Candida utilis and its fermentation method and application

By developing the DBN-JM80 strain, the problems of low protein yield and insufficient environmental tolerance of existing Candida utilis in utilizing inexpensive and complex carbon sources have been solved, achieving efficient production of high-protein single-cell protein, which is suitable for industrial-scale fermentation.

CN122146483APending Publication Date: 2026-06-05BEIJING DABEINONG TECHNOLOGY GROUP CO LTD +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BEIJING DABEINONG TECHNOLOGY GROUP CO LTD
Filing Date
2026-02-13
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing Candida utilis strains exhibit low protein yield and low efficiency in utilizing mixed sugar sources when using inexpensive and complex carbon sources. Furthermore, they have limited environmental tolerance and inorganic nitrogen source utilization capabilities, and their growth is inhibited, especially in the presence of high concentrations of ammonium sulfate.

Method used

A strain of Candida utilis named DBN-JM80 was developed, which has high protein synthesis capacity, broad environmental tolerance and efficient inorganic nitrogen source utilization. It can exhibit crude protein content of more than 50% in a variety of inexpensive carbon sources such as straw sugar and molasses, and maintain growth and nitrogen source utilization at concentrations up to 15% ammonium sulfate.

Benefits of technology

It enables efficient production of high protein from inexpensive and complex carbon sources, improves the environmental adaptability and nitrogen source utilization efficiency of the strain, is suitable for industrial-scale fermentation, reduces the stringency of process control, and improves production flexibility and economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application belongs to the technical field of microorganisms, and specifically discloses a Candida utilis, a fermentation method and application thereof. The classification and naming of the strain is Candida utilis, which has been preserved in the China General Microbiological Culture Collection Center with a preservation number of CGMCC NO:33529. The Candida utilis disclosed in the application can efficiently utilize various low-value industrial and agricultural by-products as carbon sources, and the crude protein content of the dry weight of the fermentation bacteria can be stably above 50%. In addition, the strain has excellent tolerance, can stably grow in the range of pH 3.5-6.0, and can tolerate an ammonium sulfate concentration as high as 15%. The strain of the application solves the problems of low protein yield and narrow substrate utilization spectrum of the yeast strain in the prior art, and provides important technical support for low-cost and high-efficiency production of single-cell protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology and bioengineering, specifically relating to a prion-producing yeast, its fermentation method, and its application. Background Technology

[0002] Single-cell protein (SCP) has shown great potential as a sustainable alternative to traditional animal and plant proteins in fields such as feed and food. Candida utilis is one of the core strains for industrial SCP production, with the advantage of utilizing a variety of inexpensive carbon sources, such as straw sugars (rich in pentose and hexose sugars) produced from the hydrolysis of lignocellulose, molasses (a byproduct of the food industry), cassava extract, and corn steep liquor.

[0003] However, there are still several technical bottlenecks in the existing Candida utilis strains used for SCP production:

[0004] Achieving both high protein yield and substrate utilization is challenging: most industrial strains typically have a crude protein content of 40%-45%. While a few optimized strains can increase protein content, their efficiency in utilizing complex substrates such as straw sugars is often unsatisfactory. In particular, the low utilization rate of pentose sugars such as xylose limits the overall sugar utilization rate and economic benefits.

[0005] The utilization efficiency of mixed sugar sources is low: raw materials such as straw hydrolysate contain both glucose and xylose. Most yeast strains exhibit carbon metabolite repression, preferentially utilizing glucose and inhibiting xylose metabolism, leading to prolonged total fermentation time, low xylose conversion rate, and waste of raw materials. Existing industrial strains typically struggle to consistently achieve high total sugar utilization rates when processing such mixed sugars.

[0006] Limited environmental tolerance and inorganic nitrogen source utilization: pH fluctuations during fermentation and high concentrations of salts or non-protein nitrogen (such as inorganic ammonium salts) in the substrate pose challenges to the growth and protein production capacity of the strains. In industrial fermentation using inorganic ammonium salts as nitrogen sources, ammonium sulfate has a low-cost advantage, but its high concentration often leads to high osmotic pressure and ion toxicity, severely inhibiting strain activity. Existing technologies and research literature indicate that the upper limit of ammonium sulfate tolerance for conventional industrial strains (the upper limit of the effective concentration for maintaining normal metabolism and protein conversion) is usually below 5% (w / v). When the ammonium sulfate concentration in the fermentation system approaches or exceeds this threshold, its metabolic rate decreases sharply, cell membrane permeability is impaired, and it can even lead to large-scale cell lysis and death. This greatly limits the increase of nitrogen source concentration in high-density fed-batch fermentation processes and the efficient utilization of high-ammonia industrial wastewater / byproducts.

[0007] Therefore, there is an urgent need in this field for a new strain of Candida utilis that can utilize inexpensive and complex industrial and agricultural byproducts while still maintaining high protein synthesis capacity and high environmental tolerance (especially tolerance to high concentrations of inorganic nitrogen sources). Summary of the Invention

[0008] The purpose of this invention is to overcome the shortcomings of the prior art and provide a high-performance Candida utilis strain DBN-JM80, which can achieve a crude protein content of over 50% when utilizing various industrial by-products such as straw sugar and molasses.

[0009] To achieve the above objectives, the present invention provides the following technical solution:

[0010] This invention provides a strain of *Candida utilis*, named DBN-JM80, which was deposited on February 14, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China, with accession number CGMCC NO: 33529. The ITS rDNA sequence of this strain is shown in SEQ ID NO.1.

