A method for controlling tomato brown rugose fruit virus

Abstract

The application relates to a method for preventing and treating tomato brown rugose fruit virus, which has three remarkable advantages: effectively inhibiting the virus, simplifying the preparation process and having strong persistence, can be used for long-term inhibition of the infection and replication of the tomato brown rugose fruit virus, and has a wide application prospect in large-scale field production.

Description

Technical Field

[0001] This application relates to a method for controlling tomato brown wrinkle virus, belonging to the fields of biotechnology and plant protection. Background Technology

[0002] Tomato brown rugose fruit virus (ToBRFV) is a newly emerging virus that severely affects tomato growth, leading to reduced yields and significant economic losses. RNA interference (RNAi) is a gene silencing mechanism induced by double-stranded RNA (dsRNA), commonly used in gene function research and disease treatment, and in recent years also for the control of plant diseases. However, due to the complexity of biological mechanisms, even with a thorough understanding of the principles and techniques of RNAi, it is impossible to predict whether an effective dsRNA targeting a specific gene can be obtained. The sequence composition and length of different dsRNAs directly affect the interference effect. Therefore, extensive screening is only a necessary condition for achieving interference, and the final result is highly unpredictable.

[0003] Unlike seed soaking and root application, foliar spraying remains the most convenient plant protection method in agricultural production. However, a major drawback of RNAi technology is that dsRNA is relatively unstable and easily degraded, especially when exposed to the natural environment, such as when dsRNA preparations are foliar sprayed, as it is greatly affected by factors like temperature, wind, and light. Therefore, researchers have made extensive efforts to test various methods for purifying, modifying, and encapsulating dsRNA to stabilize it after foliar spraying and achieve higher inhibition efficiency. For example, dsRNA can be purified with alcohol or sodium salt before foliar spraying, one or both strands of the dsRNA can be chemically modified, or the dsRNA can be encapsulated in nanocarriers. These methods are not only costly and difficult to scale up in actual production, but also have very low persistence. ToBRFV is usually only effectively interfered with when dsRNA is applied simultaneously (with a maximum interval of one day). There is no evidence that it can still effectively inhibit ToBRFV after a longer interval. Even after purification, modification or encapsulation of dsRNA, there are no reports of foliar spraying of dsRNA preparations inhibiting ToBRFV for more than two weeks.

[0004] Therefore, at least three challenges currently hinder the widespread application of dsRNA in ToBRFV control: First, it is difficult to obtain dsRNAs with highly effective interference against ToBRFV viral genes (specific sequence composition and length). Second, the process of dsRNA formulation is complex, requiring purification, modification, and encapsulation steps. Third, dsRNA is easily degraded, and the inhibitory effect of foliar spraying of dsRNA formulations lacks persistence. Summary of the Invention

[0005] To address the aforementioned issues, this application first provides a double-stranded RNA that targets and interferes with tomato brown wrinkled fruit virus. The preparation method of the double-stranded RNA is as follows: cDNA is synthesized from total RNA of tomato brown wrinkled fruit virus, and the cDNA is amplified using the primers shown in SEQ ID NO. 1 and SEQ ID NO. 2. The amplified product is then transcribed to obtain the cDNA.

[0006] In some embodiments, the sequence of one strand of the amplified product is shown in SEQ ID NO. 3.

[0007] In some embodiments, the double-stranded RNA consists of the sequence shown in SEQ ID NO. 4 and a sequence that is inversely complementary to the sequence shown in SEQ ID NO. 4.

[0008] This application also provides a formulation for controlling tomato brown wrinkle virus (i.e., a dsRNA formulation), the formulation containing the above-mentioned double-stranded RNA.

[0009] In some embodiments, the preparation method of the formulation includes: transforming a recombinant vector containing the double-stranded RNA into a host, expressing it under suitable conditions, and then performing lysis such as ultrasonication, and collecting the lysate. In some embodiments, the preparation method of the recombinant vector includes: synthesizing cDNA from total RNA of tomato brown wrinkle virus, introducing one end of each primer shown in SEQ ID NO. 1 and SEQ ID NO. 2 into a homologous recombination arm containing an enzyme digestion site, then amplifying the cDNA using the two primers, and ligating the amplification product with an expression vector digested with the same enzyme to form a recombinant vector.

