A nanoluc-drnhi fusion protein, a preparation method and a kit thereof

By developing the NanoLuc-dRNH1 fusion protein, the specific binding of DNA-RNA hybrids and the output of bioluminescent signals are integrated, solving the problems of cumbersome detection procedures and signal separation in existing technologies, and achieving rapid, stable and quantifiable detection results.

CN122145646APending Publication Date: 2026-06-05SICHUAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SICHUAN UNIV
Filing Date
2026-02-14
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing DNA-RNA hybrid detection methods suffer from cumbersome procedures, high background signals, and separation of recognition events from signal output, making it difficult to achieve rapid, stable, and quantifiable direct readout. In particular, they have poor accuracy and reproducibility under low abundance or complex sample conditions.

Method used

A fusion protein, NanoLuc-dRNH1, was developed that binds to and recognizes DNA-RNA hybrids and generates a bioluminescent signal using furimazine as a substrate. The protein was prepared in host cells using a recombinant expression vector and purified by affinity chromatography to form a kit product.

Benefits of technology

It achieves integrated specific binding and signal output of DNA-RNA hybrids, with low background signal, suitable for rapid detection at room temperature, stable and quantifiable signal, simplified detection process, and improved detection reliability and applicability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122145646A_ABST
    Figure CN122145646A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of protein engineering and bioluminescence analysis, and discloses a fusion protein NanoLuc-dRNH1, a preparation method and a kit thereof. The fusion protein is a single polypeptide chain, which is composed of a NanoLuc luminescent enzyme domain and a dRNH1 domain connected by a connecting peptide, and has the DNA-RNA hybrid selective binding ability and the bioluminescence signal output ability with furimazine as a substrate. The fusion protein can be recombinantly expressed in Escherichia coli and purified by affinity chromatography. Experiments show that the fusion protein forms a complex with a DNA-RNA hybrid, has low non-specific binding to single-stranded DNA, single-stranded RNA and double-stranded DNA, and generates a stable measurable luminescence signal in a short time at room temperature. Further, the kit comprising the fusion protein, furimazine and a buffer is provided, and can be used for nucleic acid structure recognition and signal reporting integrated detection, and has the advantages of simple preparation, high specificity, low background and rapid reading.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of protein engineering and bioluminescence analysis technology, specifically to a NanoLuc-dRNH1 fusion protein that combines DNA-RNA hybrid binding recognition capability with bioluminescence signal output capability. Background Technology

[0002] DNA-RNA hybrids are widely present in transcription-related processes and can form nucleic acid structures such as R-loops, playing a crucial role in gene expression regulation, genome stability maintenance, and related mechanism research. Therefore, the detection and identification of DNA-RNA hybrids are of great value for revealing their biological functions, elucidating related molecular mechanisms, and conducting related applied research. Existing methods for DNA-RNA hybrid identification mainly include antibody-based identification, nucleic acid probe-based hybridization identification, and enzymatic tool-based structural identification. However, these methods often have limitations in practical applications. For example, antibody reagents may exhibit batch-to-batch variability and cross-reaction risks; nucleic acid probes or enzymatic systems may require additional labeling, signal amplification, or multiple steps, leading to cumbersome procedures, high background signals, and often separation between the identification event and signal output, making rapid, stable, and quantifiable direct readout difficult. Especially under low-abundance or complex sample conditions, non-specific binding and background noise can more easily affect the accuracy and reproducibility of the detection results. Therefore, there is an urgent need to develop an integrated molecular module that can specifically bind to DNA-RNA hybrids and directly convert the binding event into a stable, quantifiable signal output, in order to simplify the detection process, reduce background and improve the reliability and applicability of the detection. Summary of the Invention

[0003] To address the problems in the background art, the present invention provides a fusion protein, NanoLuc-dRNH1, which simultaneously possesses the ability to recognize and bind to DNA-RNA hybrids and the ability to output bioluminescent signals using furimazine as a substrate. Furthermore, the present invention provides its encoding nucleic acid, recombinant expression vector, host cell, preparation method, and kit, thereby achieving the integration of nucleic acid structure recognition and signal reporting.

[0004] To achieve the above objectives, the present invention provides:

[0005] (1) A fusion protein NanoLuc-dRNH1, which is a single polypeptide chain containing a NanoLuc luminescent enzyme domain and a dRNH1 domain, linked by a linker peptide; the fusion protein can bind to a DNA-RNA hybrid and can generate a bioluminescent signal in the presence of furimazine. Preferably, NanoLuc is located at the N-terminus, dRNH1 is located at the C-terminus, and the linker peptide is a flexible linker peptide, preferably a Gly / Ser repeat sequence, such as GSGSGSGSGS.

[0006] (2) A recombinant expression vector containing the nucleic acid molecule and a recombinant host cell containing the vector.

