) or (c) above, and retaining the ability to specifically bind to CD276, wherein the KD value of the polypeptide binding to CD276 is less than 6 × 10⁻ 4 M.

[0007] In a preferred embodiment, the polypeptide has an amino acid sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 9.

[0008] The amino acid sequence shown in SEQ ID NO: 1 is as follows: HDHFTQF; The amino acid sequence shown in SEQ ID NO: 2 is as follows: NIGKTWR; The amino acid sequence shown in SEQ ID NO: 3 is as follows: GYFSYGSLNSYT; The amino acid sequence shown in SEQ ID NO: 4 is as follows: GHYEFGKIGQVY; The amino acid sequence shown in SEQ ID NO: 5 is as follows: TMRFGHLQSFPT; The amino acid sequence shown in SEQ ID NO: 6 is as follows: DENELRAMLTLN; The amino acid sequence shown in SEQ ID NO: 7 is as follows: NTIKAGEIGSGL; The amino acid sequence shown in SEQ ID NO: 8 is as follows: AISNTRSTIASE; The amino acid sequence shown in SEQ ID NO: 9 is as follows: DRVVKYGTLGDY.

[0009] The present invention further provides a nucleic acid molecule that encodes the polypeptide described in any of the above embodiments.

[0010] The nucleic acid molecule is any one of the following: (a) includes the nucleotide sequence shown in any one of SEQ ID NO: 10 to SEQ ID NO: 18; (b) A nucleotide sequence complementary to the nucleotide sequence described in (a) above; (c) A sequence that encodes a polypeptide with the same nucleotide sequence as described in (a) or (b) above, but with a different nucleotide sequence due to genetic code degeneracy; (d) A nucleotide sequence that encodes a polypeptide with the same or similar function, obtained by substitution, deletion or addition of one or more nucleotides based on the nucleotide sequence described in (a), (b) or (c) above; (e) A nucleotide sequence that has at least 90% sequence identity with the nucleotide sequence described in (a), (b), (c) or (d) above and encodes a polypeptide with the same or similar function.

[0011] In a preferred embodiment, the nucleic acid molecule has a nucleotide sequence shown in any one of SEQ ID NO: 10 to SEQ ID NO: 18.

[0012] The nucleotide sequence of SEQ ID NO: 10 encodes the amino acid sequence of SEQ ID NO: 1; The nucleotide sequence of SEQ ID NO: 11 encodes the amino acid sequence of SEQ ID NO: 2; The nucleotide sequence of SEQ ID NO: 12 encodes the amino acid sequence of SEQ ID NO: 3; The nucleotide sequence of SEQ ID NO: 13 encodes the amino acid sequence of SEQ ID NO: 4; The nucleotide sequence of SEQ ID NO: 14 encodes the amino acid sequence of SEQ ID NO: 5; The nucleotide sequence of SEQ ID NO: 15 encodes the amino acid sequence of SEQ ID NO: 6; The nucleotide sequence of SEQ ID NO: 16 encodes the amino acid sequence of SEQ ID NO: 7; The nucleotide sequence of SEQ ID NO: 17 encodes the amino acid sequence of SEQ ID NO: 8; The nucleotide sequence of SEQ ID NO: 18 encodes the amino acid sequence of SEQ ID NO: 9.

[0013] The nucleotide sequence shown in SEQ ID NO: 10 is as follows: AAA CTG AGT AAA ATG ATC ATG; The nucleotide sequence shown in SEQ ID NO: 11 is as follows: CCT CCA AGT CTT ACC AAT ATT; The nucleotide sequence shown in SEQ ID NO: 12 is as follows: AGT ATA ACT ATT CAG AGA CCC ATACGA AAA ATA ACC; The nucleotide sequence shown in SEQ ID NO: 13 is as follows: ATA CAC CTG ACC AAT CTT CCC AAACTC ATA ATG CCC; The nucleotide sequence shown in SEQ ID NO: 14 is as follows: AGT AGG AAA AGA CTG CAA ATG ACCAAA CCG CAT AGT; The nucleotide sequence shown in SEQ ID NO: 15 is as follows: ATT AAG AGT CAG CAT AGC ACG CAGCTC ATT CTC ATC; The nucleotide sequence shown in SEQ ID NO: 16 is as follows: AAG ACC AGA CCC AAT CTC ACC CGCCTT AAT CGT ATT; The nucleotide sequence shown in SEQ ID NO: 17 is as follows: CTC AGA CGC AAT AGT AGA ACG CGTATT ACT AAT AGC; The nucleotide sequence shown in SEQ ID NO: 18 is as follows: ATA ATC ACC CAG AGT CCC ATA CTTCAC CAC ACG ATC.