[0011] The strain DBN-JM80 of the present invention has the following beneficial biological characteristics:

[0012] (1) High protein synthesis capacity: The core advantage of this invention is that, regardless of the carbon source such as straw sugar or molasses, the crude protein content of the dry weight of the cell can consistently exceed 50%, and can reach up to 54.3% in molasses culture medium. This indicator is superior to most reported industrial strains.

[0013] (2) High efficiency in utilizing industrial by-products: This strain can effectively utilize a variety of inexpensive carbon sources. When molasses is used as a carbon source, the utilization rate of reducing sugars reaches 84.1%; when straw sugar is used as a carbon source, the utilization rate of xylose, which is difficult to utilize, can also reach 75.3%, showing good substrate adaptability.

[0014] (3) Wide environmental tolerance: This strain has a wide growth temperature range (25℃-40℃) and its growth is unaffected within a pH range of 3.5 to 6.0; it has high tolerance to nitrogen sources (such as ammonium sulfate) and can tolerate concentrations up to 15% ammonium sulfate. When cultured in a medium with 15% (w / v) ammonium sulfate, its utilization rate of ammonia nitrogen is not less than 23.0%.

[0015] The present invention also provides a microbial preparation containing the aforementioned Candida utilis, the microbial preparation comprising bacterial liquid, bacterial powder, fermentation product or fermented dried product.

[0016] The present invention also provides the application of the aforementioned Candida utilis in the preparation of single-cell proteins.

[0017] The present invention also provides the application of the aforementioned Candida utilis or the aforementioned microbial preparation in the preparation of feed or feed additives.

[0018] This invention also provides a method for preparing single-cell protein, the method comprising culturing the *Candida utilis* or the microbial preparation described herein with a culture medium, collecting the fermentation product, and collecting the bacterial cells from the fermentation product. The crude protein content of the dried bacterial cells is not less than 50%.

[0019] The present invention also provides a fermentation method for the aforementioned Candida utilis, characterized in that 5-15% of the Candida utilis seed culture is inoculated into a fermentation medium, the fermentation temperature is controlled at 25-32℃, the dissolved oxygen is maintained above 30%, and after 6-10 hours of fermentation, according to the changes in the reducing sugar concentration or dissolved oxygen level in the fermentation broth, a continuously or intermittently fed culture medium is started to maintain the total reducing sugar concentration in the fermentation broth at 0.5-5 g / L (preferably 1-2 g / L), and the total fermentation cycle is 24 hours.

[0020] Furthermore, the fermentation medium formula is as follows: molasses (calculated as reducing sugar) 20~100 g / L, ammonium sulfate 4~15 g / L, potassium dihydrogen phosphate 5~10 g / L.

[0021] Furthermore, the fermentation medium formula is as follows: molasses (calculated as reducing sugar) 50 g / L, ammonium sulfate 4 g / L, potassium dihydrogen phosphate 5 g / L.

[0022] Furthermore, the feeding medium is a molasses solution with a reducing sugar concentration of 20% w / v.

[0023] The advantages of this invention over the prior art are as follows:

[0024] One beneficial effect of this invention is that the strain can still produce high-quality SCP products with a crude protein content of over 50% when using low-cost raw materials such as straw sugar and molasses, overcoming the limitation in the prior art that it is usually difficult to obtain high protein yields using such substrates.

[0025] The strain exhibits excellent utilization of straw sugars (especially xylose) and molasses, enabling SCP producers to flexibly select or mix various industrial and agricultural by-products as raw materials based on market prices and supply conditions, effectively improving production flexibility and the ability to cope with raw material fluctuations.

[0026] The strain's wide pH and temperature tolerance range, as well as its tolerance to high concentrations of ammonium salts, make it well-suited for the complex and variable environments of industrial-scale fermentation, reducing the stringent requirements for process control and facilitating large-scale production. Attached Figure Description

[0027] Figure 1 A photograph of the present invention, Candida utilis, under a 1000x optical microscope.

[0028] Figure 2 The growth curve of Candida utilis of the present invention.

[0029] Figure 3 The biomass of Candida utilis under different pH conditions according to the present invention.

[0030] Figure 4 Biomass of four yeast strains at a 10% ammonium sulfate concentration.

[0031] Figure 5 Biomass of strain DBN-JM80 at different ammonium sulfate concentrations.

[0032] Figure 6 Nitrogen source utilization of high concentrations of ammonium sulfate by strains DBN-JM80 and TBJM. Detailed Implementation

[0033] The present invention can be better understood from the following embodiments. However, those skilled in the art will readily understand that the descriptions in the embodiments are for illustrative purposes only and should not, and will not, limit the invention as described in detail in the claims.

[0034] The *Candida utilis* strain DBN-JM80 of this invention exhibits excellent metabolic robustness. Experiments show that this strain possesses strong substrate adaptability and metabolic regulation capabilities. When utilizing various low-value industrial and agricultural by-products as the main carbon source, its core metabolic flux can be efficiently and stably directed towards biomass accumulation and protein conversion. It should be noted that although strain DBN-JM80 of this invention exhibits extremely high protein synthesis efficiency (crude protein content consistently above 50%) under conventional or optimized fermentation conditions, its final content is still affected by the degree of optimization of the fermentation process, nutrient ratio, and fluctuations in environmental parameters during actual production. Therefore, under certain specific process conditions or non-optimized environments, the above values ​​may have a reasonable range of fluctuation, which does not deviate from the high-protein-producing technical essence of the strain of this invention.

