A kit for efficiently knocking out TRIM21 gene and application thereof in reversing NDV oncolytic virus drug resistance

By designing an efficient shRNA that knocks out the TRIM21 gene and transfecting it into cells using a lentiviral vector, the problem of limited therapeutic efficacy of NDV oncolytic virus in tumors such as gliomas was solved, significantly improving viral expression and therapeutic effect in tumor cells.

CN122146698APending Publication Date: 2026-06-05THE FIFTH AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIV +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
THE FIFTH AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIV
Filing Date
2026-02-06
Publication Date
2026-06-05

Smart Images

  • Figure CN122146698A_ABST
    Figure CN122146698A_ABST
Patent Text Reader

Abstract

The application discloses a kit for efficiently knocking out a TRIM21 gene and application of the kit in reversing NDV oncolytic virus drug resistance. It is found through bioinformatics analysis and previous experimental verification that the expression level of the TRIM21 gene is related to the virus immunity of tumor cells, in order to improve the treatment effect of oncolytic virus anticancer treatment, several groups of shRNA are designed to specifically knock down TRIM21, and the knocking down effect is verified, and the experimental results show that after the TRIM21 is knocked down, the expression level of the NDV oncolytic virus in the glioma cells is significantly improved, and the highest reaches 3 times, which proves that the strategy has a significant effect on improving the treatment effect of oncolytic treatment, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, and in particular to a kit for efficiently knocking out the TRIM21 gene and its application in reversing NDV oncolytic virus resistance. Background Technology

[0002] Newcastle disease virus (NDV) is a single-stranded RNA virus that primarily infects birds, belonging to the Paramyxoviridae family. It is highly infectious and pathogenic in birds, causing respiratory, digestive, and neurological symptoms, making it a significant target for livestock disease prevention. Notably, this virus is largely non-pathogenic to humans or causes only mild conjunctivitis, thus it is considered a relatively safe viral vector. In biomedical research, NDV has been developed as a potential oncolytic virus due to its ability to selectively replicate within cancer cells and cause cell lysis.

[0003] Oncolytic virus therapy is an innovative treatment that uses modified or screened viruses to fight cancer. Its core principle lies in utilizing the selective replication ability of viruses: after being delivered to the tumor site, the virus specifically infects and replicates extensively within cancer cells, ultimately destroying these cells through direct lysis. More importantly, this process releases tumor antigens and the virus itself as "danger signals," strongly activating the body's innate and adaptive immune systems. This not only eliminates cancer cells directly infected by the virus but may also trigger a systemic immune attack on distant, uninfected tumor cells, achieving an "in situ vaccine" effect.

[0004] Gliomas are primary central nervous system tumors originating from glial cells in the brain and spinal cord, and are the most common intracranial malignant tumors. According to the World Health Organization's classification system, gliomas are divided into grades I to IV, with higher grades indicating greater malignancy and invasiveness. Grade IV glioblastomas have an extremely poor prognosis. Treatment faces significant challenges, primarily because the tumors grow invasively and have indistinct boundaries with normal brain tissue, making complete surgical resection difficult. Simultaneously, the blood-brain barrier severely hinders the effective entry of most drugs and immune cells, limiting the effectiveness of traditional radiotherapy, chemotherapy, and emerging therapies, and leading to a high recurrence rate. Therefore, developing novel treatment strategies that can overcome these physiological barriers is an urgent need in this field. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings and deficiencies of the prior art and provide a kit for efficiently knocking out the TRIM21 gene.

[0006] Another objective of this invention is to provide the application of the above-mentioned kit for efficiently knocking out the TRIM21 gene in reversing NDV oncolytic virus resistance.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] A highly efficient shRNA for knocking out the TRIM21 gene, comprising at least one of the following:

[0009] The nucleotide sequence of the positive strand of shTRIM21-1 is as follows:

[0010] CACCGTCATCTCAGAGCTAGATCGA,

[0011] The antisense strand nucleotide sequence is as follows:

[0012] AAACTCGATCTAGCTCTGAGATGAC;

[0013] The nucleotide sequence of the positive strand of shTRIM21-2 is as follows:

[0014] CACCGTCAGTTCCCCTAATGCCACC,

[0015] The antisense strand nucleotide sequence is as follows:

[0016] AAACGGTGGCATTAGGGGAACTGAC;

[0017] The nucleotide sequence of the positive strand of shTRIM21-3 is as follows:

[0018] CACCGAGCCTGTGAGCATCGAGTG,

[0019] The antisense strand nucleotide sequence is as follows:

[0020] AAACCACTCGATGCTCACAGGCTC;

[0021] Analogs of shTRIM21-1, shTRIM21-2, and shTRIM21-3 that still retain the function of inhibiting TRIM21 gene expression, obtained through base insertion, deletion, or substitution.