[0010] This application also provides the use of the described double-stranded RNA or the described preparation in the control of tomato brown wrinkled fruit virus. For example, the double-stranded RNA or the described preparation is sprayed onto the leaves of the plant. This application also provides a nucleic acid whose nucleotide sequence is shown in SEQ ID NO. 3. This application also provides a recombinant vector and microorganisms containing the nucleic acid. This application also provides a method for controlling tomato brown wrinkled fruit virus, which includes applying the described double-stranded RNA or the described preparation. For example, foliar spraying.

[0011] In some specific embodiments, the preparation method of the formulation includes: synthesizing cDNA from total RNA of tomato brown wrinkled fruit virus; modifying one end (e.g., the 5' end) of the primers shown in SEQ ID NO. 1 and SEQ ID NO. 2, such as introducing a homologous recombinant arm containing an enzyme restriction site (e.g., Sac I or Hind III); amplifying the cDNA using the modified primers; ligating the amplified product with an expression vector (e.g., L4440) digested with the same enzyme; transforming the host (e.g., HT115 competent cells); expressing the product under suitable conditions (e.g., IPTG induction); lysing the product (e.g., ultrasonic lysis); and collecting the lysate. In some embodiments, the host refers to a microorganism. In some embodiments, the preparation method of the formulation includes: ultrasonically lysing microorganisms containing dsRNA and collecting the lysate.

[0012] One implementation of ultrasonic lysis or disruption is via an ultrasonic cell disruptor (e.g., using an output power of 300 W for 1, 2, 3, 4, 5, or 6 minutes). In some implementations, the host or microorganism contains an expression vector in which the dsRNA is constructed and induced to express. In some embodiments, the microorganism is bacteria (e.g., *Escherichia coli*), fungi (e.g., yeast), etc. In some embodiments, the expression vector is a prokaryotic or eukaryotic expression vector. The inducer used to induce expression can be IPTG, etc. Attached Figure Description

[0013] Figure 1 Target region amplification results. M: DL2000; 1-2: cDNA-P2596 (229 bp) containing homologous arms; 3-4: cDNA-P2594 (267 bp) containing homologous arms; 5-6: cDNA-P2591 (292 bp) containing homologous arms.

[0014] Figure 2 Linearization of vector L4440. M: DL10000; 1: L4440 vector; 2: linearized vector.

[0015] Figure 3 Colony PCR detection. A. M: DL2000; 1-12: cDNA-P2596; 13-24: cDNA-P2594; BM: DL2000; 1-12: cDNA-P2591.

[0016] Figure 4 Different concentrations of IPTG induced dsRNA expression levels at the same time point. M: DL2000; 1: 0 mM; 2: 1 mM; 3: 2 mM; 4: 3 mM; 5: 4 mM.

[0017] Figure 5 Release levels of dsRNA after ultrasonic disruption for different time periods. M: DL2000; 1: 1 min; 2: 2 min; 3: 3 min; 4: 4 min; 5: 5 min; 6: 6 min.

[0018] Figure 6 Release of different dsRNA fragments. A:M: DL2000; 1: Pre-induction control; 2-3: dsRNA-P2596; BM: DL2000; 1-2: dsRNA-P2594; 3-4: dsRNA-P2591.

[0019] Figure 7 Performance 21 days after inoculation (I). A1: Control plant; 2-7: Plants sprayed with dsRNA-P2591 / P2592 / P2593 / P2594 / P2595 / P296 formulation; B1: Leaf of control plant; 2-7: Leaf of plant sprayed with dsRNA-P2591 / P2592 / P2593 / P2594 / P2595 / P296 formulation.

[0020] Figure 8 Real-time quantitative PCR was used to detect ToBRFV viral load. The expression levels of ToBRFV target fragments in the control and treatment groups were compared; different letters represent significant differences (P < 0.05, one-way ANOVA).

[0021] Figure 9 Performance 21 days after inoculation (Part 2). 1: Control plant; 2: Plants inoculated with ToBRFV 1 day after spraying with dsRNA-P2591; 3: Plants inoculated with ToBRFV 3 days after spraying with dsRNA-P2591; 4: Control leaf; 5: Leaf inoculated with ToBRFV 1 day after spraying with dsRNA-P2591; 6: Leaf inoculated with ToBRFV 3 days after spraying with dsRNA-P2591.