[0014] Those skilled in the art will understand that the core functional characteristic of the above-mentioned modified, substituted, deleted, added, or highly sequence-identical variants is that the polypeptide encoded by the amino acid sequence or nucleotide sequence maintains its specific binding ability to CD276, and the binding affinity meets the above-mentioned KD value standard (KD value less than 6 × 10⁻⁶). -4 M).

[0015] The present invention also provides a vector comprising the nucleic acid molecule described in any of the above embodiments. The vector may be a cloning vector (such as a plasmid, granule, bacteriophage, etc.) or an expression vector (such as a prokaryotic expression vector, a eukaryotic expression vector, a viral vector, etc.).

[0016] Furthermore, the present invention provides a host cell comprising the nucleic acid molecules described in any of the above embodiments or a carrier comprising the nucleic acid molecules. The host cell may be a prokaryotic cell (such as Escherichia coli), a eukaryotic cell (such as yeast cells, insect cells), or a mammalian cell (such as CHO cells, HEK293 cells).

[0017] This invention provides a method for screening peptides that specifically bind to CD276, the method comprising the following steps: Using the CD276 human gene overexpression cell line, multiple rounds of panning were performed on the phage-displayed heptapeptide and dodecapeptide libraries; Through the aforementioned multiple rounds of screening, peptide sequences that specifically bind to CD276 are enriched; The amino acid sequences of the enriched polypeptides were isolated and identified.

[0018] This method can efficiently and specifically screen for peptide candidates that bind to CD276 with high affinity.

[0019] The polypeptides provided by this invention have broad application prospects in the biomedical field, including but not limited to: (1) Application in detecting the expression level of CD276 protein in biological samples (such as tissue sections, cell suspensions, serum, etc.). For example, the polypeptide can be used as a detection probe to qualitatively or quantitatively detect CD276 by methods such as immunohistochemistry, flow cytometry, and ELISA.

[0020] (2) Application in the preparation of pharmaceutical agents targeting the CD276 protein. The pharmaceutical agent may be a diagnostic agent (e.g., an imaging agent), a therapeutic agent (e.g., an antagonist, a drug-conjugated carrier), or a combined therapeutic and diagnostic agent. For example, the polypeptide may be conjugated with a radionuclide, fluorescent dye, toxin, or cytotoxic drug for the diagnosis or treatment of tumors.

[0021] In summary, this invention provides a series of novel, CD276-specific peptides, their coding sequences, preparation methods, and applications. These peptides demonstrate significant application value in CD276-related immunoassays.

[0022] CD276, as an important immune checkpoint molecule and tumor-associated antigen, is highly expressed in various human malignancies and participates in regulating tumor cell proliferation, metastasis, drug resistance, and immune escape. Its expression level is significantly correlated with poor patient prognosis. Based on this biological characteristic, the peptides of this invention can be used to prepare various biomedical tools, including specific probes, imaging tracers, and in vitro diagnostic reagents. Specifically, they can be applied to PET / SPECT molecular imaging, intraoperative near-infrared fluorescence navigation, and liquid biopsy enrichment of circulating tumor cells or exosomes. By achieving quantitative detection and spatial localization of CD276 expression levels, this invention provides a new means for companion diagnosis and monitoring of treatment processes in CD276-related tumors.

[0023] The peptides described in this invention have significant application potential in precision oncology and immunotherapy. These peptides can not only act as antagonists of CD276, blocking its binding to its corresponding receptor and thereby activating immune effector cells such as T cells and enhancing anti-tumor immune responses, but also serve as components of tumor vaccines, inducing specific immune responses and improving the immune system's ability to recognize tumor cells. Furthermore, these peptides can be used in combination with other immunotherapies to achieve synergistic effects.