[0022] The highly efficient TRIM21 gene knockout shRNA is ligated into a vector, packaged with lentivirus, and transfected into cells. It can knock out some bases on the TRIM21 gene, resulting in the inability to form normal TRIM21 protein through frameshift mutation.

[0023] A vector for efficiently knocking out the TRIM21 gene, comprising the aforementioned shRNA for efficiently knocking out the TRIM21 gene.

[0024] The vector backbone is the lentiCRISPR v2 plasmid.

[0025] A kit for efficiently knocking out the TRIM21 gene, comprising the aforementioned vector for efficiently knocking out the TRIM21 gene.

[0026] A tumor treatment drug comprising the aforementioned kit for highly efficient TRIM21 gene knockout.

[0027] The aforementioned cancer treatment drugs also include NDV virus.

[0028] The kit for efficiently knocking out the TRIM21 gene also includes reagents for transducing the vector for efficiently knocking out the TRIM21 gene into cells.

[0029] The reagent is a lentiviral packaging system; preferably, it includes lentiviral auxiliary packaging plasmids psPAX2 and pMD2.G.

[0030] The application of the highly efficient TRIM21 gene knockout shRNA, the highly efficient TRIM21 gene knockout vector, and / or the highly efficient TRIM21 gene knockout kit in the preparation of antitumor drugs.

[0031] The application of the highly efficient TRIM21 gene knockout shRNA, the highly efficient TRIM21 gene knockout vector, and / or the highly efficient TRIM21 gene knockout kit in reversing NDV oncolytic virus resistance.

[0032] The application of the highly efficient TRIM21 gene knockout shRNA, the highly efficient TRIM21 gene knockout vector, and / or the highly efficient TRIM21 gene knockout kit in the preparation of oncolytic therapy enhancement drugs.

[0033] Application of TRIM21 gene in regulating tumor sensitivity to oncolytic therapy.

[0034] The expression level of the TRIM21 gene is negatively correlated with the sensitivity of tumors to oncolytic therapy. By knocking out the TRIM21 gene, the efficacy of oncolytic therapy can be improved and the resistance of tumor cells to oncolytic therapy can be reduced.

[0035] A biomarker for screening the sensitivity of tumors to oncolytic therapy includes the TRIM21 gene.

[0036] The expression level of the TRIM21 gene is negatively correlated with the sensitivity of tumors to oncolytic therapy.

[0037] A kit for screening the sensitivity of tumors to oncolytic therapy, including reagents for detecting TRIM21 gene expression levels.

[0038] The kit for screening tumor sensitivity to oncolytic therapy indicates that high expression of the TRIM21 gene suggests that the tumor is not sensitive to oncolytic therapy.

[0039] The NCBI database accession number for the TRIM21 gene is NM_003141.4, and the update time is 28-APR-2025.

[0040] The oncolytic therapy described herein is performed using the NDV virus.

[0041] The tumor in question is glioblastoma and / or esophageal cancer.

[0042] The NDV virus mentioned is the La Sota strain.

[0043] The present invention has the following advantages and effects compared with the prior art:

[0044] This invention, through bioinformatics analysis and preliminary experimental verification, discovered a correlation between the expression level of the TRIM21 gene and the viral immunity of tumor cells. To improve the therapeutic effect of oncolytic virus anticancer therapy, this invention designed several shRNAs to specifically knock down TRIM21 and verified the knockdown effect. Experimental results showed that after knocking down TRIM21, the expression level of NDV oncolytic virus in glioma cells was significantly increased, reaching up to 3-fold, demonstrating that this strategy has a significant effect on improving the therapeutic effect of oncolytic therapy and has broad application prospects. Attached Figure Description

[0045] Figure 1 This is a comparison of TRIM21 expression levels in glioma and control normal tissues.

