A method for constructing a leek VIGS silencing system and application thereof
By infecting leek seedlings with vacuum permeation, a TRV virus-induced gene silencing technology system was constructed, which solved the problem of insufficient tools for leek gene function research, achieved significant gene silencing effect, and provided a rapid gene function research tool.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GANSU AGRI UNIV
- Filing Date
- 2026-03-26
- Publication Date
- 2026-06-05
AI Technical Summary
The lack of tools for studying the gene function of chives, and the absence of an efficient and rapid gene silencing system, increases the difficulty of the research.
A TRV virus-induced gene silencing technology system was constructed by infecting leek seedlings with vacuum permeation method. Recombinant plasmids were then introduced into leek cells using vacuum permeation method to achieve gene silencing.
A VIGS silencing system for chives was successfully constructed, which significantly reduced the expression level of target genes, made up for the shortcomings of existing technologies, and provided a rapid tool for gene function research.
Smart Images

Figure CN122146780A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, specifically to a method for constructing a VIGS silencing system in chives and its application. Background Technology
[0002] An effective method for gene function research is to stably transform the target gene within the species to obtain transgenic plants and verify its function. Virus-induced gene silencing (VIGS) provides an excellent tool for large-scale, rapid gene silencing in plants because it shortens the experimental cycle and does not rely on stable genetic transformation. Leeks, belonging to the Liliaceae family of monocotyledons, have a significantly different genetic background from classic model plants (such as Arabidopsis and rice), lacking a mature genetic manipulation system. The leek genome is highly complex: large, tetraploid, with many repetitive sequences and strong gene redundancy, increasing the difficulty of gene function research. Leek regeneration relies on meristematic or young tissues, but its cell dedifferentiation ability is weak, making it difficult to establish an efficient regeneration system. This has resulted in a serious lag in leek functional genomics research, lacking efficient and rapid gene function research tools. Therefore, developing a method for constructing a leek VIGS silencing system is essential. Summary of the Invention
[0003] To develop a method for constructing a VIGS silencing system in chives, this invention provides a method for constructing a VIGS silencing system in chives and its application. This invention constructs a VIGS silencing system in chives by infecting chive seedlings using a vacuum infiltration method.
[0004] This invention provides a method for constructing a VIGS silencing system for chives, comprising the following steps: The target gene fragment was recombinantly ligated with a linearized TRV2 vector to obtain a recombinant plasmid, which was then transformed into Agrobacterium tumefaciens to obtain a recombinant Agrobacterium tumefaciens culture. This culture was then used to infect leek seedlings using a vacuum permeation method and cultured until a typical gene silencing phenotype could be observed, thus constructing a leek VIGS silencing system.
[0005] This invention uses chive functional genes as indicator genes and employs a vacuum permeation method to infect chive seedlings, thereby constructing a TRV virus-induced gene silencing technology system, which makes up for the lack of tools for chive gene function research.
[0006] Furthermore, the pressure of the vacuum permeation method is 0.08 kPa to 0.09 kPa, and the vacuum permeation time is 5 min to 6 min.
[0007] Furthermore, the leek seedlings mentioned are leek seedlings that have been cultivated for 5 to 6 months.
[0008] Furthermore, the culture conditions are as follows: after being treated in the dark at 22℃~24℃ for 22h~24h, the conditions are adjusted to alternating culture at 22℃~24℃ for 14h of light and 18℃ for 10h of darkness for 23d~25d.
[0009] Furthermore, the linearization step of the TRV2 vector is as follows: the empty TRV2 vector is obtained by double digestion with restriction endonucleases BamHI and KpnI.
[0010] Furthermore, the chives mentioned are 'red-rooted chives'.
[0011] This invention also provides the application of the leek VIGS silencing system in verifying leek gene function, wherein the leek VIGS silencing system is constructed using the aforementioned construction method.
[0012] Furthermore, the leek gene includes AtuPDS Gene, AtuXTH Gene, AtuSAMS and AtuALL Gene.