[0024] Beyond clinical applications, these peptides also provide important tools for studying the functional mechanisms of CD276 in the tumor microenvironment. Targeted drug delivery systems built upon these peptides can achieve precise drug delivery, improving efficacy while reducing systemic toxicity, making them valuable in novel diagnostic technologies, molecular imaging, and gene therapy. Related research will further deepen our understanding of tumor biology and immune regulation mechanisms, and provide a basis for innovative cancer treatment strategies. Future development may focus on developing peptide drug conjugates, constructing integrated diagnostic and therapeutic platforms, utilizing artificial intelligence to optimize peptide structures, and exploring their cross-indication applications in other diseases such as autoimmune diseases. Attached Figure Description

[0025] Figure 1To verify the overexpression of CD276 protein on the surface of CHO-K1 cell membranes; Figure 2 The data are the interaction fitting data between CD276 and SW-1; Figure 3 The data are the interaction fitting data between CD276 and SW-2; Figure 4 The data are the interaction fitting data between CD276 and SW-3; Figure 5 The data are the interaction fitting data between CD276 and SW-4; Figure 6 The data are the interaction fitting data between CD276 and SW-6; Figure 7 The data are the interaction fitting data between CD276 and SW-8; Figure 8 The data are the interaction fitting data between CD276 and SW-10; Figure 9 The data are the interaction fitting data between CD276 and SW-11; Figure 10 This is the interaction fitting data between CD276 and SW-12. Detailed Implementation

[0026] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0027] Example 1: In this embodiment, nine peptides that specifically bind to CD276 were obtained through screening of heptapeptide and dodecapeptide libraries. The specific method is as follows.

[0028] 1. Construction of CD276-overexpressing CHO-K1 cell line (1) Remove the cells from the incubator and observe the density. When the density is about 90%, discard the supernatant, add 2 mL of PBS to wash once, add 1 mL of trypsin and put it in the incubator to digest for about 2 min.

[0029] (2) Add 1640 medium containing 10% FBS to stop digestion. Transfer the cells from the culture dish to a 15-mL centrifuge tube, centrifuge at 2000 rpm for 2 min, discard the supernatant, resuspend the cells in 1 mL of medium and count them. Seed 100,000 cells in each well of a six-well plate, shake well and place in an incubator.

[0030] (3) Viral infection: After the cells have adhered and grown stably for 12 h, viral infection was performed. First, 2 mL of 1640 medium containing polybrene was prepared, i.e., 3.2 μL of polybrene (CO351-10 mg / mL) was added to 2 mL of 1640 medium and added to each well of a six-well plate, 1 mL per well. Then, different virus solutions, namely PLVX and CD276-OE, were added to each well and marked. The six-well plates were then gently mixed and placed in an incubator.

[0031] (4) After 12 h, replace the medium in the six-well plate with fresh medium. When the cell density is about 90%, the cells can be transferred to a 10 cm dish and screened for puromycin at a concentration of 5 μg / mL.

[0032] 2. Validation of CD276 overexpressing cell lines (1) When the cell density is above 85%, the cells can be collected. Discard the supernatant of the culture medium in the culture dish and wash twice with PBS.

[0033] (2) Digest with trypsin and terminate the process. Transfer the cells to centrifuge tubes, centrifuge, discard the supernatant, wash once with 1 mL PBS and place in an ice box (groups: Blank, PLVX, CD276-OE).

[0034] (3) Centrifuge at 4℃, 500 g for 5 min and discard the supernatant.

[0035] (4) Add CD276 antibody (CD276-PE, 0.3 μL of antibody per tube of 50 μL PBS) and incubate on ice for 30 min.

[0036] (5) Add 1 mL PBS to wash twice, transfer to a flow cytometer, and use a flow cytometer to detect the expression of CD276 on the cell surface.

[0037] (6) For example Figure 1 The results showed that CHO-K1 cells overexpressed CD276 protein.

[0038] 3. Activation and culture of ER2738 host bacteria (1) Activation: Take two 10 mL centrifuge tubes, add 3 mL of LB liquid medium and 3 μL of 500 mg / mL tetracycline (Tet) to each tube, add 20 μL of ER2738 glycerol bacteria to one tube, and use the other tube as a blank control. Incubate at 37℃ and 210 rpm for 4 h.