[0035] Unless otherwise specified, the methods used in the following examples are conventional methods in the art, and the reagents and raw materials used are commercially available.

[0036] In the following examples, the crude protein content was determined according to the national standard GB / T 6432-2018 "Determination of Crude Protein in Feed - Kjeldahl Method". The reducing sugar content was determined using the 3,5-dinitrosalicylic acid method. The pentose content was determined using the lichenol hydrochloric acid method.

[0037] In the following examples, the sugarcane molasses was purchased from Nanning Sugar Industry Binyang Bridge Sugar Co., Ltd.; the straw sugar was sourced from Beijing University of Chemical Technology.

[0038] Example 1: Screening, Identification, and Biological Characteristics Study of Strains

[0039] 1.1 Strain screening and identification

[0040] 1.1.1 Sample source: Fresh feces were collected from healthy adult cattle at Tongliao Dabeinong Cattle Farm.

[0041] 1.1.2 Sample Processing: Immediately place the obtained fecal samples into a sterile container pre-filled with anaerobic buffer (phosphate-buffered saline, PBS) and maintain a low temperature of 4°C before returning them to the laboratory as soon as possible. In the laboratory, weigh 1g of the sample and mix it with sterile phosphate-buffered saline (PBS) at a ratio of 1:10 (w / v), shake thoroughly to prepare the initial bacterial suspension.

[0042] 1.1.3 Selective enrichment: The above bacterial suspension was inoculated into YPD medium and cultured at 30℃ under aerobic conditions with shaking at 200 rpm for 48 hours. YPD medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract.

[0043] 1.1.4 Serial dilution and streak plating: Take an appropriate amount of the enriched bacterial culture and serially dilute it to 10⁻⁻⁻⁶. 6 Select an appropriate concentration of dilution, and spread 100 μL onto YPD solid medium plates (containing a final concentration of 100 mg / L chloramphenicol). Incubate at 30℃ for 48 hours. Observe the colony morphology regularly, and select single colonies that meet the characteristics of Candida utilis (milky white, smooth, with regular edges) for repeated streak isolation until a pure culture is obtained. YPD solid medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 20 g / L agar powder.

[0044] 1.1.5 Morphological characteristics: Morphological characterization of the purified strain: its colonies are milky white, with a smooth, moist surface and regular edges; under a microscope, individual cells exhibit a typical sausage shape (e.g., Figure 1 (As shown). Based on the above morphological characteristics, the isolated strain was named DBN-JM80.

[0045] 1.1.6 Molecular biological identification (confirmation): ITS rRNA of JM80 was amplified by PCR using universal primers (forward primer ITS1, reverse primer ITS4). The PCR amplification products were sent to Anshengda Company for sequencing. The gene sequence obtained from the ITS rRNA molecular identification was compared with the sequence in the NCBI library by BLAST for strain homology comparison. The sequence comparison results showed that the strain isolated in this invention belongs to Candida utilis.

[0046] The ITS rRNA sequence of DBN-JM80 is shown in SEQ ID No. 1:

[0047] AAGAGATCCGTCGTTGAAAGTTTTAAGATTATAATACAAATTGACTAGTTTCTAGAAAATAAATTTCTGTGTTTAAAACCTTTGGCAGAGCCAAAGCAAAAGAAGCAAAATACACTGTGTATTGGTTGGAGCCGCGCTAGAAGCGCAGGCCCAGGTTCTCTAATGATCCCTCCGTAGGGT GAACCTGCGGAAGGATCATTAGAGAACCTGGGCCTGCGCTTCTAGCGCGGCTCCAACCAATACACAGTGTATTTTGCTTCTTTTGCTTTGGCTCTGCCAAAGGTTTTAAACACAGAAATTTATTTTCTCTAGAAACTAGTCAATTTGAATTTTAATCTTCAAAACTTTCAACAACGGATCTCT TGGTTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGGTTTTCGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTCTGGCATTCCAGAGAGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAGATCCTCTAGGGGACTTGGTATTGAGTGATACTCTGTG TTAACTTGAAATACTCTAGGCAGAGCTCCCCCTAGAAATCCTCTGGGCCGAAATAATGTATTAGGTTCTACCAACTCGTTATTTTCCAGACAGACTTCCAGGCAGAGCTCGGCTGAACAACCTTTCTAAGCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGC

[0048] Strain JM80 was deposited on February 14, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and classified as Candida utilis, with accession number CGMCC NO: 33529.

[0049] 1.2 Determination of Mixed Sugar Utilization and Protein Production Capacity

[0050] 1.2.1 Xylose utilization

[0051] The glucose culture medium composition (g / L) is: glucose 100.0, (NH4)2SO4 21.0, urea 10.0, yeast extract 2.0, MgSO4 1.1, K2HPO4 1.0, KH2PO4 0.5.

[0052] The xylose medium composition (g / L) is: xylose 100.0, (NH4)2SO4 21.0, urea 6.0, yeast extract 4.0, MgSO4 1.1, K2HPO4 1.0, KH2PO4 2.5.

[0053] After activation, strain JM80 and three other Candida utilis strains were inoculated into glucose and xylose media at a 5% inoculum, respectively. The cultures were incubated at 30℃ and 180 rpm for 24 h, with uninoculated media serving as a blank. Biomass, residual sugar content, pentose content, and crude protein content were measured. Of the three Candida utilis strains, two strains with accession numbers CICC1807 and CICC1769 were purchased from the China Industrial Microbiological Culture Collection Center (CICC); the Candida utilis strain with accession number CGMCC 2.2878 was purchased from the China General Microbiological Culture Collection Center (CGMCC).