[0007] (3) The preparation method of the fusion protein includes steps such as induction of expression, cell lysis to obtain soluble supernatant, affinity chromatography purification and concentration.

[0008] (4) A kit comprising the fusion protein, furimazine substrate and reaction buffer.

[0009] Compared with the prior art, the present invention has the following beneficial effects:

[0010] (1) The DNA-RNA hybrid binding recognition and bioluminescent signal output are integrated into a single molecular module, simplifying the process.

[0011] (2) It has good binding properties to DNA-RNA hybrids and low background signal.

[0012] (3) Stable and quantifiable luminescence readout can be obtained using furimazine as a substrate, which is suitable for rapid detection at room temperature.

[0013] (4) It can be prepared in commonly used recombinant expression systems and purified by affinity chromatography. The process is simple and can be promoted.

[0014] (5) It can be formed into a reagent kit product form, which is convenient for standardized use and application promotion. Attached Figure Description

[0015] Figure 1 This is a schematic diagram illustrating the principle of recognition and bioluminescence detection of the fusion protein NanoLuc-dRNH1.

[0016] Figure 2 This is a plasmid map of the fusion protein NanoLuc-dRNH1;

[0017] Figure 3 This is a schematic diagram of the SDS-PAGE results for the expression and purification of the fusion protein;

[0018] Figure 4This is a schematic diagram of the EMSA results for the fusion protein, the DNA-RNA hybrid, and the control substrate.

[0019] Figure 5 These are the Mie kinetic curves of NanoLuc-dRNH1 on furimazine. Detailed Implementation

[0020] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that these descriptions are merely exemplary and not intended to limit the scope of the invention. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concept of the invention. Unless otherwise specified, specific conditions in the embodiments are performed under conventional conditions or conditions recommended by the manufacturer. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0021] Example 1: Construction and Recombinant Expression of NanoLuc-dRNH1 Fusion Protein

[0022] In this embodiment, a recombinant expression vector for expressing the NanoLuc-dRNH1 fusion protein was constructed, and recombinant expression was performed in *E. coli*. The specific steps are as follows: First, a recombinant expression vector for expressing the NanoLuc-dRNH1 fusion protein was constructed. Preferably, the expression vector is a pET series prokaryotic expression vector, and the selection marker is Kan resistance. More preferably, the recombinant expression vector is pET_His6-SUMO-TEV-NanoLuc-dRNH1, with a full-length plasmid of approximately 6907 bp (see [link to documentation]). Figure 2The expression cassette of the expression vector preferably comprises, in sequence, a ribosome binding site (RBS), a 6×His tag coding sequence, a SUMO tag coding sequence, a TEV protease cleavage site, a NanoLuc coding sequence, and a dRNH1 coding sequence, wherein dRNH1 is an inactivating mutant of human RNase H1 (e.g., D210N), and includes a T7 terminator downstream; the vector backbone preferably also includes a lacI regulatory element and its promoter, an origin of replication (ori), a KanR resistance gene, f1 ori, and rop and bom elements. Those skilled in the art can make equivalent substitutions or adjustments to the tag type, cleavage site, linker sequence, promoter, or regulatory element as needed, as long as it can drive expression and obtain a fusion protein that simultaneously possesses DNA-RNA hybrid binding ability and bioluminescent signal output ability using furimazine as a substrate, all of which fall within the scope of protection of this invention. Subsequently, the recombinant expression vector was transformed into *E. coli* DH5α competent cells for amplification, and the extracted plasmid was sequence-verified. The verified plasmid was then transformed into *E. coli* BL21(DE3) competent cells for protein expression. Single colonies were picked and inoculated into LB medium, and cultured at 37°C with shaking until the OD600 reached 0.6–0.8. IPTG was then added to a final concentration of 300 μM, and the culture temperature was increased to 18°C ​​for 16 h to induce expression. After induction, the bacterial cells were collected for later use.