[0039] (2) Streaking culture: Dip an inoculating loop into the activated ER2738 bacterial culture and streak it on a tetracycline plate. Incubate overnight at 37°C. The next morning, pick single clones and add 100 μL of tetracycline (Tet) to 100 mL of LB medium. Amplify the culture by shaking at 240 rpm for 5 h at 37°C. Aliquot: 4 mL / tube (5-mL tube), 12 tubes; 1 mL / tube, 10 tubes. Store at 4°C for later use.

[0040] 4. Screening of peptide phage display libraries (1) Cell harvesting: 4.8 × 10⁻⁶ cells of each of CHO-K1-PLVX and CHO-K1-OE. 6 Transfer each cell to a 15-mL centrifuge tube, resuspend in 4 mL, and then transfer each cell type to 1 mL to 1.5-mL EP tubes, 4 tubes of each type, for a total of 8 tubes. Centrifuge at 2000 rpm for 5 min at 4℃, and take the two tubes with the largest and most uniform cell count.

[0041] (2) Wash away the serum: Add 900 μL of serum-free 1640 medium to each tube to resuspend the cells, wash the cells, centrifuge at 2000 rpm for 5 min at 4℃.

[0042] (3) Blocking: Add 400 μL of blocking solution (5 mg / mL BSA) and block at 4℃ for 1 h. Place on a shaker and seal with sealing film.

[0043] (4) Centrifuge PLVX cells at 2000 rpm for 5 min at 4℃, discard the supernatant, add 200 μL PBS and mix well, add 10 μL peptide library, mix well, and incubate at 4℃ for 1 h (Day 1: 1 h; Day 2: 1 h; Day 3: 1.5 h; Day 4: 2 h; Day 5: 2 h).

[0044] (5) After incubation, centrifuge at 3000 rpm for 5 min at 4℃. The supernatant is incubated with OE cells for 2 h (Day 1: 2 h; Day 2: 1.5 h; Day 3: 1 h; Day 4: 45 min; Day 5: 30 min).

[0045] (6) Centrifuge at 3000 rpm for 5 min at 4℃ and discard the supernatant.

[0046] (7) PBST (pH 5.0) 0.1% Tween-20, wash five times, add 900 μL each time.

[0047] (8) Wash twice with PBST (pH 7.4) 0.1%~0.5% Tween-20 (Day 1: 0.1%; Day 2: 0.2%; Day 3: 0.3%; Day 4: 0.4%; Day 5: 0.5%), adding 900 μL each time.

[0048] (9) Add 100 μL of lysis buffer (sterile water), mix well after adding, and let stand at room temperature for 5 min.

[0049] (10) Add 200 μL of elution buffer directly, mix well, centrifuge at room temperature for 20 min (3000 rpm, 5 min, 4℃), transfer the supernatant to tube A of a new 1.5-mL EP tube (tube A: add 30 μL of neutralizing solution in advance), add 200 μL of elution buffer to the original tube, mix well at room temperature for 10 min, centrifuge, take the supernatant and transfer it to tube A, add 30 μL of neutralizing solution, mix well.

[0050] (11) Take out a new 1.5-mL tube, add 10 μL of peptide elution neutralization buffer and 90 μL of PBS 7.4 solution for titer determination, and use the remaining solution for amplification.

[0051] (12) First wash: Prepare 10 200 μL tubes, add 90 μL of PBS7.4 to each tube, take out 10 μL of the neutralized liquid and put it into the first EP tube for gradient dilution.

[0052] (13) Amplification: Take two 50 mL centrifuge tubes, add 20 mL LB medium, 200 μL ER2738 and 20 μL tetracycline (Tet), then add the entire peptide library, labeled as "7 peptides / 12 peptides one amplification", shake at 270 r / min for 4.5 h, and protect from light.

[0053] (14) Take out the shaken bacterial culture and pour it into a 50-mL centrifuge tube. Centrifuge at 12000 rpm for 15 min at 4℃. Pour the supernatant directly into a 50-mL centrifuge tube, add 3.3 mL PEG / NaCl, blow it a few times, shake it well, and let it precipitate overnight at 4℃. Seal the tube with a sealing film.

[0054] (15) The next morning: Centrifuge at 12000 rpm for 15 min at 4℃, discard the supernatant, keep the precipitate, add 500 μL of PBS 7.4 solution, mix well, add to a new 1.5-mL centrifuge tube, add 500 mL of PBS 7.4 solution to wash the 50-mL centrifuge tube once, then transfer to the 1.5-mL centrifuge tube, add 1 / 6 volume of PEG8000, mix well, precipitate at 4℃ for 1 h.