[0054] As shown in Table 1, strain JM80 exhibits a significant advantage in utilizing xylose as the primary carbon source, with a xylose utilization rate (63.1%) far exceeding that of other tested strains (the highest being 51.7%). This highly efficient xylose utilization is crucial for producing protein feeds using xylose-based raw materials rich in hemicellulose hydrolysis. Simultaneously, JM80 maintained excellent crude protein synthesis capacity (47.65%) under xylose cultivation, with its crude protein content comparable to the optimal strain (CGMCC 2.2878, 47.03%) (a difference of only 0.62 percentage points). Combined with its equally good performance in glucose utilization and biomass accumulation (e.g., glucose utilization rate of 92.4%, dry weight of 10.58 g / L), JM80 demonstrates the best potential in both overall xylose utilization efficiency and protein production capacity.

[0055] Table 1. Yeast utilization of xylose and glucose and protein synthesis.

[0056] strain number Xylose utilization rate % dry weight g / L Crude protein content % Glucose utilization rate % dry weight g / L Crude protein content % JM80 63.1 2.87 47.65 92.4 10.58 39.62 CGMCC 2.2878 51.7 2.92 47.03 94.7 8.11 42.52 CICC 1807 35.8 2.84 40.54 88.7 10.65 37.25 CICC 1769 43.0 2.96 43.77 86.4 10.44 37.80

[0057] 1.2.2 Utilization of mixed sugars

[0058] Fermentation medium 1: molasses (calculated as reducing sugar) 2%, (NH4)2SO4 0.6%, KH2PO4 1.0%, MgSO4 0.25%, pH 5.5.

[0059] Fermentation medium 2: Straw sugar (calculated as reducing sugar) 2%, (NH4)2SO4 0.6%, KH2PO4 1.0%, MgSO4 0.25%, pH 5.5. The straw sugar is a lignocellulose hydrolysate, in which the main reducing sugar components are glucose 69.5 g / L and xylose 21.0 g / L.

[0060] After activation, *Candida utilis* JM80 was inoculated into fermentation medium 1 and fermentation medium 2 at a 5% inoculum rate. The cultures were incubated at 30°C and 180 rpm for 24 h, with the uninoculated medium serving as a blank. Biomass, residual sugar content, pentose content, and crude protein content were measured.

[0061] Table 2 shows that yeast JM80 was cultured in a medium with straw sugar as the carbon source. After fermentation, the results showed that the strain's utilization rate of xylose was 75.3%, and the utilization rate of total reducing sugar was 64.5%. After drying, the collected cells showed a crude protein content as high as 53.58%.

[0062] Yeast JM80 was cultured in a medium with molasses as the carbon source. After fermentation, the results showed that the strain utilized 84.1% of the reducing sugars, and the crude protein content of the collected cells after drying was as high as 54.28%.

[0063] The above results indicate that strain JM80 can maintain extremely high protein synthesis levels regardless of the inexpensive carbon source.

[0064] Table 2. Yeast utilization of mixed sugars and protein synthesis.

[0065] serial number Crude protein content % Reducing sugar utilization rate % Xylose utilization rate % viable bacteria count Biomass g / L Molasses 54.3 84.1 - 1.3×108 4.66 Straw Sugar 53.6 64.5 75.3 8.2×107 4.25

[0066] Note: Molasses contains very low levels of xylose.

[0067] Example 2: Environmental tolerance test of strain DBN-JM80

[0068] 2.1 Temperature tolerance

[0069] The *Candida utilis* strain DBN-JM80 (CGMCC NO: 33529) was activated in YPD liquid medium and then inoculated at a rate of 5% (v / v) into 250 mL Erlenmeyer flasks containing 50 mL of YPD liquid medium. The flasks were placed in a shaker and cultured at 180 rpm for 24 hours at constant temperatures of 25°C, 30°C, 35°C, and 40°C. Uninoculated YPD medium was used as a blank control. The optical density (OD) of the culture medium was measured at 600 nm using a microplate reader. 600 The value is used to evaluate bacterial biomass.

[0070] The results are as follows Figure 2 As shown, strain DBN-JM80 exhibited good growth ability within a temperature range of 25℃ to 40℃. At 25℃ and 30℃, the bacterial biomass (OD) was [data missing]. 600 The value reached its highest, indicating that its optimal growth temperature range is 25℃-30℃. This wide growth temperature range demonstrates its strong adaptability to temperature fluctuations that may occur in industrial production.

[0071] 2.2 pH tolerance test

[0072] Multiple groups of YPD liquid culture media were prepared, and the initial pH of each group was precisely adjusted to 3.5, 4.0, 4.5, 5.0, 5.5, and 6.0 using 1M HCl or 1M NaOH, respectively. Strain DBN-JM80 was inoculated at a rate of 5% and cultured at 30℃ and 180 rpm for 24 hours. The OD was then measured. 600 value.

[0073] The results are as follows Figure 3 As shown, the growth of strain DBN-JM80 was not significantly affected within an initial pH range of 3.5 to 6.0, and the OD... 600The values ​​all reached high levels. This indicates that the strain has a wide pH tolerance range, and especially exhibits excellent growth stability in the acidic environment commonly found in industrial fermentation, without the need for overly strict and precise pH control.

