DNA methylation markers cg22131907, kits and devices for detecting type 2 diabetes
By detecting the DNA methylation site cg22131907, combined with a kit and a prediction model, the problem of early diagnosis of type 2 diabetes has been solved, achieving high sensitivity and high specificity in early prediction and diagnosis, and is suitable for early screening of type 2 diabetes.
Patent Information
- Application Number
- CN202610334315.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-18
- Publication Date
- 2026-06-05
AI Technical Summary
Current research on peripheral blood DNA methylation in Chinese patients with type 2 diabetes is limited, and there is a lack of early and accurate prediction and diagnostic methods.
The DNA methylation site cg22131907 was identified as a biomarker for type 2 diabetes and detected using the TaqMan probe method. Combined with kits and devices, it was used for early prediction and diagnosis, and a predictive model was constructed using a logistic regression model.
It provides a highly sensitive and specific method for early prediction and diagnosis of type 2 diabetes. The test is convenient and easy to conduct large-scale screening. The device has a simple structure and high accuracy.
Smart Images

Figure CN122146891A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of disease diagnostic technology, and in particular to a DNA methylation marker cg22131907 for detecting type 2 diabetes, a kit, and a device. Background Technology
[0002] Type 2 diabetes is the most common subtype of diabetes, accounting for approximately 90% of diabetes cases worldwide. Its core pathological manifestation is persistently elevated blood glucose levels. The pathogenesis of this disease is mainly related to relative insulin insufficiency and insulin resistance in peripheral tissues. Long-term effects can lead to the failure of pancreatic β-cell compensatory function, ultimately resulting in the loss of insulin secretion capacity. Type 2 diabetes often causes a variety of serious complications, affecting the vascular, ocular, renal, and nervous systems, posing a significant threat to public health. Therefore, early and accurate prediction and diagnosis of this disease are crucial for effective prevention and timely treatment.
[0003] DNA methylation is a key epigenetic regulatory mechanism, specifically involving the catalytic addition of a methyl group to the 5′ carbon atom of cytosine in CpG dinucleotides by DNA methyltransferases. In the human genome, over 98% of CpG sites are located in transcriptionally active repetitive sequence regions. As a dynamic record of the influence of environmental factors, DNA methylation has become a highly promising novel biomarker with broad applications in disease risk prediction, diagnosis, and prognostic assessment. Simultaneously, methylation site detection is also an important tool for studying epigenetic regulation, gene expression, and environment-genome interactions (e.g., Chinese invention patent CN105861644A relates to lung cancer risk prediction biomarkers; CN110982907B relates to thyroid nodule-related biomarkers).
[0004] Studies have shown that DNA methylation status is closely related to the development and progression of type 2 diabetes. For example, studies by Ling et al. and Barres et al. found that the methylation level of the PPARGC1A gene promoter region in pancreatic islet tissue and skeletal muscle of patients with type 2 diabetes was significantly lower than that in healthy controls. Furthermore, in peripheral blood, the methylation levels at specific sites of several genes (such as ABCG1, LOXL2, TXNIP, SLC1A5, and SREBF1) also showed significant differences between patients with type 2 diabetes and healthy individuals. These findings suggest that peripheral blood-based DNA methylation detection holds promise for providing earlier and more accurate prediction and diagnosis of type 2 diabetes. However, current research on peripheral blood DNA methylation in the Chinese population with type 2 diabetes remains relatively limited and requires further in-depth exploration.
[0005] In view of this, the present invention is hereby proposed. Summary of the Invention
[0006] This invention is based on the inventor's discoveries and understanding of the following facts and problems: To discover novel peripheral blood DNA methylation biomarkers associated with type 2 diabetes, the inventors recruited two type 2 diabetes case-control populations in Zhuhai City, Guangdong Province (Population 1: recruited from January to December 2022; Population 2: recruited from January to December 2023). The diagnostic criteria for type 2 diabetes were: fasting blood glucose higher than 7.0 mmol / L; or blood glucose level measured at any time of day higher than 11.1 mmol / L, accompanied by typical diabetic symptoms. Controls were healthy individuals with normal blood glucose levels. Thus, Population 1 included 223 cases and 204 controls, and Population 2 included 252 cases and 236 controls. Peripheral blood samples were collected from these populations, and DNA was extracted. Samples from Population 1 were analyzed using Illumina's Infinium Methylation EPIC BeadChip (850k chip) to detect 850,000 DNA methylation sites across the entire genome; samples from Population 2 were validated using the TaqMan probe method to identify candidate DNA methylation sites. Ultimately, the methylation site cg22131907, which exhibits hypermethylation in the peripheral blood of patients with type 2 diabetes, was successfully identified. Here, cg represents the site's number in Illumina's CpG locus database.