[0055] (16) After precipitation for 1 h, centrifuge at 12000 rpm for 15 min at 4℃ and discard the supernatant.

[0056] (17) Add 200 μL PBS 7.4 to resuspend, and resuspend with a low-adsorption pipette tip.

[0057] (18) Centrifuge at 12000 rpm, 2 min, 4℃ to remove bacterial fragments, and transfer the supernatant to a new 1.5-mL EP tube labeled “7-peptide amplification, 12-peptide amplification”.

[0058] (19) Take 10 μL for titer measurement (add 90 μL of PBS 7.4 solution to 10 μL of elution buffer), and use the rest for the next round of screening.

[0059] (20) Gradient 10 after amplification -1 ~10 -12 But only select 10 -6 ~10 -10 Remove the plate.

[0060] (21) Second round of selection: Collect cells, add PBS to 1 mL, centrifuge at 2000 rpm for 5 min at 4℃ (22) Wash once with serum-free 1640 medium, without blowing or tapping, and centrifuge at 2000 rpm for 5 min at 4℃.

[0061] (23) 400 μL of blocking solution (5 mg / mL BSA) was placed at 4℃ for 1 h and then placed on a shaker.

[0062] (24) After 1 h, PLVX was centrifuged at 2000 rpm for 5 min at 4℃, the supernatant was discarded, and a round of amplification liquid was added and incubated for 1 h.

[0063] (25) Centrifuge OE cells at 2000 rpm for 5 min at 4℃, discard the supernatant, centrifuge PLVX at 3000 rpm for 5 min at 4℃, add the supernatant to OE cells, and incubate at 4℃ for 1.5 h.

[0064] (26) Centrifuge at 3000 rpm for 5 min at 4℃, wash five times with PBST (pH 5.0).

[0065] (27) Wash twice with PBST (pH 7.4, 0.2%).

[0066] (28) Add water for lysis, 5 min at room temperature, add 200 μL of elution buffer directly, 20 min at room temperature, centrifuge at 3000 rpm for 5 min at 4℃.

[0067] (29) Take the supernatant and add it to a new EP tube containing 30 μL of neutralizing solution in 1.5 mL.

[0068] (30) Add 200 μL of elution buffer to the precipitate, mix well, incubate at room temperature for 10 min, add the supernatant to the tube above, and then add 30 μL of neutralization solution. Take 10 μL + 90 μL of PBS to measure the titer.

[0069] (31) Repeat the above steps to perform the third round of screening and related determinations, namely the second round of elution → the second round of elution product titration → the second round of enrichment → the second round of enrichment product titration → the third round of elution → the third round of elution product titration → the fourth round of elution product titration → the fourth round of enrichment → the fourth round of enrichment product titration → the fifth round of elution → the fifth round of elution product titration.

[0070] 5. Determination of titer of phage particle concentration products (1) Perform 10-fold serial dilutions on the phage samples to be tested (eluted and amplified). The dilution gradient of the eluted phage samples is 10. -1 -10 -5 The amplified phage samples were diluted in a 10-10 ratio. -6 -10 -10 .

[0071] (2) Heat the bottom solid culture medium in a microwave oven until it melts (take it out and check its state after melting for a while, boil it until it is completely melted, boil it again and then take it out), and cool it down to about 50°C. Open the bottom solid culture medium in a clean bench, add 200~250 μL of IPTG / x-gal to 150 mL, mix well, protect from light, and pour into a 6-well plate.

[0072] (3) Take 200 μL of bacterial culture ER2738 into a 4 mL sterile EP tube, add 10 μL of phage at different dilutions to each tube, mix well and incubate at room temperature for 5 min. Set up a blank control with no phage and only host bacteria in each 6-well culture plate.

[0073] (4) Take 2 mL of melted top agar medium into a 4 mL EP tube for incubating bacteriophages, mix quickly and immediately pour it onto a solid (IPTG / X-gal) 6-well culture plate and spread it evenly.