[0074] 2.3 Ammonium sulfate tolerance test

[0075] To verify the tolerance and application potential of the strain DBN-JM80 of this invention under high concentration of inorganic nitrogen source environment, and to highlight its advantages over other industrial yeasts, this comparative experiment was conducted.

[0076] (1) Experimental Design

[0077] The strain of this invention is Candida utilis DBN-JM80.

[0078] Control strain:

[0079] Comparison 1: Saccharomyces cerevisiae (code AQJM), a widely used industrial brewing yeast.

[0080] Control 2: Saccharomyces cerevisiae (number JM03), another strain of Saccharomyces cerevisiae preserved in the laboratory.

[0081] Control 3: Zygosaccharomyces rouxii (TBJM), a known yeast with high sugar and salt tolerance.

[0082] Culture conditions: YPD-based liquid medium was used, with ammonium sulfate added to each medium, and the final concentration gradients were set to 0%, 5%, 10%, 15%, and 20%. After activation, the four yeast strains were inoculated into each medium at a rate of 5% (v / v) and cultured at 30°C and 180 rpm for 48 hours.

[0083] Testing indicators:

[0084] The optical density (OD) of the culture medium was measured at a wavelength of 600 nm using an ELISA reader. 600 ( ) to evaluate bacterial biomass.

[0085] The change in ammonia nitrogen concentration in the culture medium before and after culture was determined by Nessler's reagent spectrophotometry, and the ammonia nitrogen utilization rate was calculated.

[0086] Ammonia nitrogen utilization rate = (Total ammonia nitrogen content in the culture medium before culture - Residual ammonia nitrogen content in the fermentation broth after culture) / Total ammonia nitrogen content in the culture medium before culture × 100%

[0087] (2) Experimental Results

[0088] Growth advantages under high ammonium stress:

[0089] As attached Figure 4 As shown, after culturing for 24 hours under harsh conditions containing 10% ammonium sulfate, the OD of the strain DBN-JM80 of this invention... 600 The value was the highest, significantly superior to all control strains AQJM, JM03, and TBJM. This result intuitively demonstrates that under high concentrations of ammonium salt stress, DBN-JM80's growth rate and environmental adaptability far exceed those of conventional Saccharomyces cerevisiae and the well-known tolerant Zygosaccharomyces rouxii.

[0090] Determination of the tolerance concentration limit:

[0091] The tolerance of the strain of this invention was determined by an ammonium sulfate concentration gradient experiment, and the results are shown in the appendix. Figure 5 At an ammonium sulfate mass fraction of 15%, the OD of DBN-JM80 is... 600 The value was 1.004, approximately the same as the control group without additives (0% concentration, OD). 600 =2.021) 49.7%, indicating that the strain can still maintain effective growth under this high-salt environment. When the concentration is increased to 20%, the OD of DBN-JM80 is 49.7%. 600 The growth rate was significantly inhibited when the concentration of ammonium sulfate dropped to 0.613 (relative growth rate of only 30.3%). Therefore, the effective tolerance limit of the strain of this invention was determined to be 15%. Compared to conventional non-genetically modified yeasts (whose ammonium sulfate tolerance limit is typically 8%-10%), the strain DBN-JM80 of this invention still exhibits a significant growth advantage in extremely high ammonium salt environments, demonstrating significantly superior tolerance compared to existing technologies.

[0092] Nitrogen source utilization capacity under high ammonium environment:

[0093] As attached Figure 6 As shown, the test results for ammonia nitrogen utilization are key evidence of the industrial value of this strain. Under culture conditions with an ammonium sulfate content as high as 15%, after 48 hours of cultivation, strain DBN-JM80 still achieved a 23.0% utilization rate of ammonia nitrogen. This indicates that DBN-JM80 is not merely passively "tolerant" to high osmotic pressure, but can actively and effectively assimilate and utilize inorganic nitrogen sources to synthesize its own cellular substances (such as proteins) under high ammonium stress. This ability to maintain key physiological metabolic functions under high pressure is a significant advantage for it as an industrial production strain.

[0094] (3) Experimental Conclusions

[0095] Based on the comparative experimental results above, it can be concluded that the *Candida utilis* strain DBN-JM80 of this invention exhibits significantly better ammonium sulfate tolerance than conventional industrial yeasts. It not only maintains growth at ammonium sulfate concentrations as high as 15%, but more importantly, it retains its ability to assimilate and utilize ammonia nitrogen even under these extreme conditions. This characteristic makes DBN-JM80 a promising candidate for applications utilizing high-concentration ammonium-containing industrial byproducts as nitrogen sources, or in high-density fermentation processes requiring fed-batch nitrogen sources.

[0096] Example 3: Fermentation performance testing and process optimization of strain DBN-JM80

[0097] This embodiment aims to systematically evaluate the production performance of the present invention's Candida utilis DBN-JM80 and determine its optimal fermentation process parameters in shake flasks through a series of optimization experiments.

[0098] 3.1 Determination of key culture medium components

[0099] To determine the optimal culture medium composition for efficient protein production by strain DBN-JM80, the concentrations of carbon source, nitrogen source, and inorganic salts were investigated.

[0100] Carbon source (molasses) concentration: Tests were conducted within an initial reducing sugar concentration range of 20-150 g / L. The results showed that the optimal balance between crude protein content and yield was achieved when the initial reducing sugar concentration was around 50 g / L. Under these conditions, the crude protein content of strain DBN-JM80 by dry weight could reach over 54%.