[0007] The first objective of this invention is to provide a DNA methylation biomarker for detecting type 2 diabetes, which is suitable for early prediction of type 2 diabetes, thereby providing a basis for the early prediction and diagnosis of type 2 diabetes and solving the aforementioned technical problems.
[0008] A second objective of this invention is to provide the use of a reagent for detecting the methylation level of DNA methylation site cg22131907 in the preparation of products for diagnosing type 2 diabetes.
[0009] A third objective of this invention is to provide a kit for diagnosing type 2 diabetes.
[0010] A fourth objective of the present invention is to provide a device for diagnosing type 2 diabetes.
[0011] To achieve the above objectives, the following technical solution is adopted: In a first aspect, the present invention provides a DNA methylation biomarker for detecting type 2 diabetes, wherein the DNA methylation biomarker is a single DNA methylation site: cg22131907. Wherein, cg represents the site's number in the Illumina CpG locus database.
[0012] As a further technical solution, subjects with higher levels of cg22131907 methylation have a higher risk of developing type 2 diabetes compared to healthy subjects.
[0013] The degree of methylation at the aforementioned DNA methylation sites can be used to predict the risk of developing type 2 diabetes in subjects, providing a basis for the early prediction and diagnosis of type 2 diabetes.
[0014] Secondly, the present invention provides the application of a reagent for detecting the methylation level of DNA methylation site cg22131907 in the preparation of products for diagnosing type 2 diabetes.
[0015] As a further technical solution, subjects with higher levels of cg22131907 methylation have a higher risk of developing type 2 diabetes compared to healthy subjects.
[0016] As a further technical solution, the reagent includes a primer pair, a first probe, and a second probe; The nucleic acid sequences of the primer pair are shown in SEQ ID NO:1 and SEQ ID NO:2; The nucleic acid sequence of the first probe is shown in SEQ ID NO:3; The nucleic acid sequence of the second probe is shown in SEQ ID NO:4.
[0017] Forward primer TGAGTAGGAAAGTAGTCGTAGGT (SEQ ID NO: 1); Backward primer ATTTCGAACCGCGATAAA (SEQ ID NO: 2); Unmethylated probe: TGGCGTTTTATTATGTCGT (SEQ ID NO: 3); The methylated probe is: TGGCGTTTTATTACGTCGT (SEQ ID NO: 4).
[0018] The methylation level of the DNA methylation markers described in this invention can be effectively detected using the Taqman probe method with the primer pairs and probes described above.
[0019] Thirdly, the present invention provides a kit for diagnosing type 2 diabetes, comprising a primer pair, a first probe, and a second probe; The nucleic acid sequences of the primer pair are shown in SEQ ID NO:1 and SEQ ID NO:2; The nucleic acid sequence of the first probe is shown in SEQ ID NO:3; The nucleic acid sequence of the second probe is shown in SEQ ID NO:4.
[0020] As a further technical solution, the test sample of the kit includes blood.
[0021] Fourthly, the present invention provides an apparatus for diagnosing type 2 diabetes, comprising a data acquisition module and a prediction module; The data acquisition module is used to acquire data on the methylation level of the DNA methylation site cg22131907 in the subject being tested. The prediction module is used to input the data of the methylation level of the DNA methylation site cg22131907 of the subject to be tested into a pre-trained prediction model, and to predict the risk of type 2 diabetes in the subject to be tested through the prediction model. The prediction model was trained using the following method: a. Obtain data on the methylation level of the DNA methylation site cg22131907 in healthy subjects and patients with type 2 diabetes; b. Use the data obtained in step a to train the prediction model and obtain the pre-trained prediction model.
[0022] As a further technical solution, the prediction model includes a logistic regression model.
[0023] As a further technical solution, the kit described above is used to obtain data on the methylation level of the DNA methylation site cg22131907.
[0024] Compared with the prior art, the present invention has the following beneficial effects: 1. The DNA methylation biomarker for detecting type 2 diabetes provided by this invention has high sensitivity and strong specificity. This biomarker can be detected using the Taqman probe method, and the detection is convenient, safe, and easy for large-scale screening.
[0025] 2. The kit for diagnosing type 2 diabetes provided by the present invention includes primers and probes for detecting the methylation level of DNA methylation site cg22131907. By detecting the degree of methylation of DNA methylation site cg22131907, the risk of developing type 2 diabetes in the subject can be predicted, providing a basis for the early prediction and diagnosis of type 2 diabetes.