[0022] Figure 10 Real-time quantitative PCR was used to detect the viral load of ToBRFV. 1: Control plants; 2: Treatment group inoculated 1 day after spraying with dsRNA-P2591 preparation; 3: Treatment group inoculated 3 days after spraying with dsRNA-P2591 preparation.

[0023] Figure 11 Performance 21 days after inoculation (Part 3). 1: Control plant; 2: Plant sprayed with dsRNA-P2591 preparation; 3: Leaf of control plant; 4: Leaf sprayed with dsRNA-P2591 preparation.

[0024] Figure 12Example of a partial primer sequence used for screening.

[0025] Figure 13 The core part of the primer pair corresponds to the amplified cDNA sequence.

[0026] Figure 14 The sequences of primers for detecting viral load. Detailed Implementation

[0027] To illustrate the universal design concept of this application, specific experimental parameters are provided below as examples, but this should not be used as a reason to limit the scope of protection of this application. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0028] Example 1: Primer screening and cDNA synthesis for the target region

[0029] 1.1 Experimental Materials: Virus inoculation was performed using the pcb301-ToBRFV vector and Agrobacterium tumefaciens injection with GV3101. The tomato material, Jinza 216, was cultivated by the Tianjin Academy of Agricultural Sciences and grown in the greenhouse of the Modern Urban Agriculture Research Institute of the Tianjin Academy of Agricultural Sciences under normal water and fertilizer management. The vector LH4440 was purchased from Wuhan Miaoling Biotechnology Co., Ltd. The Escherichia coli RNase III deficient strain HT115 was purchased from Beijing TaKaRa Co., Ltd.

[0030] 1.2 Enzymes and Reagents: Restriction endonucleases (Sac I and Hind III) were purchased from Beijing TaKaRa Company. High-fidelity DNA polymerase Fastpfu was purchased from Beijing TransGen Biotech Company. Homologous recombination ligase was purchased from Jiangsu Novizan Company. DNA gel extraction kits and plasmid mini-extraction kits were purchased from Beijing TaKaRa Company. Primer synthesis and DNA sequencing were performed by New Era Zhonghe Biotechnology Co., Ltd.

[0031] 1.3 Primers: Insertion sites were designed and target primers were synthesized based on the map of the final vector L4440. The upstream and downstream primers introduced homologous recombination arms containing Sac I and Hind III restriction sites, respectively. The portion lacking restriction sites and homologous recombination arms was considered the core part of the primers. Those skilled in the art will understand that the screening of specific primers is a very complex process. Figure 12 and Figure 13Only six primer pairs and the corresponding cDNA sequences amplified from the core portions of these primer pairs are shown. The experiments below show that the cDNA-P2591 (sequence shown in SEQ ID NO. 3) amplified together by the core portion GATGTCCGCGACATAATGCGG of primer P2591-F (SEQ ID NO. 1) and the core portion GCGGCGTAACAAACATGGACAT of primer P2591-R (SEQ ID NO. 2) yields the best results.

[0032] SEQ ID NO. 3 (5'-3'):

[0033] GATGTCCGCGACATAATGCGGCACGAAGGCCAGAAAGACAGTATAGAATTATACCTTTCCAGGCTTGAGCGGGGCAACAAAGTTGTCCCAAATTTCCAAAAGGAAGCTTTTGACAGATACGCTGAAACGCCAGACGAAGTTGTCTG TCACAGTACCTTCCAAACGTGTACGCACCAGCAGGTGGAAAACACAGGCAGGTGTATGCTATTGCATTGCACAGTATATACGATATACCTGCTGATGAATTCGGAGCGGCACTTTTAAGGAAAAATGTCCATGTTTGTTACGCCGC

[0034] SEQ ID NO. 4 (5'-3'):

[0035] GAUGUCCGCGACAUAAUGCGGCACGAAGGCCAGAAAGACAGUAUAGAAUUAUACCUUUCCAGGCUUGAGCGGGGCAACAAAGUUGUCCCAAAUUUCCAAAAGGAAGCUUUUGACAGAUACGCUGAAACGCCAGACGAAGUUGUCUGUCACAGUACCUUCCAAACGUGUACGCACCAGCAGGUGGAAAACACAGGCAGGGUGUAUGCUAUUGCAUUGCACAGUAUAUACGAUAUACCUGCUGAUGAAUUCGGAGCGGCACUUUUAAGGAAAAAUGUCCAUGUUUGUUACGCCGC (Note: According to the standard ST.26 sequence listing requirements, U is not allowed in the sequence. Unless otherwise specified, the symbol "t" refers to thymine in the DNA sequence and uracil in the RNA sequence.)