[0013] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention successfully constructed a TRV virus-induced gene silencing technology system using a vacuum permeation method, filling the gap in tools for studying gene function in chives. The choice of the vacuum permeation method is unconventional. Experiments have demonstrated that, compared to other conventional inoculation methods in this field, such as friction and injection, the vacuum permeation method can successfully silence the target gene. Furthermore, testing showed that after inoculation of chive plants using the vacuum permeation method, the target gene... AtuPDS Gene expression levels decreased significantly by 86.99%, while the friction method barely achieved silencing; after the injection method infected leek plants, its... AtuPDS Gene expression levels decreased by 22.04%, but this was not statistically significant. Therefore, the vacuum permeation method solved the problem of successfully constructing a silencing system for studying gene function in chives. Attached Figure Description
[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0015] Figure 1 The results show the PCR amplification of a 300bp fragment of the PDS gene; where M: DNA marker 2000; PDS: PCR amplification product of a 300bp fragment of the AtuPDS gene.
[0016] Figure 2 The PDS insert sequence was aligned with the TRV2-AtuPDS vector sequence; where TRV-PDS is the TRV2-AtuPDS vector sequence and AtuPDS is the PDS insert sequence obtained from transcriptome alignment.
[0017] Figure 3 The results of comparing the leek PDS gene sequence obtained from transcriptome data with the garlic PDS gene sequence in the NCBI database.
[0018] Figure 4 For TRV2- AtuPDS Inducing Leeks PDS Gene silencing phenotype; where CK: uninfected leek seedlings; seedlings treated with pTRV2 empty vector culture; pTRV2- AtuPDS-1 pTRV2- AtuPDS-2 and pTRV2- AtuPDS-3 : 3 TRV2- AtuPDS PDS-silenced chive seedlings treated with bacterial solution.
[0019] Figure 5 For TRV2- AtuPDS Seedling treatment and control AtuPDS Gene expression analysis; where CK was the untreated control; TRV2 was the empty vector-treated control; Atu PDS -1-3, TRV2- AtuPDS The three strains were treated.
[0020] Figure 6 Phenotypic diagram showing the effect of different infection methods on the construction of the VIGS silencing system in chives; In the figure, A represents the phenotype of chive plants infected by vacuum permeation method in Example 1 after 3 days; B represents the phenotype of chive plants infected by vacuum permeation method in Example 1 after 7 days; C represents the phenotype of chive plants infected by vacuum permeation method in Example 1 after 30 days; D represents the phenotype of chive plants 3 days after infection by the friction method; E represents the phenotype of chive plants infected by the friction method 7 days later; F represents the phenotype of chive plants infected by the friction method 30 days later; G represents the phenotype of leek plants 3 days after injection infection; H represents the phenotype of chive plants 7 days after infection by injection. I represents the phenotype of leek plants 30 days after being infected by injection.
[0021] Figure 7 To study the effects of different infection methods on chives AtuPDS The impact on gene expression levels.
[0022] Figure 8 for AtuXTH Electrophoresis diagram of PCR amplification products of gene silencing fragments; where M: DNA marker 2000; 1: AtuXTH PCR amplification product of a 300 bp gene fragment.
[0023] Figure 9 for AtuXTH Statistical graph of relative gene expression levels in empty vector and silent vector plants.
[0024] Figure 10 for AtuXTH Phenotype of gene-silenced leek plants.
[0025] Figure 11 The effect of silencing the AtuXTH gene on the cellulose and hemicellulose content of leek leaves; In the figure, A represents the effect of silencing the AtuXTH gene on cellulose in chive leaves; B represents the effect of silencing the AtuXTH gene on the hemicellulose content of leek leaves.
[0026] Figure 12 for AtuSAMS and AtuALL Electrophoresis diagram of PCR amplification products of gene silencing fragments; in the diagram, M: DNA marker 2000; 2: AtuSAMS 3: AtuALL .
[0027] Figure 13 for AtuSAMS and AtuALL Analysis of the relative expression levels of genes in empty vector and silent vector plants; In the diagram, A is... AtuSAMS Analysis of the relative expression levels of genes in empty vector and silent vector plants; B is AtuALL Analysis of the relative expression levels of genes in empty vector and silent vector plants.
[0028] Figure 14 for AtuSAMS and AtuALL Phenotype of gene-silenced leek plants.