[0101] Nitrogen source (ammonium sulfate) concentration: Tests were conducted within the range of 5-25 g / L ammonium sulfate concentration. The results showed that yeast biomass and protein content reached their maximum values ​​at 5 g / L.

[0102] Inorganic salts: Experiments have shown that when molasses is used as the main raw material, no additional magnesium salts (such as magnesium sulfate) need to be added to the culture medium to meet the growth requirements of the strain.

[0103] 3.2 Optimization of fermentation process parameters (orthogonal experiment and response surface methodology)

[0104] First, a Taguchi orthogonal experimental design was used to optimize four key process parameters: inoculum size, culture temperature, initial pH, and culture time. Using crude protein yield as the evaluation index, the order of importance of each factor affecting yield and the optimal combination range were determined through analysis of the experimental results.

[0105] Based on this, to accurately determine the optimal culture medium formulation, the Box-Behnken response surface methodology (BBD) was used to further optimize the three core components: molasses reducing sugar concentration (A), ammonium sulfate concentration (B), and potassium dihydrogen phosphate concentration (C). The results are shown in Table 3. Through variance analysis and regression fitting of 15 sets of experimental data, a quadratic polynomial regression model for crude protein yield was established. The model showed extremely significant regression results (P<0.001), no significant lack of fit (P>0.05), and a high coefficient of determination (R²) of 0.9965, indicating that the model can accurately predict fermentation results.

[0106] Table 3. Fermentation results using the Response Surface Method (BBD) method.

[0107] Run sequence Molasses reducing sugar concentration (g / L) ammonium sulfate g / L Potassium dihydrogen phosphate g / L dry weight g / L Crude protein content % Crude protein yield (g / L) 1 75 10 5 12.03 54.73 6.58 2 75 4 15 12.73 50.85 6.48 3 50 4 10 14.35 54.72 7.85 4 75 7 10 12.43 51.43 6.39 5 100 10 10 7.80 32.69 2.55 6 100 4 10 8.62 32.27 2.78 7 100 7 5 7.91 35.21 2.79 8 50 7 5 14.14 54.34 7.68 9 75 4 5 12.98 52.44 6.80 10 50 10 10 12.98 54.76 7.11 11 50 7 15 13.37 53.13 7.10 12 75 7 10 11.96 53.06 6.35 13 75 7 10 12.78 51.95 6.64 14 75 10 15 11.54 52.23 6.03 15 100 7 15 8.02 32.23 2.58

[0108] The model predicted the optimal fermentation medium formulation as follows: molasses reducing sugar concentration 51.5 g / L, ammonium sulfate 4 g / L, and potassium dihydrogen phosphate 5 g / L. Validation showed that under these medium conditions, the cell dry weight was 14.56 g / L, the crude protein content on a dry basis was as high as 55.6%, and the final crude protein yield reached 8.66 g / L. These results highly agree with the model predictions and demonstrate higher production performance, proving the effectiveness and reliability of the optimization scheme.

[0109] Example 4: Small-scale fermentation of strain DBN-JM80

[0110] This embodiment aims to verify the production performance of strain DBN-JM80 on a small-scale trial.

[0111] 4.1 30L small-scale fermentation

[0112] A small-scale fermentation test was conducted in a 30L fermenter.

[0113] Seed activation: The strain DBN-JM80 was cultured in YPD medium at 28℃ and 200 rpm for 16-18 hours.

[0114] Optimized fermentation medium: molasses (calculated as reducing sugar) 50 g / L, ammonium sulfate 4 g / L, potassium dihydrogen phosphate 5 g / L.

[0115] Fermentation process: 10% of the seed culture was inoculated into a 30L fermenter, with a total liquid volume of 15L. The fermentation temperature was controlled at 28℃. During fermentation, the dissolved oxygen (DO) was maintained above 30% by adjusting the stirring speed, aeration rate, and tank pressure. The total fermentation cycle was 24 hours.

[0116] 4.2 Preparation of live yeast powder

[0117] After fermentation, the fermentation broth (30L) was collected by centrifugation to gather the microbial cells. The obtained wet microbial slurry was then mixed with a 15-20% (w / w) compound freeze-drying protectant (composed of sucrose, skim milk powder, and monosodium glutamate in a specific ratio). The mixture was poured into trays and pre-frozen at -80℃. Subsequently, a vacuum freeze dryer was used to prepare live yeast freeze-dried powder with a viable cell count of 1.0 × 10⁻⁶ cells / day. 10 CFU / g.

[0118] Example 5: Preparation of single-cell protein feed using strain DBN-JM80

[0119] 5.1 High-density fermentation in a 100L fermenter

[0120] To ultimately verify the actual production performance of strain DBN-JM80 under industrial conditions, a fed-batch fermentation experiment was conducted in a 100L industrial fermenter.

[0121] Seed activation: The strain DBN-JM80 was cultured in YPD medium at 28℃ and 200 rpm for 16-18 hours.

[0122] Basic culture medium: molasses initial reducing sugar 20 g / L, ammonium sulfate 4 g / L, potassium dihydrogen phosphate 5 g / L.

[0123] Feeding medium: molasses solution with a reducing sugar concentration of 20% (w / v).