[0026] 3. The device for diagnosing type 2 diabetes provided by the present invention has a simple structure and can accurately detect the risk of developing type 2 diabetes in subjects. Attached Figure Description
[0027] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0028] Figure 1 Box plot of the methylation ratio of cg22131907 site in type 2 diabetes patients and control group according to Example 3 of the present invention; a total of 223 people were in the case group and 204 people were in the control group. The difference in methylation level of DNA methylation sites between the case group and the control group was analyzed using multiple linear regression, adjusted for sex, age and body mass index. Figure 2 Box plot of the methylation ratio of cg22131907 site in type 2 diabetes patients and control group according to Example 4 of the present invention; a total of 252 people were in the case group and 236 people were in the control group. The difference in methylation level of DNA methylation sites between the case group and the control group was analyzed using multiple linear regression, adjusted for sex, age and body mass index. Figure 3 : Receiver operating characteristic (ROC) curve of cg22131907 site predicting the risk of developing type 2 diabetes according to Embodiment 5 of the present invention. Detailed Implementation
[0029] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.
[0030] Example 1 A reagent kit includes reagents comprising a primer pair, a first probe, and a second probe; The nucleic acid sequences of the primer pair are shown in SEQ ID NO:1 and SEQ ID NO:2; The nucleic acid sequence of the first probe is shown in SEQ ID NO:3; The nucleic acid sequence of the second probe is shown in SEQ ID NO:4.
[0031] Example 2 A device for diagnosing type 2 diabetes includes a data acquisition module and a prediction module; The data acquisition module is used to acquire data on the methylation level of the DNA methylation site cg22131907 in the subject being tested. The prediction module is used to input the data of the methylation level of the DNA methylation site cg22131907 of the subject to be tested into a pre-trained prediction model, and to predict the risk of type 2 diabetes in the subject to be tested through the prediction model. The prediction model was trained using the following method: a. Obtain data on the methylation level of the DNA methylation site cg22131907 in healthy subjects and patients with type 2 diabetes; b. Use the data obtained in step a to train the prediction model and obtain the pre-trained prediction model.
[0032] The prediction model is constructed from a logistic regression model.
[0033] Example 3: Collection of clinical samples to screen for methylation biomarkers in type 2 diabetes 1. Materials and Methods 1.1 Research Subjects This study included 223 cases of type 2 diabetes and 204 controls from Guangzhou, Guangdong Province, China. These individuals were recruited between January and December 2022. The diagnostic criteria for type 2 diabetes were: fasting blood glucose level higher than 7.0 mmol / L; or blood glucose level measured at any time of day higher than 11.1 mmol / L, accompanied by typical diabetic symptoms. Controls were healthy individuals with normal blood glucose levels. Population information used in this study can be found in Table 1. There were no significant differences in sex and age between the case and control groups. Peripheral blood was collected from the individuals, and DNA was extracted.
[0034] Table 1. Population information for genome-wide association studies
[0035] 1.2 DNA methylation detection and quality control The Infinium MethylationEPIC BeadChip (850k chip) from Illumina was used to detect 850,000 DNA methylation sites across the entire genome.
[0036] Quality control is divided into sample quality control and methylation site quality control.
[0037] Sample quality control is as follows: First, initial quality control of sample data was performed using GenomeStudio software, methylation module (version 1.9.0), to determine staining, extension, hybridization, target removal, bisulfite conversion, specificity, non-polymorphism, and negative controls (without background correction or normalization). Then, we retained only samples with a detection rate exceeding 95%.
[0038] The quality control of methylation sites is as follows: First, we excluded DNA methylation sites with signal values below 3 in at least 5% of the samples. Then, using the wateRmelon R package, we calculated and removed CpG sites whose detection p-values were greater than 0.05, accounting for more than 1% of the total samples. To avoid the influence of single nucleotide polymorphisms (SNPs) on DNA methylation measurements and sex bias, if an SNP was present both within the probe and at a CpG site, that CpG site was removed. We also removed probes from non-CpG sites and sex chromosome probes.
[0039] 1.3 Statistical Tests The difference in DNA methylation levels between the case group and the control group was analyzed using multiple linear regression, adjusted for sex, age, and body mass index. P-values were expressed as 1×10⁻⁶. -4 As a significance threshold across the entire genome.
[0040] 2. Results To discover novel peripheral blood DNA methylation biomarkers associated with type 2 diabetes, the inventors used Illumina's Infinium MethylationEPIC BeadChip (850k chip) to detect approximately 850,000 DNA methylation sites in the peripheral blood of 223 type 2 diabetes patients and 204 controls in Population 1. Through rigorous quality control, all samples were preserved, and 733,252 CpG sites were retained.