[0029] Figure 15 For silence AtuSAMS The effect of genes on the content of characteristic sulfur compounds in leek leaves; In the diagram, A represents silence. AtuSAMS The effect of genes on the content of allyl methyl sulfide in leek leaves; B represents silence. AtuSAMS The effect of genes on the content of dimethyl disulfide in leek leaves; C represents silence. AtuSAMS The effect of genes on diallyl sulfide content in leek leaves; D represents silence. AtuSAMS The effect of genes on the 3,4-dimethylthiophene content in chive leaves; E represents silence. AtuSAMS The effect of genes on the content of allyl methyl disulfide in leek leaves; F stands for silence. AtuSAMS The effect of genes on the content of dimethyl trisulfide in leek leaves; G stands for silence. AtuSAMS The effect of genes on diallyl disulfide content in leek leaves.
[0030] Figure 16 For silence AtuALL The effect of genes on the content of characteristic sulfur compounds in leek leaves; In the diagram, A represents silence. AtuALL The effect of genes on the content of allyl methyl sulfide in leek leaves; B represents silence. AtuALL The effect of genes on the content of dimethyl disulfide in leek leaves; C represents silence. AtuALL The effect of genes on diallyl sulfide content in leek leaves; D represents silence. AtuALL The effect of genes on the 3,4-dimethylthiophene content in chive leaves; E represents silence. AtuALL The effect of genes on the content of allyl methyl disulfide in leek leaves; F stands for silence. AtuALL The effect of genes on the content of dimethyl trisulfide in leek leaves; G stands for silence. AtuALL The effect of genes on diallyl disulfide content in leek leaves. Detailed Implementation
[0031] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.
[0032] Example 1: A method for constructing a VIGS silencing system for chives and its application.
[0033] This invention uses seedlings of 'red-rooted leek' cultivated for 6 months after seed germination as experimental material. Total RNA was extracted from the leek seeds and reverse transcribed into cDNA, which was then cloned. AtuPDS Insert fragment, construct TRV- AtuPDS The vector was used to transform Escherichia coli and Agrobacterium, and leek leaves were infected using a vacuum permeation method to obtain leek plants with an albino phenotype. AtuPDS Gene expression level analysis.
[0034] 1. Total RNA extraction and reverse transcription from leeks RNA was extracted from leaves of *Leek 'Red Root'*, using the SteadyPure Universal Total RNA Extraction Kit from Aikerui Biotechnology Co., Ltd. RNA integrity was analyzed by 1% agarose gel electrophoresis, and RNA purity was assessed using a NanoDrop 2000 UV spectrophotometer. High-quality RNA meeting the criteria of A260 / A230 > 2.0 and 1.8 < A260 / A280 < 2.1 was used for cDNA synthesis. The RNA was reverse transcribed into cDNA using the One-Step Genomic DNA Removal and cDNA Reverse Transcription Kit from Beijing TransGen Biotechnology Co., Ltd. (Beijing TransGen Biotechnology Co., Ltd., China).
[0035] 2. Cloning AtuPDS Insert fragment, construct pTRV- AtuPDS carrier The NCBI tool BLAST was used to search for PDS gene sequences in species such as Arabidopsis thaliana, rice, tomato, and maize. Then, PDS transcripts for leeks were identified from the third-generation transcriptome assembly data of leeks. Based on their conserved regions, a leek pTRV-1000 gene sequence was designed and constructed. AtuPDS Primers for the PDS insert fragment of the vector were designed using Primer 5 software, and the primer sequences are shown in Table 1.
[0036] Table 1 Cloning primer sequences Using cDNA from 'Red Root Leek' leaves as a template, PCR amplification was performed using KOD-Plus-one. The reaction system is shown in Table 2, and the reaction procedure is shown in Table 3. The amplified target band is shown in... Figure 1 As shown, the target fragment sequence is shown in SEQ ID NO.1.
[0037] The TRV2 empty vector was double-digested with restriction endonucleases BamHI and KpnI. The digested linear TRV2 vector was ligated to the target fragment using the pEASY-BasicSeamless Cloning and Assembly Kit; the reaction system is shown in Table 4. The components were gently mixed and reacted at 50°C for 15 min to obtain the recombinant product.