[0124] Fermentation Process: A 10% inoculum of seed culture was inoculated into a 100L fermenter, with an initial volume of 40L. The fermentation temperature was controlled at 28℃. During fermentation, the dissolved oxygen (DO) in the fermentation broth was maintained above 30% by adjusting the stirring speed, aeration rate, and tank pressure. After approximately 6-10 hours of fermentation, when the initial reducing sugar concentration in the fermentation broth dropped below 2 g / L and the dissolved oxygen (DO) showed a significant rebound, the automatic feeding system was activated to continuously or intermittently add feed medium, maintaining the total reducing sugar concentration in the fermentation broth at 0.5-5 g / L. The total fermentation cycle was 24 hours.

[0125] After fermentation, the volume of the fermentation liquid was approximately 50 L, and the wet weight of the cells was measured to be approximately 250 g / L.

[0126] 5.2 Post-processing and product preparation

[0127] (1) Bacterial cell isolation and washing:

[0128] After fermentation, the fermentation broth was separated into solid and liquid components using a high-speed centrifuge, and the resulting wet mycelial sludge was collected. To remove culture medium residues and metabolic byproducts, the wet mycelial sludge was washed 1-2 times with pure water and then centrifuged again until the washing liquid was clear.

[0129] (2) Drying:

[0130] The bacterial slurry is pumped into a pressure spray drying tower for drying. The inlet air temperature is set to 180-220℃, and the outlet air temperature is set to 80-95℃. After the bacterial slurry is atomized at high speed by the atomizer, it comes into full contact with the hot air, and the moisture evaporates rapidly. A free-flowing, light yellow to yellowish-brown powder is collected at the bottom of the drying tower.

[0131] (3) Product packaging:

[0132] The collected yeast powder was sieved, then vacuum-packed in moisture-proof composite bags and stored in a cool, dry place. This yielded approximately 3.4 kg of finished single-cell protein feed ingredients.

[0133] 5.3 Product Quality Analysis

[0134] The final obtained single-cell protein feed powder was sampled, and key indicators were tested according to relevant national standards (such as GB / T series standards). The results are shown in Table 4.

[0135] Table 4. Quality Analysis of Yeast Powder Products

[0136] Testing items Test results unit Detection methods crude protein content 51.6 % (dry basis) Kjeldahl method for nitrogen determination (GB / T 6432) Coarse ash 11.0 % (dry basis) Muffle furnace ashing method (GB / T 6438) Moisture 6.29 % Oven drying method (GB / T 6435) Heavy metals (lead / arsenic) < 5.0 / < 2.0 mg / kg Atomic absorption / atomic fluorescence Appearance and smell It is a light yellowish-brown powder with a characteristic fermented aroma of yeast and no off-odors. - Sensory evaluation

[0137] The amino acid composition of the hydrolyzed product was analyzed, and the detailed results are shown in Table 5.

[0138] Table 5. Amino acid composition analysis of bacterial powder from strain DBN-JM80

[0139] Amino acid name percentage of dry basis content in the sample (%) Percentage of crude protein content (g / 100g protein) Aspartic acid (Asp) 4.75 9.21 Threonine (Thr) 2.79 5.41 Serine 2.63 5.10 Glutamic acid (Glu) 6.43 12.46 Proline (Pro) 1.78 3.45 Glycine (Gly) 2.20 4.26 Alanine (Ala) 2.86 5.54 Valine 3.03 5.87 Isoleucine (Ile) 2.62 5.08 Leucine (Leu) 3.90 7.56 Tyrosine (Tyr) 1.75 3.39 Phenylalanine (Phe) 2.38 4.61 Histidine (His) 0.97 1.88 Lysine (Lys) 3.11 6.03 Arginine (Arg) 2.32 4.50 Methionine (Met) 0.78 1.52 Total amino acids 44.30 85.86

[0140] Conclusion: This example successfully demonstrates the entire process from 100L industrial-scale fermentation of strain DBN-JM80 to the final preparation of commercial single-cell protein feed ingredients. The final product has a crude protein content of 51.6%, is a light yellow powder, free of lumps, has a characteristic yeast aroma, and good flowability.

[0141] Amino acid composition results indicate that the protein produced by this strain possesses excellent quality characteristics. Lysine (6.03 g / 100g protein), a key indicator for evaluating protein quality, is close to the level of high-grade fishmeal. Simultaneously, the protein is also rich in glutamic acid and aspartic acid, which impart umami flavor, demonstrating that the protein produced by this strain possesses both high nutritional value and excellent palatability.

[0142] Comprehensive performance comparison analysis

[0143] To further elucidate the superior performance and commercial value of the single-cell protein (SCP) produced by the strain DBN-JM80 of this invention as a feed ingredient, its key nutritional indicators were compared with the biomimetic digestibility of two of the most important protein ingredients in the industry—fish meal and soybean meal. The results are shown in Table 6.

[0144] Table 6. Comparison of the nutritional value and digestibility of the yeast protein of this invention with mainstream protein raw materials.

[0145] Testing items The yeast protein of this invention (DBN-JM80) A certain brand of fish meal Soybean meal standard Crude protein on dry basis (CP, %) 51.6 71.3 43.3 Lysine (as a percentage of protein, g / 100g CP) 6.03 7.50 6.32 Methionine (as a percentage of protein, g / 100g CP) 1.52 2.81 1.44 Protein digestibility (%) 90.0 92.6 93.8 Energy (cal / g) 4682.3 4454.1 4196.0 Dry matter digestibility (%) 73.9 84.6 76.9 Energy digestibility (%) 72.3 84.7 78.2 Energy value of enzyme hydrolysate (cal / g) 3544.7 4210.1 3681.4 Anti-nutritional factors None or extremely low none Contains antigenic proteins, trypsin inhibitors, phytic acid, etc.