[0023] Example 2: Cleavage, purification, and preservation of fusion proteins

[0024] The recombinant bacterial culture was centrifuged at 4700 rpm for 25 minutes at 4°C to collect the bacterial cell pellet. The supernatant was discarded, and the pellet was resuspended in pre-cooled lysis buffer (50 mM Tris-HCl, pH 7.5; 300 mM NaCl; 10% glycerol) at 3 to 5 times the wet weight of the bacterial cells to ensure thorough homogenization. Cell disruption was then achieved using high-pressure homogenization under ice bath or circulating cooling conditions until the suspension became significantly clear and its viscosity decreased. The disrupted suspension was centrifuged at 11000 rpm for 1 hour at 4°C to remove cell debris and insoluble matter. The clear supernatant was collected as the soluble protein sample. The supernatant was loaded onto a Ni-NTA affinity chromatography column pre-equilibrated with the same lysis buffer, and washed with washing buffer (50 mM Tris-HCl, pH 7.5: 1 M). Non-specifically bound proteins were removed using NaCl and 10% glycerol. The target fusion protein was then eluted using a 10-500 mM imidazole gradient. Each elution peak was collected by fractionation and identified by SDS-PAGE. The target protein fractions were then combined. The combined solution was transferred to a 50 kDa MWCO ultrafiltration centrifuge and concentrated to approximately 1 mL at 4°C. Simultaneously, it was replaced with storage buffer (50 mM Tris-HCl, pH 7.5, 250 mM NaCl, 10% glycerol, 1 mM DTT). Finally, the protein was aliquoted, flash-frozen in liquid nitrogen, and stored at -80°C. Electrophoresis results showed that the apparent molecular weight of the obtained fusion protein under reducing conditions was approximately 62 kDa (see [link to electrophoresis results]). Figure 3 The result was consistent with the theoretical value, indicating that the lysis and purification process was effective.

[0025] Example 3: Verification of Selective Binding of DNA-RNA Hybrids (EMSA)

[0026] In this embodiment, electrophoretic mobility shift analysis (EMSA) was used to verify the binding ability of the NanoLuc-dRNH1 fusion protein to the DNA-RNA hybrid and its selectivity relative to the control substrate. The specific procedures were as follows: the final concentration of all substrates was 1 μM. The DNA-RNA hybrid substrate was prepared by mixing SEQ ID NO.1 and SEQ ID NO.2 at a molar ratio of 1:1 and annealing. For the control substrates, ssDNA was SEQ ID NO.3, ssRNA was SEQ ID NO.4, and dsDNA was prepared by mixing SEQ ID NO.5 and SEQ ID NO.6 at a molar ratio of 1:1 and annealing. The fusion protein was incubated with each of the above substrates in binding reaction buffers before EMSA analysis. Preferably, the binding reaction buffer is a 5× concentrated buffer, composed of 50 mM Tris-HCl (pH 7.5), 75 mM KCl, 3 mM MgCl2, and 10 mM DTT; it is diluted to a 1× working concentration for use, wherein the 1× working concentration is 10 mM Tris-HCl (pH 7.5), 15 mM KCl, 0.6 mM MgCl2, and 2 mM DTT. No BSA is added to the binding reaction system, and it is preferably incubated at 37°C for 30 minutes. After incubation, the reaction system is analyzed by non-denaturing polyacrylamide gel electrophoresis. The results are shown (see...). Figure 4 In the presence of the fusion protein, the DNA-RNA hybrid exhibits a significant change in migration rate and forms a complex band, while the migration of the control substrates ssDNA, ssRNA, and dsDNA is largely unaffected, indicating that the fusion protein has good binding ability to the DNA-RNA hybrid and exhibits high selectivity.

[0027] Table 1 EMSA Sequences

[0028] Serial Number name Sequence (5'-3') illustrate 1 SEQ ID NO.1 GGGATCAGTGGTTCCCATAT DNA-RNA hybrid DNA strand 2 SEQ ID NO.2 AUAUGGGAACCACUGAUCCC DNA-RNA hybrid RNA chain 3 SEQ ID NO.3 GGGATCAGTGGTTCCCATAT Single-stranded DNA control substrate 4 SEQ ID NO.4 AUAUGGGAACCACUGAUCCC Single-stranded RNA control substrate 5 SEQ ID NO.5 GGGATCAGTGGTTCCCATAT Double-stranded DNA control substrate positive strand 6 SEQ ID NO.6 ATATGGGAACCACTGATCCC Double-stranded DNA control substrate antisense strand

[0029] Example 4: Enzyme kinetic characterization of NanoLuc-dRNH1

[0030] In this embodiment, a unified bioluminescent reaction buffer system was first determined: preferably, the NanoLuc-dRNH1 fusion protein was characterized by enzyme kinetics using furimazine as a substrate in a working buffer containing 20 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 150 mM KCl, 10% glycerol, and 1 mM DTT and their equivalent concentration ranges. Bioluminescence intensity was measured under different furimazine concentration gradients, and a standard curve was established to obtain a stable signal conversion relationship. Under near-saturation substrate conditions, 0.1 nM NanoLuc-dRNH1 could produce a maximum reaction rate on the order of approximately 10 nM / s. After Michaelis-Menten kinetic fitting, its apparent KL of furimazine was determined. M At 10 -5 On the order of M, while exhibiting approximately 10 2 s -1 catalytic conversion number on the order of magnitude and 10 6 M -1 s -1 Catalytic efficiency on the order of magnitude (see Figure 5 The above results indicate that NanoLuc-dRNH1 can effectively convert furimazine while maintaining good bioluminescence performance, making it suitable for the nucleic acid detection system of this invention.