[0074] (5) After cooling the 6-well culture plate to room temperature in the dark for about 15 min, invert it and incubate it overnight (12–14 h) in a constant temperature incubator at 37 ℃; put the diluted EP tubes into centrifuge tubes and store them at 4 ℃.

[0075] (6) Place the plate in the incubator for no more than 12 hours. Take it out the next morning, wrap it with sealing film, transfer it to a 4-degree refrigerator, and place it upside down. You can take pictures at any time.

[0076] (7) Check the plates. Select a 6-well plate containing approximately 20-100 plaques and count the number of blue spots, and calculate the titer. Calculation formula: Phage titer (pfu / μL) = Number of plaques × Dilution factor / 10.

[0077] The enrichment effect was assessed by detecting the phage titer in each round of elution during the screening process. The results are shown in Tables 1 and 2 below.

[0078]

[0079]

[0080] As can be seen from Tables 1 and 2, although the amount of phage input in the last four rounds was reduced compared to the first round, the amount of phage recovered was higher than that in the first round. Furthermore, the titer of the phage collected after five rounds of elution increased significantly, which fully demonstrates that as the screening proceeded, a large number of phages in the phage polypeptide library that could specifically bind to the CD276 protein were amplified and enriched.

[0081] 6. Sequencing (1) Select 120 monoclonal plaques (60 heptapeptides and 60 12-peptides) from the plate in the fifth round of screening for PCR. The primers are Fw: ggcgatggttgttgtcattg and Rv: taacactgagtttcgtcaccag.

[0082] (2) The PCR products were sent for sequencing. The reverse sequencing was performed using Rv:taacactgagtttcgtcaccag. The sequencing results were translated into peptide sequences using the TransPhage website (version 0.3.8-dev). After sequence analysis and verification, nine specific sequences were obtained, namely SW-1, SW-2, SW-3, SW-4, SW-6, SW-8, SW-10, SW-11, and SW-12, as detailed in Tables 3-11.

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092] Example 2 1. Pre-enrichment of ligand proteins When coupling the ligand protein CD276 to the chip (CM5, carboxyl surface), the protein must be dissolved in a buffer solution with a pH lower than its isoelectric point. Under these conditions, the protein surface carries a positive charge and can bind to the negatively charged carboxyl surface of the chip via electrostatic adsorption. However, excessively low pH may affect protein activity; therefore, pre-enrichment experiments are necessary to determine the optimal coupling pH conditions.

[0093] Sample preparation: Use PBS buffer (pH 7.4) as the coupling buffer. Dilute 10×PBS 10-fold with deionized water filtered through a 0.22 μm membrane and sonicate to remove air bubbles. Take three 1.5-mL EP tubes and add 20 μL of ligand protein solution (1 mg / mL) and 180 μL of sodium acetate buffer (10 mM, pH 4.0) to each tube, mix well, and bring the total ligand amount to 20-30 μg. If air bubbles are present, centrifuge to remove them. Note: All EP tubes must have their caps removed.

[0094] 2. Ligand coupling The coupling process covalently immobilizes the CD276 ligand (protein) onto the chip surface. This experiment employed the amino-coupled method, with specific conditions determined based on pre-enrichment experimental results. The coupling operation was completed using a wizard program in the Biacore T200 control software.

[0095] Coupling quantity calculation: The theoretical coupling quantity is calculated according to the following formula:

[0096] in, MW represents the maximum binding capacity (RU) on the chip surface; MW represents the molecular weight of the ligand protein; MW represents the molecular weight of the analyte peptide. R L This is a fixed amount of ligand; This is a stoichiometric ratio.

[0097] Conjugation Procedure: The amino-coupled method was used, with a target conjugation amount of 3000 RU. Based on the pre-enrichment results, pH 4.0 sodium acetate buffer (10 mM) was selected as the conjugation buffer. 120 μL of buffer was placed in a 1.5-mL EP tube, and 80 μL of CD276 protein stock solution (0.25 mg / mL) was added and mixed well. 100 μL of EDC and NHS (from the amino-coupled reagent kit BR-1000-50) were placed in two separate 1.5-mL EP tubes; 140 μL of ethanolamine (same as the kit) was placed in another EP tube. All tube caps were removed, and any air bubbles were removed by centrifugation. The EP tubes were placed in the sample rack according to the sample placement table, and the rack caps were replaced with the tubes in the sample compartment. The conjugation program was run, taking approximately 40-50 minutes.