[0046] Figure 2 This is a graph showing the analysis results of the relationship between the survival time of glioma patients and the level of TRIM21 expression.

[0047] Figure 3 This is a graph showing the results of TRIM21-related analysis. A) Transcriptome heatmap comparing gene transcription differences in Control, Virus, PI, and PI_Virus; B) Transcriptome Venn diagram showing transcriptional differences between different cell groups; C) qRT-PCR detection of two genes highly expressed in EC9706-PI and two genes low expressed in EC9706 cells compared to the control, with β-actin as the internal control; D) Cluster analysis of signaling pathways for differentially expressed genes in EC9706-PI and EC9706 cells; E) Transcriptional levels of TRIM21 in the two cell types; F) qRT-PCR detection of differences in TRIM21 levels between the two cell groups, with β-actin as the internal control; G) Western blot detection of differences in TRIM21 levels between EC9706-PI and EC9706 cells.

[0048] Figure 4 This is a graph showing the results of Western blot analysis of the TRIM21 knockout effect in HepG2 cells in Example 2.

[0049] Figure 5 This is a graph showing the effect of qPCR detection on NDV replication after TRIM21 knockout in Example 3.

[0050] Figure 6 This is a plasmid map of the lentiCRISPR v2 plasmid. Detailed Implementation

[0051] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0052] Unless otherwise specified in the following implementation plan, the test conditions are generally as per standard test conditions or the test conditions recommended by the reagent company. Unless otherwise specified, all materials and reagents used are commercially available.

[0053] Example 1: Bioinformatics Analysis of TRIM21 in Tumors

[0054] TRIM21 is a potential therapeutic target for tumors. Bioinformatics analysis revealed high expression of TRIM21 in gliomas, and a negative correlation with patient survival. Gene comparison using the GEPIA bioinformatics website showed that the expression of this gene in gliomas was significantly higher than in control normal tissues. Figure 1 As shown in the figure, the survival curves for patients with two types of glioma (low / high TRIM21) show that patients with high TRIM21 expression levels have significantly shorter survival times. Figure 2 As shown.

[0055] In previous experiments, we induced cancer cells into persistently infected, antiviral cells (the induction method for antiviral cells was based on Chinese invention patent CN202110869932.X, using EC9706 cells). To understand the transcriptional changes that occur when cancer cells transform into persistently infected, antiviral cells, two groups of cells were infected with 1 MOI of NDV. Transcriptome sequencing was performed on both groups, along with uninfected control cells. The four groups were named Control (EC9706), Virus, PI (EC9706-PI, antiviral cells), and PI_Virus. Transcriptome heatmap results showed that gene transcription in Control and PI cells changed, and infection of these two cell types with NDV also revealed different gene changes. Figure 3(Figure A) This suggests that the reason why PI cells are able to resist viruses is that the transcription of the cells has undergone relatively stable changes. The Venn diagram of gene transcription also shows that the transcription of cancer cells and PI cells has undergone transcriptional changes (Figure B).

[0056] Transcriptome sequencing revealed that Rab35 and MSI2 gene transcription was downregulated in PI cells, while NTMT1 and ATF2 gene transcription was upregulated in EC9706-PI cells. To verify the reliability of the sequencing results, quantitative primers for these four genes were designed. qRT-PCR results showed trends consistent with the transcriptome sequencing results. Figure 3 The presence of C in the sequence indicates that the sequencing results are reliable. Cluster analysis of genes with altered transcriptional PI relative to cancer cells revealed enrichment of multiple viral replication-related signaling pathways. Figure 3 (Figure 3, D) suggests that the antiviral response in EC9706-PI cells is based on gene transcription. In the sequencing results, the expression level of TRIM21 changed from 8.17±0.32 in cancer cells to 161.45±10.86 in PI cells, an increase of about 20-fold, which is extremely significant (Figure 3, E).

[0057] To verify the reliability of the TRIM21 expression sequencing results, the expression level of TRIM21 in two cell types was detected by qRT-PCR, with β-actin as an internal control. The results showed that the expression level of TRIM21 in antiviral PI cells was significantly higher than that in the control group, and the difference was statistically significant. Figure 3 To verify the changes in TRIM21 protein content, Western blot was used to detect the protein content in the two groups, with β-actin as an internal control. The results showed that the TRIM21 content in antiviral EC9706-PI cells was significantly increased (F). Figure 3 (G). The above results show that after cancer cells acquire antiviral capabilities, TRIM21 transcription is activated, and the intracellular TRIM21 protein content increases significantly.