[0038] SEQ ID NO.1: ATGAATGTTATTGGGACAGTTTCTGCTGTGTATCCAAGTGGTGGAATCAAAGAAGAGATTTGTCGAGGGTTTGAATACAGAATGCAAGGGTTTGGTACAAGTGATACATGGGAGTTGAATTGCATGTTCCAGTTTCATATTA TGCAAGGATGAGACCAGCTTAAGTTTGGCGCCTTTACAGTAGTTTGCAAGGATTGCGCAAGACCTGAACTTGAAGTGCCATTATTTCTAGAAGCTGCAAATGTCTGCTTCTTTCGCGGAACCCTCGACCACAAAAAAAGCTT.
[0039] Table 2 Gene Cloning PCR Reaction System Table 3 PCR reaction procedure Table 4 Seamless Cloning Reaction System After the reaction was complete, the centrifuge tubes were placed on ice to cool for several seconds. The recombinant product (pTRV-) AtuPDS Transformation of E. coli using a vector. The specific steps for E. coli transformation and clone screening are as follows:
[0040] (a) Trans-T1 competent cells were thawed on ice.
[0041] (b) Add 5 μL of the recombinant product to Trans-T1 competent cells, mix gently, and let stand on ice for 30 min to obtain the mixture.
[0042] (c) The mixture was heat-shocked in a 42°C water bath for 70 seconds, followed immediately by an ice bath for 2 minutes.
[0043] (d) Add 450 μL of LB liquid medium and then incubate at 250 r / min in a shaker at 37°C for 60 min.
[0044] (e) Take 100 μL of cells and spread them evenly on LB plates containing Kana resistance and incubate overnight at 37°C.
[0045] (f) Select single clones and culture them in LB liquid medium containing Kana resistance at 28°C and 200 r / min for 12 h with shaking to obtain the culture medium.
[0046] (g) Take 2 μL of culture medium and add it to 20 μL of PCR reaction system, and use specific primers to identify positive clones.
[0047] The verified TRV2-AtuPDS recombinant plasmid was sent to the company for sequencing. The sequence was consistent with the transcriptome sequencing results. Figure 2 Blast analysis in the NCBI database revealed that the PDS gene sequence of leeks obtained from the transcriptome was similar to that of garlic (…). Allium sativum The homology of the PDS gene (GenBank: HQ630600.1) of phytoene desaturase was 90.87%. Figure 3 This indicates that a specific fragment of the leek PDS gene has been successfully cloned.
[0048] 3. Transformation of Agrobacterium The empty vector TRV1, empty vector TRV2, and TRV2-AtuPDS recombinant plasmid were transformed into Agrobacterium tumefaciens GV3101 using the freeze-thaw method, and the bacterial suspension with the correct bands was verified by colony PCR for infection.
[0049] 4. Vacuum infiltration method for infecting leek plants (a) Two days before inoculation, the successfully transformed empty vector TRV1, empty vector TRV2, and TRV2-AtuPDS Agrobacterium were inoculated into a solution containing 50 mg·L⁻¹ -1 Kana, 25 mg·L -1 Rif and 15 mg·L -1 Gen was cultured in LB medium with shaking until OD 600 With a value of around 1, TRV1 bacterial solution, TRV2 bacterial solution, and TRV2-AtuPDS bacterial solution were obtained.
[0050] (b) Transfer the cultured TRV1, TRV2 and TRV2-AtuPDS bacterial cultures into sterile centrifuge tubes and centrifuge at 4000 r / min for 5 min. Then remove the supernatant and retain the precipitated bacterial cells, which are recorded as TRV1 cells, TRV2 cells and TRV2-AtuPDS cells, respectively.
[0051] (c) Use the inoculum solution (containing 10 mM·L⁻¹) respectively -1 MgCl2, 10 mM·L -1 MES, 200 μM·L -1 AS (prepared fresh for use, pH 5.6) was used to resuspend TRV1, TRV2, and TRV2-AtuPDS cells, respectively. OD 600The value was adjusted to 0.8, and the mixture was allowed to stand at 28℃ for 3 hours to obtain empty TRV1 bacterial culture, empty TRV2 bacterial culture and recombinant TRV2-AtuPDS bacterial culture.