[0098] 3. Sample Testing (1) Initial screening of samples: Dissolve the obtained peptide powder in PBS or DMSO to prepare a 100 μM stock solution. Dilute the stock solution by half with 1×PBS buffer. Run the Fragment Binding Level Screen program for initial affinity screening and the Fragment Clean Screen program to exclude non-specifically bound sticky small molecules.

[0099] (2) Determination of KD value of samples: The highest concentration of peptide was set at 100 μM, and seven concentrations (100 μM, 50 μM, 25 μM, 12.5 μM, 6.25 μM, 3.12 μM, 1.56 μM) were prepared by half-maximal serial dilution, and a zero-concentration control was set up. Intermediate concentrations were selected for repeated experiments to evaluate repeatability. The injection time was set at 600 seconds, the flow rate at 30 μL / min, and the dissociation time at 600 seconds. Data acquisition was carried out using a multi-cycle kinetics / affinity experiment.

[0100] (3) Select appropriate continuous concentrations (at least 5 concentrations) for kinetic 1:1 binding or steady-state analysis. Results after data processing and analysis are shown below. Figure 2-10 .

[0101] Based on the sensor images, the analyte SW-1 is determined to be of the fast-attachment-fast-dissociation type, therefore Affinity is selected. The steady-state model is applied for analysis, yielding an affinity KD of 5.905 × 10⁻⁶. -4 M.

[0102] Based on the sensor images, the analyte SW-2 is determined to be of the fast-attachment-fast-dissociation type, so Affinity is selected. The steady-state model is applied for analysis, and the obtained affinity KD is 2.283 × 10⁻⁶. -4 M.

[0103] Based on the sensor images, the analyte SW-3 is determined to be of the fast-attachment-fast-dissociation type, so Affinity is selected. The steady-state model is applied for analysis, and the obtained affinity KD is 9.069 × 10⁻⁶. -5 M.

[0104] Based on the sensor images, the analyte SW-4 is determined to be of the fast-attachment-fast-dissociation type, so Affinity is selected. The steady-state model is applied for analysis, and the obtained affinity KD is 5.454 × 10⁻⁶. -4 M.

[0105] Based on the sensor images, the analyte SW-6 is determined to be of the fast-attachment-fast-dissociation type, therefore Affinity is selected. The steady-state model is applied for analysis, and the obtained affinity KD is 2.544 × 10⁻⁶. -4 M.

[0106] Based on the sensor images, the analyte SW-8 is determined to be of the fast-attachment-fast-dissociation type, therefore Affinity is selected. The steady-state model is applied for analysis, and the obtained affinity KD is 1.226 × 10⁻⁶. -5 M.

[0107] Based on the sensor images, the analyte SW-10 is determined to be of the fast-attachment-fast-dissociation type, so Affinity is selected. The steady-state model is applied for analysis, and the obtained affinity KD is 5.944 × 10⁻⁶. -5 M.

[0108] Based on the sensor images, the analyte SW-11 is determined to be of the fast-attachment-fast-dissociation type, therefore Affinity is selected. The steady-state model is applied for analysis, and the obtained affinity KD is 1.191 × 10⁻⁶. -5 M.

[0109] Based on the sensor images, the analyte SW-12 is determined to be of the fast-attachment-fast-dissociation type, therefore Affinity is selected. The steady-state model is applied for analysis, yielding an affinity KD of 6.343 × 10⁻⁶. -6 M.

[0110] Therefore, it can be seen that the nine polypeptides screened by this invention can not only specifically bind to the CD276 protein on the cell membrane surface, but also specifically bind to the commercially available CD276 protein.

[0111] CD276, as an important immune checkpoint molecule and tumor-associated antigen, is highly expressed in various human malignancies and participates in regulating tumor cell proliferation, metastasis, drug resistance, and immune escape. Its expression level is significantly correlated with poor patient prognosis. Based on this biological characteristic, the peptides of this invention can be used to prepare various biomedical tools, including specific probes, imaging tracers, and in vitro diagnostic reagents. Specifically, they can be applied to PET / SPECT molecular imaging, intraoperative near-infrared fluorescence navigation, and liquid biopsy enrichment of circulating tumor cells or exosomes. By achieving quantitative detection and spatial localization of CD276 expression levels, this invention provides a new means for companion diagnosis and monitoring of treatment processes in CD276-related tumors.