[0146] Comparative analysis conclusions:

[0147] The data in Table 6, through comparison with two industry benchmark protein raw materials, clearly reveal the nutritional characteristics and application value of the single-cell protein (SCP) produced by the strain DBN-JM80 of this invention.

[0148] 1. Overall advantages compared to soybean meal:

[0149] Compared with soybean meal standards, the yeast protein of this invention exhibits significant comprehensive application advantages.

[0150] Higher concentration of nutrients: This product has significantly higher dry-basis crude protein content (51.6%) and energy value (4682.3 cal / g) than soybean meal. More importantly, in terms of limiting amino acids, its methionine content is also superior to soybean meal, which means that this product has higher nutritional value in feed formulations that meet the amino acid requirements of animals.

[0151] Excellent biocompatibility: A key difference is that the yeast protein of this invention does not contain anti-nutritional factors such as antigenic proteins and trypsin inhibitors, which are commonly found in soybean meal and can affect the intestinal health and nutrient absorption of young animals.

[0152] In summary, the yeast protein of this invention provides the feed industry with a protein raw material that is more nutritious, higher in energy, and far more biocompatible than soybean meal. It is a more ideal choice than soybean meal in the fields of young livestock and aquatic feed, where the safety and low allergenicity requirements of raw materials are stringent.

[0153] 2. Analysis of characteristics and positioning relative to fishmeal:

[0154] Compared with a certain brand of fishmeal, the yeast protein of this invention shows a high degree of comparability in core nutritional indicators.

[0155] Comparable levels of core amino acids: The lysine content of this product (6.03g / 100g of protein) is close to that of high-quality fishmeal (7.50g / 100g), which proves its core value as a high-quality protein source.

[0156] The protein digestibility is similar: its apparent protein digestibility of 90.0% is in the same range as that of fishmeal (92.6%), indicating that the two have similar high-efficiency absorption characteristics.

[0157] Sustainability and Cost-Effectiveness: Fishmeal, a marine catch resource, is expensive, has an unstable supply, and faces challenges to resource sustainability. This invention utilizes industrial fermentation technology to produce fishmeal from renewable, low-cost industrial and agricultural byproducts, providing a solution with stable supply, controllable quality, and significant cost-effectiveness.

[0158] Therefore, the yeast protein of this invention, with its core nutritional value highly comparable to fishmeal, as well as its inherent advantages in production cost and supply stability, makes it an ideal choice to partially or completely replace fishmeal in aquatic feed and piglet feed, thereby optimizing formulation costs and ensuring supply chain security.

[0159] Through the above technical solutions, the present invention demonstrates beneficial technical effects in terms of strain performance, process economy, and product application scope, and possesses clear novelty, inventiveness, and industrial application value.

Claims

1. A strain of Candida utilis, characterized in that, Its accession number is CGMCC NO:33529.

2. The Candida utilis according to claim 1, characterized in that, Its ITS sequence is shown in SEQ ID NO.

1.

3. The Candida utilis according to claim 1 or 2, characterized in that, The *Candida utilis* has at least one of the following characteristics: (a) When cultured in a medium with molasses as the main carbon source, its utilization rate of reducing sugars is not less than 80%; (b) When cultured in a medium with straw sugar as the main carbon source, its xylose utilization rate is not less than 70%; (c) When cultured in a medium containing 15% (w / v) ammonium sulfate, the utilization rate of ammonia nitrogen is not less than 23.0%.

4. A microbial preparation containing the Candida utilis as described in claim 1 or 2.

5. The use of the Candida utilis according to claim 1 or 2 in the preparation of single-cell proteins.

6. The use of the Candida utilis according to claim 1 or 2 or the microbial preparation according to claim 4 in the preparation of feed or feed additives.

7. A method for preparing single-cell proteins, characterized in that, The method includes the steps of culturing the Candida utilis of claim 1 or 2 or the microbial preparation of claim 4 in a culture medium, collecting the fermentation product, and collecting the cell bodies from the fermentation product.

8. The method according to claim 7, characterized in that, The crude protein content of the dried bacterial cells is not less than 50%.

9. A fermentation method for Candida utilis according to claim 1 or 2, characterized in that, Inoculate 5-15% of the *Candida utilis* seed culture into the fermentation medium. Control the fermentation temperature at 25-32°C and maintain dissolved oxygen at above 30%. After 6-10 hours of fermentation, add feed medium continuously or intermittently according to the changes in reducing sugar concentration or dissolved oxygen level in the fermentation broth to maintain the total reducing sugar concentration in the fermentation broth at 0.5-5 g / L, preferably 1-2 g / L. The total fermentation cycle is 24 hours.

10. The fermentation method according to claim 9, characterized in that, The fermentation medium formula is as follows: molasses (calculated as reducing sugar) 20~100 g / L, ammonium sulfate 4~15 g / L, potassium dihydrogen phosphate 5~10 g / L.

11. The fermentation method according to claim 10, characterized in that, The fermentation medium formula is: molasses (calculated as reducing sugar) 50 g / L, ammonium sulfate 4 g / L, potassium dihydrogen phosphate 5 g / L.

12. The fermentation method according to claim 9, characterized in that, The feeding medium is a molasses aqueous solution with a reducing sugar concentration of 20% w / v.