[0052] (d) The empty TRV1 vector was thoroughly mixed with the empty TRV2 vector and the recombinant TRV2-AtuPDS bacterial solution at a 1:1 ratio to obtain TRV1-TRV2 mixed bacterial solution and TRV1-TRV2-AtuPDS mixed bacterial solution respectively. The TRV1-TRV2 mixed bacterial solution was used as a blank control.
[0053] (e) The inoculation method was vacuum infiltration: Leek seedlings cultured for 6 months were taken, some fibrous roots were trimmed, and the entire seedling was immersed in the mixed bacterial solution at a pressure of 0.08 kPa for 5 minutes. Excess bacterial solution was then rinsed with distilled water, and the seedlings were transplanted into a substrate (commercial seedling substrate: vermiculite mass ratio of 2:1). The commercial seedling substrate was an organic seedling nutrient substrate produced by Gansu Lvneng Ruichi Biotechnology Co., Ltd. After 24 hours of dark treatment at 22℃ in an artificial climate chamber, normal culture was resumed (14 hours of light at 22℃ / 10 hours of darkness at 18℃). After 25 days, typical leaf whitening phenomenon due to PDS gene silencing began to be observed on the newly grown leaves of the seedlings. Figure 4 The treatment of plant leaves with the virus-free bacterial solution did not produce any whitening phenotype, nor did it result in leaf damage or rot. This indicates that the present invention has successfully constructed a VIGS silencing system for chives.
[0054] 5. Gene expression level analysis From TRV2- AtuPDS Total RNA was extracted from the whitened parts of infected leek leaves and reverse transcribed to obtain RNA. SPK1 As an internal reference gene, qRT-PCR was used to... AtuPDS Quantitative analysis of relative gene expression was performed using the following validation primers: F: TAGTGAACCATGCCGTCCATTGC (SEQ ID NO.4); R: AGATGATCGACTGCTCCGTGAAAC (SEQ ID NO. 5).
[0055] The SYBR Green Pro Taq HS premixed qPCR kit was tested on a JLM QX Series of Real-Time PCR System according to the manufacturer's instructions. The reaction system is shown in Table 5. The reaction program was 95℃ for 30 s; 95℃ for 5 s; 60℃ for 30 s, for 40 cycles. The relative quantitative expression of the target gene was analyzed using the 2-ΔΔCt method.
[0056] Table 5 qPCR reaction system The results showed that in the leaves of chives that produced the albino phenotype PDS The gene expression level was significantly lower than that of the empty control and leaves of uninfected plants. Specifically, compared with TRV2, AtuPDS -1, AtuPDS -2 and AtuPDS -3 chive leaves PDS Gene expression levels decreased by 56.65%, 66.14%, and 58.13%, respectively, while TRV2 and CK treatments showed lower levels in leaves. PDS There was no significant difference in expression levels. Figure 5 Based on the above results, it can be determined that the photobleaching phenomenon of silencing leek plant leaves is caused by the vector TRV2- AtuPDS Inducing endogenous PDS Caused by gene silencing.
[0057] To investigate the effects of different infection methods on the construction of a VIGS silencing system in leeks, successfully transformed empty vectors TRV1, TRV2, and TRV2-AtuPDS Agrobacterium were constructed following the steps in Example 1. Infection was then performed using different methods:
[0058] (1) The chive plants were infected using the vacuum infiltration method described in Example 1. For specific steps, please refer to Example 1. After 3 days, yellowing and drying of the outer leaves of the vacuum-infiltrated chive plants could be observed. Figure 6 (A); 7 days later, the chive plants resumed normal growth ( Figure 6 (B); 30 days later, the new leaves of the chives showed an albinism phenotype (B). Figure 6 (C), Explanation AtuPDS The gene has been successfully introduced into and expressed in leek plants. qRT-PCR results show that, compared to pTRV2, qRT-PCR significantly improved the expression of pTRV2 after vacuum permeation infection of leek plants. AtuPDS Gene expression levels decreased significantly by 86.99% ( Figure 7 ).