[0112] The peptides described in this invention have significant application potential in precision oncology and immunotherapy. These peptides can not only act as antagonists of CD276, blocking its binding to its corresponding receptor and thereby activating immune effector cells such as T cells and enhancing anti-tumor immune responses, but also serve as components of tumor vaccines, inducing specific immune responses and improving the immune system's ability to recognize tumor cells. Furthermore, these peptides can be used in combination with other immunotherapies to achieve synergistic effects.

[0113] Beyond clinical applications, these peptides also provide important tools for studying the functional mechanisms of CD276 in the tumor microenvironment. Targeted drug delivery systems built upon these peptides can achieve precise drug delivery, improving efficacy while reducing systemic toxicity, making them valuable in novel diagnostic technologies, molecular imaging, and gene therapy. Related research will further deepen our understanding of tumor biology and immune regulation mechanisms, and provide a basis for innovative cancer treatment strategies. Future development may focus on developing peptide drug conjugates, constructing integrated diagnostic and therapeutic platforms, utilizing artificial intelligence to optimize peptide structures, and exploring their cross-indication applications in other diseases such as autoimmune diseases.

[0114] The above description is only a preferred embodiment of the present invention and does not limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A polypeptide that specifically binds to CD276, characterized in that, The polypeptide is selected from any one of the following: (a) A polypeptide comprising the amino acid sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 9; (b) A polypeptide obtained by modifying the amino acid sequence described in (a) and retaining its ability to specifically bind to CD276, wherein the KD value for binding to CD276 is less than 6 × 10⁻⁶. -4 M; (c) A polypeptide obtained by substituting, deleting, or adding one or more amino acids based on the amino acid sequence described in (a) or (b), which retains the ability to specifically bind to CD276, and whose KD value for binding to CD276 is less than 6 × 10⁻⁶. -4 M; (d) A polypeptide having at least 90% sequence identity with the amino acid sequence described in (a), (b), or (c) and retaining the ability to specifically bind to CD276, wherein the KD value for binding to CD276 is less than 6 × 10⁻⁶. -4 M.

2. The polypeptide according to claim 1, characterized in that, A polypeptide having the amino acid sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO:

9.

3. A nucleic acid molecule, said nucleic acid molecule encoding a polypeptide as described in any one of claims 1-2.

4. The nucleic acid molecule as described in claim 3, characterized in that, The nucleic acid molecule is any one of the following: (a) Includes the nucleotide sequence shown in any one of SEQ ID NO: 10 to SEQ ID NO: 18; (b) A nucleotide sequence complementary to the nucleotide sequence described in (a); (c) A sequence that encodes a polypeptide with the same nucleotide sequence as described in (a) or (b) but has a different nucleotide sequence due to genetic code degeneracy; (d) A nucleotide sequence that encodes a polypeptide with the same or similar function, obtained by substitution, deletion or addition of one or more nucleotides based on the nucleotide sequence described in (a), (b) or (c); (e) A nucleotide sequence that has at least 90% sequence identity with the nucleotide sequence described in (a), (b), (c) or (d) and encodes a polypeptide with the same or similar function.

5. The nucleic acid molecule as described in claim 4, characterized in that, It has the nucleotide sequence shown in any one of SEQ ID NO: 10 to SEQ ID NO:

18.

6. A vector comprising the nucleic acid molecule of any one of claims 3-5, wherein the vector is a cloning vector or an expression vector.

7. A host cell comprising the nucleic acid molecule of any one of claims 3-5 or the vector of claim 6.

8. A method for screening peptides that specifically bind to CD276 as described in claim 1, characterized in that, The method includes the following steps: (a) Using the CD276 human gene overexpression cell line, multiple rounds of panning were performed on the heptapeptide and dodecapeptide libraries displayed by bacteriophages; (b) Through the aforementioned multi-round screening, peptide sequences that specifically bind to CD276 are enriched; (c) Isolate and identify the amino acid sequence of the enriched polypeptide.

9. The application of the polypeptide as described in claim 1 in detecting the expression level of CD276 protein in biological samples.

10. The use of the polypeptide of claim 1 in the preparation of a drug targeting the CD276 protein.

Images