[0036] 1.4. cDNA Synthesis: Total RNA was extracted from tomatoes infected with Tomato Brown Rugosefruit Virus (ToBRFV) using a kit. 2 μl oligo dT and 3 μl DEPC water were added, and the mixture was placed in a PCR instrument (70℃) for 10 min, then immediately placed on ice for 5 min. After cooling, 0.5 μl M-MLV reverse transcriptase, 2 μl 5×M-MLV buffer, 2.5 μl dNTPs (each 10 mmol / L), and 0.25 μl Ribonuclease inhibitor were added, and the mixture was synthesized at 42℃ for 60 min, followed by inactivation at 65℃ for 15 min. This was then used as a template for PCR.

[0037] 1.5 Obtaining the target fragment with homologous recombination arms: Using the synthesized cDNA as a template, PCR amplification was performed using the primers described above. Fastpfu enzyme was used for amplification, and the amplification system is shown in Table 1.

[0038] Table 1 Fastpfu enzyme amplification system

[0039]

[0040] The PCR reaction program was as follows: 98℃ pre-denaturation for 5 min; cycling consisted of 98℃ denaturation for 10 s, 60℃ annealing for 30 s, and 72℃ extension for 2 min, for a total of 30 cycles; followed by a 72℃ extension for 5 min. The PCR products were subjected to electrophoresis on a 1.8% agarose gel at 150 V for 15 min. The electrophoresis results were photographed and recorded, indicating that the target fragment was successfully amplified. Figure 1 Observe under UV light and quickly cut out the target band. Recover the target fragment using a gel recovery kit (TaKaRa), following the kit instructions.

[0041] Example 2: Construction of the Expression System

[0042] 2.1 Enzyme digestion of the vector: The LH4440 vector was double-digested with restriction endonucleases Sac I and Hind III to obtain a linearized vector. The digestion effect was verified by 1% agarose gel electrophoresis. Figure 2 The enzyme digestion system is shown in Table 2.

[0043] Table 2 Enzyme digestion system of target fragment and vector

[0044]

[0045] 2.2 Ligation: The recovered target fragment was ligated to the enzyme-digested vector using homologous recombination. The ligation was carried out at 37°C for 30 min. The ligation system is shown in Table 3.

[0046] Table 3. Connection between target fragment and linearized vector

[0047]

[0048] 2.3 Transformation: Competent cells were thawed on ice, and 1 μL of plasmid was added. The cells were placed on ice for 20 min, then heat-shocked in a 42°C water bath for 90 sec, followed by an ice bath for 2 min. After the ice bath, 400 μL of pre-chilled antibiotic-free LB medium was added, and the cells were incubated at 37°C and 180 rpm for 30 min. After incubation, the centrifuge tubes were removed, centrifuged at 12,000 g for 1 min at room temperature, and the supernatant was discarded. 100 μL of the supernatant was plated onto a solid medium containing Amp (50 ug / mL) and TET (10 ug / mL) antibiotics, and incubated upside down at 37°C for 16-18 hours. Colony PCR identification showed that the band size was consistent with expectations. Figure 3 After sequencing, they were named LH4440-2596, LH4440-2594, and LH4440-2591, respectively.

[0049] Example 3 Preparation of dsRNA formulation

[0050] 3.1 Screening for the optimal concentration of IPTG for induction: The recombinant vector was transformed into HT115 competent cells. Single colonies were picked and inoculated into resistant liquid medium containing Amp (50 μg / mL) and TET (10 μg / mL), and cultured overnight at 37°C in a shaker. The cells were then transferred to fresh resistant liquid medium at a ratio of 1:1000 and cultured until the OD600 value reached 0.4–0.6. IPTG was then added at final concentrations of 0, 1, 2, 3, and 4 mM, respectively, and incubated at 37°C for 4 h. Total RNA was extracted using the TriZol extraction method, and the induction effect of dsRNA was detected by 1.5% agarose gel electrophoresis. The results showed that the induction effect was optimal when the IPTG concentration was 2 mM (Figure 4).