[0059] (2) Friction method: Total RNA extraction, reverse transcription, and cloning from chives AtuPDS Insert fragment, construct pTRV- AtuPDS For specific steps regarding the carrier and transformation of Agrobacterium, please refer to Example 1. Add 0.4% carborundum (600 mesh) to the infection solution; other steps are the same as in Example 1.
[0060] Inoculation method: Take the youngest fully unfolded leaf from a one-year-old leek plant. Gently support the back of the leaf with your index and middle fingers. Using your index finger (wearing a latex glove), dip it in the inoculum and gently and evenly rub the upper surface (upper epidermis) of the leaf in the same direction from the leaf base to the tip. The pressure should be just enough to create tiny, invisible scratches on the leaf surface, avoiding excessive force that could cause leaf breakage or severe damage. After rubbing, immediately rinse the leaf surface gently with distilled water from a wash bottle to remove excess abrasive and bacterial solution. Place the leek plant in an artificial climate chamber at 22℃ in the dark for 24 hours, then resume normal cultivation (22℃ light for 14 hours / 18℃ darkness for 10 hours). After 3 days, water-soaked wilting and wrinkling can be observed on the rubbed leaves. Figure 6 D); 7 days later, the rubbed leaves dried out ( Figure 6 E). After 30 days, the plant leaves turned yellow, but no whitening phenotype was observed. Figure 6 (F), explanation AtuPDS The gene was not introduced into leek plants. qRT-PCR results showed that, compared to pTRV2, leek plants infected by friction infection exhibited [a specific effect / effect]. AtuPDS There was no significant change in gene expression levels. Figure 7 ).
[0061] (3) Injection method: Total RNA extraction, reverse transcription, and cloning from chives AtuPDS Insert fragment, construct pTRV- AtuPDS For specific steps regarding the preparation of the vector, Agrobacterium transformation, and infection solution, please refer to Example 1.
[0062] Inoculation method: Take the youngest fully expanded leaf from a one-year-old leek plant. Gently support the underside (ventral side) of the leaf with one hand, and use the other hand to hold a 1 mL syringe to draw up the mixed bacterial solution. First, prick a hole with the syringe needle, being careful not to pierce the leaf. Then, gently press the blunt end of the syringe against the underside of the leaf, and slowly push the plunger with your thumb while simultaneously applying a slight reverse pressure with the syringe against the leaf. You can see the bacterial solution permeate and diffuse between the lower epidermis and mesophyll cells of the leaf, forming a moist, dark green area. After inoculation, place the leek plants in an artificial climate chamber at 22℃ in the dark for 24 hours, then resume normal culture (22℃ light for 14 hours / 18℃ darkness for 10 hours). After 3 days, some injected leaves can be observed to show water-soaked wilting and yellow tips. Figure 6 (G); 7 days later, the injected leaves resumed normal growth, but the color was yellowish (G); Figure 6 H). After 30 days, the plant leaves turned further yellow, and no whitening phenotype appeared (H). Figure 6 (I), Explanation AtuPDS The gene was not introduced into leek plants. qRT-PCR results showed that, compared to pTRV2, the gene was less effective after injection infection of leek plants. AtuPDSGene expression levels decreased by 22.04%, but this was not statistically significant. Figure 7 ).
[0063] Example 2: Leek VIGS silencing system in AtuXTH Applications in gene function analysis Using seedlings of 'Red Root Leek' cultivated for 6 months after seed germination as experimental material, TRV- was constructed according to the method in Example 1. AtuXTH The vector was used to infect leek leaves via Agrobacterium-mediated vacuum permeation. Primers for silencing fragment amplification are shown in Table 6. Screening was performed using qRT-PCR. AtuXTH Plants with a gene silencing efficiency of 60% or higher were designated as positive plants, and were then used to target pTRV2 and pTRV2- gene silencing. AtuXTH The plants were treated with 2 μmol / L 2,4-epibrassinolide. The treatment was carried out at 20:00 in the evening by spraying the leaves of the chives evenly with a sprayer. 8 mL of the treatment solution was sprayed per pot. The treatment was repeated every other day for 5 times. After the treatment, the plants were sampled 7 days after the plant was grown to determine the cellulose and hemicellulose content.