[0031] Example 5: Bioluminescence Reaction and Rapid Readout

[0032] In this embodiment, the conventional bioluminescent reaction of the NanoLuc-dRNH1 fusion protein was verified using the unified reaction buffer system described in Example 4. The fusion protein and furimazine were added to the reaction buffer to initiate the bioluminescent reaction, with the final concentration of the fusion protein being 100 nM and the final concentration of furimazine being 10 μM. The luminescence signal was read after reacting at room temperature for approximately 5 minutes.

[0033] Under the above system, the fusion protein can generate a stable, reproducible, and accurately readable bioluminescent signal within a short time. Furthermore, the bioluminescent signal can be measured using a luminescence reader or a luminescence detection system; in one specific embodiment, the luminescent signal exhibits a high emission intensity around approximately 450 nm, and a detection channel in the 450-470 nm range is preferably selected for readout; it should be understood that different detection devices and filter settings may result in differences in the wavelength corresponding to the strongest signal.

[0034] Example 6: Kit (Minimum Version) Composition and Usage

[0035] This invention provides a kit comprising at least the following components: Component A: fusion protein NanoLuc-dRNH1; Component B: furimazine substrate; Component C: reaction buffer. Preferably, the reaction buffer is a 5× concentrated buffer with the following composition: 100 mM Tris-HCl (pH 7.5), 25 mM MgCl2, 750 mM KCl, 50% glycerol, and 5 mM DTT; it is diluted to a 1× working concentration for use. In use, components A and B are added to component C and mixed thoroughly to achieve a final concentration of 100 nM for the fusion protein and 10 μM for the furimazine. The reaction is carried out at room temperature for 5 minutes, and the bioluminescent signal is measured as the output.

[0036] Finally, it should be noted that the above embodiments are only used to further illustrate the present invention and are not intended to limit the scope of protection of the present invention. Although the technical solutions of the present invention have been described in detail with reference to the above embodiments, those skilled in the art can still make various modifications, substitutions or equivalent transformations without departing from the spirit and substance of the present invention. Any improvements, modifications or equivalent substitutions made based on the concept of the present invention should fall within the protection scope of the present invention.

Claims

1. A fusion protein NanoLuc-dRNH1, which is a single polypeptide chain containing a luminescent enzyme domain and a recognition domain capable of binding DNA-RNA hybrids, wherein the luminescent enzyme domain is preferably NanoLuc luminescent enzyme and the recognition domain is a dRNH1 domain, the two being linked by a flexible linker peptide, enabling the fusion protein to generate a measurable bioluminescent signal in the presence of a substrate and specifically recognize DNA-RNA hybrids, wherein the luminescent enzyme domain may be located at the N-terminus or the C-terminus, and the recognition domain may be located at the N-terminus or the C-terminus.

2. The fusion protein as described in claim 1, characterized in that, The linker peptide is a flexible linker peptide, preferably a Gly / Ser repeat sequence, and the fusion protein may further include an affinity purification tag and / or a protease cleavage site. The affinity purification tag may be selected from His, Strep, FLAG, and HA tags, and the protease cleavage site may be selected from TEV, SUMO, thrombin, Factor Xa cleavage site, or other known cleavage sites.

3. A method for isolating nucleic acid molecules, characterized in that, The nucleic acid molecule encodes the NanoLuc-dRNH1 fusion protein as described in claim 1 or 2, and can drive its expression in a prokaryotic expression system in a recombinant expression vector, so that the fusion protein retains its DNA-RNA hybrid binding ability and bioluminescent catalytic function.

4. A recombinant expression vector, characterized in that, The vector comprises the nucleic acid molecule of claim 3 and is capable of driving the expression of the fusion protein in a prokaryotic expression system; and a recombinant host cell, characterized in that it contains the recombinant expression vector, preferably Escherichia coli, so that the fusion protein can be efficiently expressed in the host and maintain its DNA-RNA hybrid binding ability and bioluminescent catalytic function.

5. A method for preparing the NanoLuc-dRNH1 fusion protein according to claim 1 or 2, characterized in that, The process includes culturing host cells containing the recombinant expression vector of claim 4 and inducing the expression of the fusion protein, collecting bacterial cells and lysing them to obtain a soluble supernatant containing the fusion protein, separating and purifying the fusion protein by affinity chromatography and concentrating it to obtain a purified product, so that the fusion protein retains its DNA-RNA hybrid binding ability and can generate a bioluminescent signal in the presence of furimazine.

6. A reagent kit, characterized in that, The invention comprises the fusion protein, luminescent substrate, and reaction buffer as described in claim 1 or 2, and is used for the specific recognition and bioluminescent detection of DNA-RNA hybrids, realizing the integrated application of nucleic acid recognition and signal output. It is applicable to multiple scenarios such as rapid detection, molecular biology research, clinical testing, or bioanalysis. The substrate is preferably Furimazine or other substrates with luminescent properties.