[0058] The above results demonstrate that the expression level of TRIM21 is significantly increased in antiviral cells, proving that this gene may be associated with the efficacy of antiviral therapy.

[0059] Example 2: Design and transfection of sgRNA

[0060] 2.1 Design of sgRNA

[0061] To improve the efficacy of oncolytic therapy for gliomas, several sgRNAs were designed based on the TRIM21 target identified in previous screening. These sgRNAs are shTRIM21-1, shTRIM21-2, and shTRIM21-2, with the specific sequences as follows:

[0062] shTRIM21-1-F: CACCGTCATCTCAGAGCTAGATCGA;

[0063] shTRIM21-1-R: AAACTCGATCTAGCTCTGAGATGAC;

[0064] shTRIM21-2-F: CACCGTCAGTTCCCCTAATGCCACC;

[0065] shTRIM21-2-R:AAACGGTGGCATTAGGGGAACTGAC;

[0066] shTRIM21-3-F: CACCGAGCCTGTGAGCATCGAGTG;

[0067] shTRIM21-3-R: AAACCACTCGATGCTCACAGGCTC.

[0068] 2.2 Construction of Interference Carrier

[0069] After synthesizing the above sgRNA sequences, they were combined and paired separately. The three groups of Oligo sequences were mixed at a final concentration of 10 nM for each component. After mixing, the mixture was heated in a 95-degree metal bath for 5 min, then the metal bath was turned off and the mixture was left to stand for 2 h. The hybridization of the upstream and downstream sequences was then completed.

[0070] The lentiCRISPR v2 plasmid was digested with BsmBI restriction endonuclease and reacted in a 55°C water bath for 2 hours. After adding 6× DNA loarding buffer, DNA electrophoresis was performed, and the target band on the upper side of the lane was cut off on a gel cutter for gel recovery.

[0071] The recovered DNA and hybridized Oligo were ligated according to the following system: 5 μL of DNA recovered by BsmBI digestion, 2 μL of hybridized Oligo, 2 μL of T4 ligase, and 1 μL of T4 Buffer.

[0072] The above system was ligated overnight at 4°C and then transformed into stbl3 competent cells. The next day, bacteria were picked and plasmids were extracted for verification, thus obtaining the interference vector. The interference vector with correct sequencing was used for subsequent lentivirus packaging.

[0073] 2.3 Lentiviral Packaging

[0074] The interference vector obtained in 2.2 and two lentiviral packaging helper plasmids psPAX2 and pMD2.G were transfected into 293T cells at a ratio of 2:1:1. After 48 hours, the cell supernatant was collected to obtain the packaged lentiviral cell supernatant.

[0075] 2.4 Lentiviral transfection

[0076] LN-18 cells were cultured in 6-well plates. When the cell density reached 50-70%, the cells were infected with the lentiviral cell supernatant obtained in section 2.3. 5 μg / mL polybrene was added to assist in the viral transduction process. After 6 hours of infection, the medium was replaced with fresh medium. After 48 hours of infection, 10 μg / mL puromycin was added to begin selection. The surviving cells were identified as TRIM21 knockout cells, which were then propagated and used in subsequent processes.

[0077] Western blot analysis revealed that several sequences showed significant knockout of TRIM21, achieving nearly 100% knockout. Figure 4 ).

[0078] Example 3: Validation of the efficacy of oncolytic NDV inoculation

[0079] 3.1 Cell Culture and Inoculation

[0080] The LN-18 cells with TRIM21 knocked out and the LN-18 cells without TRIM21 knocked out obtained in Example 2 were seeded into cell culture plates, respectively. The next day, they were infected with NDV (La Sota strain) at a dose of 1 MOI, and the cell RNA was collected 24 hours after infection.

[0081] 3.2 Detection of viral replication level

[0082] M gene mRNA was detected by reverse transcription using OligdT from the kit, and NDV genomic RNA was detected by reverse transcription using NDV-specific primers. The expression levels of different RNAs were detected by q-PCR. The specific primers used are as follows:

[0083] NDV-specific primers: AGGGTTCCCGTTCATTCAG;

[0084] NDV-MF: AAGAAGCAAATCGCCCC;

[0085] NDV-MR: ACGCTTCCTAGGCAGAG.