[0064] Table 6 Primers for PCR amplification of silent fragments The specific steps are as follows: 1. AtuXTH Cloning of gene silencing fragments Using a correctly sequenced full-length gene plasmid as a template, PCR amplification was performed using KOD enzyme. The electrophoresis image of the product showed a band length of 300 bp (e.g., Figure 8 The target fragment is then purified by gel extraction for use in vector construction.
[0065] 2. Analysis of target gene silencing efficiency Design specific primers (forward primer as shown in SEQ ID NO.12, reverse primer as shown in SEQ ID NO.13).
[0066] F: TGCCAAACCATGCCCTCAAGTC (SEQ ID NO. 12); R: TGTACTTCCTCTGCACCCACCTC (SEQ ID NO. 13).
[0067] qRT-PCR was used to detect the levels of leek seedlings treated for 25 days. AtuXTH Gene expression level ( Figure 9 Using pTRV2 as a control, plants with a 60% decrease in the expression level of the target gene were selected as positive plants that achieved the silencing effect. Figure 10 ).
[0068] 3. Silence AtuXTH Effects of genes on cellulose and hemicellulose synthesis in leeks like Figure 11 As shown, compared with the pTRV2 control plants, the cellulose content of pTRV2 plants significantly increased by 7.46% after BR treatment. However, pTRV2- AtuXTH The cellulose content in the plant leaves was significantly reduced by 39.71% compared to the pTRV2 control; after treatment with exogenous BR, the pTRV2- AtuXTH The cellulose content of the plants increased significantly compared to untreated pTRV2- AtuXTH The plant growth rate increased by 28.54%. Hemicellulose content showed a similar trend. Compared to the pTRV2 control, AtuXTH The hemicellulose content of silent plants decreased significantly by 28.30%, while BR treatment could slightly increase the hemicellulose content, but the difference was not statistically significant. These results indicate that... AtuXTH It may participate in the positive regulation of cellulose and hemicellulose biosynthesis in leek leaves by BR, affecting cell wall remodeling and thus promoting leek growth.
[0069] Example 3: Leek VIGS silencing system in AtuSAMS and AtuALL Applications in gene function analysis Using seedlings of 'Red Root Leek' cultivated for 6 months after seed germination as experimental material, TRV- was constructed according to the method in Example 1. AtuSAMS and TRV- AtuALL The vector was used to infect leek leaves via Agrobacterium-mediated vacuum permeation. Primers for silencing fragment amplification are shown in Table 7. Screening was performed using qRT-PCR. AtuSAMS and AtuALL Plants with a gene silencing efficiency of 60% or higher were designated as positive plants, and were then used to target pTRV2 and pTRV2- gene silencing. AtuSAMS and TRV- AtuALL The plants were treated with 2 μmol / L 2,4-epibrassinolide. The treatment was carried out at 20:00 in the evening by spraying the leaves of the chives evenly with a sprayer. 8 mL of the treatment solution was sprayed per pot. The treatment was repeated every other day for 5 times. After the treatment, the plants were sampled 7 days after the plant was grown to determine the content of characteristic sulfur compounds in the chives.
[0070] Table 7 Primers for PCR amplification of silent fragments 1. AtuSAMS and AtuALL Cloning of gene silencing fragments Using a correctly sequenced full-length gene plasmid as a template, PCR amplification was performed using KOD enzyme. The electrophoresis image of the product showed a band length of 300 bp. Figure 12 The target fragment is then purified by gel extraction for use in vector construction.
[0071] 2. Analysis of target gene silencing efficiency Design specific primers (SEQ ID NO.14~SEQ ID NO.17), as follows: AtuSAMS Validation primers used for the gene: F: AAGGTGGATAGGAGTGGGGCTTAC (SEQ ID NO. 14); R: CGACAACGGCTCAGGCACAC (SEQ ID NO. 15).
[0072] AtuALL Validation primers used for the gene: F: GACCCCTCACCAGCTTTTGGATG (SEQ ID NO. 16); R: TCACCGCCTTGGGTCAAAATTCG (SEQ ID NO. 17).