[0051] 3.2 Optimal time selection for ultrasonic disruption: Induction conditions of 2 mM IPTG and 37℃ for 4 h were selected. After induction, bacterial cells were collected and resuspended in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). Ultrasonic disruption was performed using an ultrasonic cell disruptor at 300 W for 1, 2, 3, 4, 5, and 6 min to explore the optimal ultrasonic time. Subsequently, the disrupted liquid was directly separated from dsRNA by 1.5% agarose gel electrophoresis to detect the dsRNA release effect. The results showed that ultrasonic disruption for 5 min maximized the release of dsRNA (Figure 5).

[0052] After induction of expression, the recombinant vectors LH4440-2596, LH4440-2594n, and LH4440-2591 were used to collect bacterial cells, which were then resuspended in TE buffer. Following sonication, the lysate was used as the dsRNA preparation. 5 μL of the preparation was then subjected to agarose gel electrophoresis for detection. Figure 6 The remaining liquid is reserved for spraying. The above examples are only dsRNA-P2591, dsRNA-P2594 or dsRNA-P2596. Those skilled in the art will understand that various dsRNA preparations such as dsRNA-P2592, dsRNA-P2593 or dsRNA-P2595 can be obtained by following similar procedures.

[0053] Example 4: The preventive and therapeutic effects of dsRNA preparations

[0054] 4.1 Experimental Treatments: Tomato plants that had reached the three-leaf stage were selected. TE buffer was used as a control. The treatment involved spraying the upper and lower surfaces of the leaves and the leaf stalks until a fine liquid film formed on the leaf surface. Each tomato plant was sprayed with approximately 4 mL of dsRNA preparation (i.e., the treatment group). ToBRFV virus was inoculated using Agrobacterium tumefaciens injection 1 day and 3 days after dsRNA spraying (i.e., 1-day and 3-day intervals), and the virus infection status was observed. The dsRNA preparations were derived from six dsRNA treatments: dsRNA-2596, dsRNA-2595, dsRNA-2594, dsRNA-2593, dsRNA-2592, and dsRNA-2591. Ten tomato plants were treated with each treatment, and the treatment was replicated three times.

[0055] 4.2 Virus Content Detection: Real-time quantitative PCR (RT-PCR) was used to detect the expression of the ToBRFV target fragment after dsRNA treatment to determine the virus content. Total RNA was extracted from infected leaves 21 days after inoculation and reverse-engineered into cDNA. Using the ACTIN gene in tomato as an internal reference gene, specific primers ACTIN-F and ACTIN-R were designed as internal control primers; ToBRFV-cqF and ToBRFV-cqR primers were designed to detect the expression of the ToBRFV target fragment, with TE buffer spraying as a blank control. Relative quantification was performed using 2... -△△Ct Methods and primer sequences are described in [link to method]. Figure 14 .

[0056] 4.3 Control Efficacy: One day after spraying the dsRNA preparation, ToBRFV was inoculated. On day 17 after inoculation, the control group began to show symptoms; on day 21 after inoculation, the control group showed obvious leaf curling symptoms, while the treatment groups did not show this symptom. Figure 7 ); 25-27 days after inoculation, the treatment groups began to show symptoms to varying degrees. The incidence of disease was investigated and statistically analyzed (Table 4), and real-time quantitative PCR (RT-qPCR) was performed using ToBRFV-cqF / R primers to identify differences in viral load among the different treatment groups and screen for the fragment with the best control effect. The results showed that the viral load in all treatment groups was lower than that in the control group. Among them, the dsRNA-2591 preparation showed the most significant effect (Figure 8), proving that the dsRNA preparation induced by in vitro lysis can effectively prevent ToBRFV infection. Secondly, the results of ToBRFV inoculation at different intervals after spraying with the dsRNA-2591 preparation showed that 21 days after inoculation, the treatment group still did not develop symptoms (Figure 9); the viral load was detected, and the results showed that there was still a significant difference when the interval was 3 days. Figure 10 This further proves that the method has a long time-limited effect.

[0057] Table 4. Survey of the number of diseased plants

[0058]

[0059] Example 5: Application Effects of dsRNA Formulation in Production Practice

[0060] 5.1. Materials: Tianjin Miscellaneous 216.

[0061] 5.2. Method:

[0062] 5.2.1 Seedling raising: Sow 2 tomato seeds per hole in a seedling tray and manage them as usual. When the seedlings have three leaves and one bud, spray them and inoculate them against viruses.