[0086] 3.3 Experimental Results

[0087] To verify the effect of TRIM21 knockout cells on NDV replication, control group cells and TRIM21 knockout cells were inoculated with 1 MOI of virus. Total RNA was collected after 36 h, and reverse transcription was performed using Oligo dT primers and NDV-specific primers, respectively. Oligo dT primers were used to detect viral mRNA, while NDV-specific primers were used to detect NDV genome transcription. Experimental results are as follows: Figure 5 As shown, the results indicate that the sgTRIM21-3 group exhibited the most significant cell function at both the viral mRNA and viral genomic RNA levels, demonstrating that viral replication levels increased more than three-fold after TRIM21 knockout compared to the control group. These results suggest that TRIM21 is involved in cancer cells' resistance to oncolytic viruses, confirming our hypothesis that knocking out TRIM21 in cancer cells using this kit can improve the oncolytic effect of NDV, providing new material for further research on enhancing the oncolytic effect of NDV.

[0088] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A highly efficient shRNA for knocking out the TRIM21 gene, characterized in that... It is at least one of the following: The nucleotide sequence of the positive strand of shTRIM21-1 is as follows: CACCGTCATCTCAGAGCTAGATCGA, The antisense strand nucleotide sequence is as follows: AAACTCGATCTAGCTCTGAGATGAC; The nucleotide sequence of the positive strand of shTRIM21-2 is as follows: CACCGTCAGTTCCCCTAATGCCACC, The antisense strand nucleotide sequence is as follows: AAACGGTGGCATTAGGGGAACTGAC; The nucleotide sequence of the positive strand of shTRIM21-3 is as follows: CACCGAGCCTGTGAGCATCGAGTG, The antisense strand nucleotide sequence is as follows: AAACCACTCGATGCTCACAGGCTC; Analogs of shTRIM21-1, shTRIM21-2, and shTRIM21-3 that still retain the function of inhibiting TRIM21 gene expression, obtained through base insertion, deletion, or substitution.

2. The shRNA for efficiently knocking out the TRIM21 gene according to claim 1, characterized in that: The highly efficient TRIM21 gene knockout shRNA is ligated into a vector, packaged with lentivirus, and transfected into cells. It can knock out some bases on the TRIM21 gene, resulting in the inability to form normal TRIM21 protein through frameshift mutation.

3. A vector for efficiently knocking out the TRIM21 gene, characterized in that: Includes the shRNA that efficiently knocks out the TRIM21 gene as described in claim 1 or 2.

4. A kit for efficiently knocking out the TRIM21 gene, characterized in that: The vector for efficiently knocking out the TRIM21 gene as described in claim 3.

5. The kit for efficiently knocking out the TRIM21 gene according to claim 4, characterized in that: The kit for efficiently knocking out the TRIM21 gene also includes reagents for transducing the vector for efficiently knocking out the TRIM21 gene into cells; The reagents include lentiviral helper packaging plasmids psPAX2 and pMD2.G.

6. The use of the highly efficient TRIM21 gene knockout shRNA as described in claims 1-2, the highly efficient TRIM21 gene knockout vector as described in claim 3, and / or the highly efficient TRIM21 gene knockout kit as described in claims 4-5 in the preparation of antitumor drugs and / or oncolytic therapy enhancement drugs.

7. Application of TRIM21 gene in regulating tumor sensitivity to oncolytic therapy.

8. A biomarker for screening the sensitivity of tumors to oncolytic therapy, characterized in that: Including the TRIM21 gene; The expression level of the TRIM21 gene is negatively correlated with the sensitivity of tumors to oncolytic therapy.

9. A kit for screening the sensitivity of tumors to oncolytic therapy, characterized in that: Including reagents for detecting TRIM21 gene expression levels; The kit for screening tumor sensitivity to oncolytic therapy indicates that high expression of the TRIM21 gene suggests that the tumor is not sensitive to oncolytic therapy.

10. A tumor treatment drug, characterized in that: A kit for efficiently knocking out the TRIM21 gene as described in claim 4 or 5; The aforementioned cancer treatment drugs also include NDV virus; The NDV virus mentioned is the La Sota strain.