[0073] qRT-PCR was used to detect the levels of leek seedlings treated for 25 days. AtuSAMS and AtuALL Gene expression level ( Figure 13 Using pTRV2 as a control, plants with a 60% decrease in the expression level of the target gene were selected as positive plants that achieved the silencing effect. Figure 14 ).
[0074] 3. Silence AtuSAMS and AtuALL The Influence of Genes on Characteristic Sulfur Compounds in Leeks The content of seven characteristic sulfur-containing compounds in leeks was determined using GC-MS combined with external standard quantification. For example... Figure 15 As shown, compared with the pTRV2 control plants, the silenced AtuSAMS The gene significantly reduced the content of dimethyl disulfide, 3,4-dimethylthiophene, allyl methyl disulfide, dimethyl trisulfide, and diallyl disulfide in leek leaves. Exogenous BR treatment also significantly inhibited the accumulation of these sulfur-containing compounds, with their contents decreasing by 27.08%, 1.54%, 14.67%, 10.33%, and 31.07% respectively compared to the pTRV2 control. Furthermore, compared to pTRV2- AtuSAMS Compared to other plants, pTRV2- AtuSAMS Although the contents of allyl methyl sulfide, dimethyl disulfide, diallyl sulfide, and 3,4-dimethylthiophene in the +BR treatment group slightly increased, the differences were not significant. These results indicate that... AtuSAMSIt may respond to BR’s regulation of the synthesis of characteristic volatile sulfur compounds in chives by participating in the sulfur metabolism pathway in chives.
[0075] exist AtuALL In silent plants, the contents of allyl methyl sulfide and the other six characteristic sulfur-containing compounds were significantly reduced. Figure 16 Compared to the pTRV2 control, exogenous BR treatment also significantly inhibited the accumulation of dimethyl disulfide, 3,4-dimethylthiophene, allylmethyl disulfide, dimethyl trisulfide, and diallyl disulfide. AtuALL In comparison, dimethyl disulfide, 3,4-dimethylthiophene, allylmethyl disulfide, dimethyl trisulfide, and diallyl disulfide showed better performance in pTRV2- AtuALL The content of +BR in leek leaves was reduced in all aspects, with significant reductions of 0.88% and 2.26% in 3,4-dimethylthiophene and dimethyl trisulfide, respectively. In summary, AtuALL It may be involved in the regulation of BR's metabolism of volatile sulfur compounds.
[0076] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.
[0077] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. A method for constructing a leek VIGS silencing system, characterized in that, Includes the following steps: The target gene fragment was recombinantly ligated with a linearized TRV2 vector to obtain a recombinant plasmid, which was then transformed into Agrobacterium tumefaciens to obtain a recombinant Agrobacterium tumefaciens culture. This culture was then used to infect leek seedlings using a vacuum permeation method and cultured until a typical gene silencing phenotype could be observed, thus constructing a leek VIGS silencing system.
2. The method for constructing the leek VIGS silencing system according to claim 1, characterized in that, The vacuum permeation method uses a pressure of 0.08 kPa to 0.09 kPa and a vacuum permeation time of 5 min to 6 min.
3. The method for constructing the leek VIGS silencing system according to claim 1, characterized in that, The leek seedlings mentioned are leek seedlings that have been cultivated for 5 to 6 months.
4. The method for constructing the leek VIGS silencing system according to claim 3, characterized in that, The culture conditions were as follows: after dark treatment at 22℃~24℃ for 22h~24h, the conditions were adjusted to alternating light treatment at 22℃~24℃ for 14h and dark treatment at 18℃ for 10h for 23d~25d.
5. The method for constructing the leek VIGS silencing system according to claim 1, characterized in that, The linearization step of the TRV2 vector is as follows: the empty TRV2 vector is obtained by double digestion with restriction endonucleases BamHI and KpnI.
6. The method for constructing the leek VIGS silencing system according to claim 1, characterized in that, The chives mentioned are 'red-rooted chives'.
7. The application of the leek VIGS silencing system in verifying leek gene function, characterized in that, The leek VIGS silencing system is constructed using the construction method described in any one of claims 1 to 6.
8. The application according to claim 7, characterized in that, The leek genes include AtuPDS Gene, AtuXTH Gene, AtuSAMS and AtuALL Gene.