[0063] 5.2.2 Bacterial Culture: HT115 bacterial suspension containing the L4440-2591 vector was inoculated into LB solid medium containing AMP (50 ug / mL) and TET (10 ug / mL) using an inoculation needle and cultured. After 1 day, single colonies were picked and cultured in LB liquid medium containing AMP (50 ug / mL) and TET (10 ug / mL) at 37℃ with shaking at 200 rpm for 24 h.

[0064] 5.2.3 Induction of dsRNA expression: A suitable amount of bacterial culture was re-inoculated into fresh LB medium containing antibiotics, and incubated at 37°C and 200 rpm for 3 h until OD500 was reached. 600 When the concentration is 0.4-0.6, IPTG (final concentration 2 mM) is added to induce expression. After incubation at 37℃ and 200 rpm for 4 h, it is used for dsRNA lysis.

[0065] 5.2.4 Lysis of dsRNA: The bacterial cells were collected and resuspended in TE buffer. The cells were then sonicated using an ultrasonic cell disruptor at an output power of 300 W for 5 min. Subsequently, the lysRNA in the solution was directly separated by 1.5% agarose gel electrophoresis to detect the release effect of dsRNA. The remaining liquid was used as the spray solution (dsRNA-2591 formulation).

[0066] 5.2.5 dsRNA treatment of tomato plants: 50 tomato seedlings were sprayed with the lysed dsRNA solution, and 50 seedlings were sprayed with TE buffer as a control. The upper and lower surfaces of the leaves were sprayed evenly. One day after spraying, the plants were inoculated with ToBRFV virus.

[0067] 5.2.6 Results: The tomato plants were observed and analyzed one month later. Of the 50 plants sprayed with the crude extract, 40 were disease-free, while all plants in the control group developed the disease within one month, proving that this method can be used for long-term control of tomato brown wrinkle virus (Figure 11).

[0068] In summary, the dsRNA formulation or method for the prevention and control of ToBRFV in this application has three major advantages over existing technologies: First, dsRNA-P2591 has a significant inhibitory effect on ToBRFV; second, the preparation process of dsRNA-P2591 formulation is simple, requiring no purification, modification, or encapsulation steps; and third, it has a long duration of action: the interval between application of dsRNA-P2591 formulation and exposure to the virus can be up to 3 days, and the inhibitory effect can last for more than one month.

Claims

1. A double-stranded RNA that targets and interferes with tomato brown wrinkle virus, characterized in that, The method for preparing the double-stranded RNA is as follows: cDNA is synthesized from total RNA of tomato brown wrinkle virus, the cDNA is amplified using primers shown in SEQ ID NO. 1 and SEQ ID NO. 2, and the amplified product is transcribed to obtain the cDNA.

2. The double-stranded RNA according to claim 1, characterized in that, The sequence of one strand of the amplified product is shown in SEQ ID NO.

3.

3. The double-stranded RNA according to claim 1 or 2, characterized in that, The double-stranded RNA consists of the sequence shown in SEQ ID NO. 4 and a sequence that is inversely complementary to the sequence shown in SEQ ID NO.

4.

4. A preparation for controlling tomato brown wrinkled fruit virus, characterized in that, The formulation contains the double-stranded RNA as described in any one of claims 1-3.

5. The formulation as described in claim 4, characterized in that, The preparation method of the formulation includes: transforming a recombinant vector containing the double-stranded RNA into a host, expressing it under suitable conditions, lysing it, and taking the lysate.

6. The formulation as described in claim 5, characterized in that, The method for preparing the recombinant vector includes: synthesizing cDNA from total RNA of tomato brown wrinkled fruit virus; introducing one end of each primer shown in SEQ ID NO. 1 and SEQ ID NO. 2 into a homologous recombination arm containing an enzyme digestion site; then amplifying the cDNA with the two primers; and ligating the amplification product with an expression vector digested with the same enzyme to form a recombinant vector.

7. The use of the double-stranded RNA according to any one of claims 1-3 or the preparation according to any one of claims 4-6 in the prevention and control of tomato brown wrinkled fruit virus.

8. The application as described in claim 7, characterized in that, The double-stranded RNA or the preparation is sprayed onto the leaves of the plant.

9. A nucleic acid having the nucleotide sequence shown in SEQ ID NO.

3.

10. A recombinant vector or microorganism containing the nucleic acid of claim 9.

Images