[0041] The inventors used multiple linear regression, adjusted for sex, age, and body mass index, to identify a series of DNA methylation sites significantly associated with type 2 diabetes (P < 1 × 10⁻⁶). -4 Among them, cg22131907 attracted our attention. This DNA methylation site was significantly higher in the case group than in the control group (P=6.9×10). -37 Appendix Figure 1 The average methylation level at this site was 32.2% in the control group and 34.7% in the case group. These results suggest that cg22131907 is a candidate peripheral blood DNA methylation biomarker associated with type 2 diabetes.
[0042] Example 4: Collection of clinical samples to validate methylation biomarkers in type 2 diabetes 1. Materials and Methods 1.1 Research Subjects This study included 252 cases of type 2 diabetes and 236 controls from Guangzhou, Guangdong Province, China. These individuals were recruited between January and December 2023. The diagnostic criteria for type 2 diabetes were: fasting blood glucose level higher than 7.0 mmol / L; or blood glucose level measured at any time of day higher than 11.1 mmol / L, accompanied by typical diabetic symptoms. Controls were healthy individuals with normal blood glucose levels. Population information used in this study can be found in Table 2. Peripheral blood was collected from these individuals, and DNA was extracted. These samples served as an independent population to verify whether there was a significant difference in cg22131907 between cases and controls.
[0043] Table 2. Population Information for the Validation Phase
[0044] 1.2 DNA methylation detection The methylation level at the cg22131907 site was detected using the TaqMan probe assay. First, the DNA was treated with sodium sulfite, followed by desulfurization and purification using a reaction column. The purified DNA was then used for subsequent PCR reactions. Forward and backward primers, as well as methylated and unmethylated probes, were designed for the cg22131907 site. The forward primer was TGAGTAGGAAAGTAGTCGTAGGT (SEQ ID NO: 1), the backward primer was ATTTCGAACCGCGATAAA (SEQ ID NO: 2), the unmethylated probe was TGGCGTTTTATTATGTCGT (SEQ ID NO: 3), and the methylated probe was TGGCGTTTTATTACGTCGT (SEQ ID NO: 4). Finally, the PCR reaction was performed.
[0045] 1.3 Statistical Tests The difference in DNA methylation levels between the case group and the control group was analyzed using multiple linear regression, adjusted for sex, age, and body mass index. A p-value of 0.05 was used as the significance threshold.
[0046] 2. Results To verify whether there was a significant difference in cg22131907 between diabetic cases and controls, the inventors used the TaqMan probe assay to detect the methylation level of the cg22131907 site. Using multiple linear regression, adjusted for sex, age, and body mass index, they found that this DNA methylation site was significantly higher in the case group than in the control group (P = 7.8 × 10⁻⁶). -21 Appendix Figure 2The average methylation level at this site was 32.6% in the control group and 34.2% in the case group. These results suggest that the inventors have confirmed cg22131907 as a peripheral blood DNA methylation marker associated with type 2 diabetes.
[0047] Example 5: Predicting the risk of developing type 2 diabetes based on discovered methylation biomarkers 1. Materials and Methods 1.1 Research Subjects The samples included in Examples 3 and 4. Detailed information on the specific research subjects can be found in the descriptions of Examples 3 and 4.
[0048] 1.2 Statistical Tests Use logistic regression to build a predictive model; use the "pROC" package in R to plot the receiver operating characteristic curve (ROC curve) and calculate the area under the curve (AUC).
[0049] 2. Experimental Results All samples from the study subjects underwent cg22131907 methylation status testing, and methylation levels were characterized using β values. To investigate the effect of cg22131907 methylation level on the predictive risk of type 2 diabetes, we first used data from the sample in Example 3 for model training. We found that the AUC for predicting the risk of type 2 diabetes using cg22131907 was 0.839.
[0050] The predictive effectiveness was then evaluated using the samples from Example 4. ROC curves were plotted, and the AUC was calculated. We found that the AUC for predicting the risk of type 2 diabetes using cg22131907 was 0.733, suggesting that the cg22131907 methylation level used in this study has some predictive value for type 2 diabetes. See Appendix. Figure 3 .
[0051] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A DNA methylation biomarker for detecting type 2 diabetes, characterized in that, The DNA methylation marker is a single DNA methylation site: cg22131907.
2. The DNA methylation marker according to claim 1, characterized in that, Compared to healthy subjects, subjects with higher levels of cg22131907 methylation had a higher risk of developing type 2 diabetes.
3. Application of reagents for detecting the methylation level of DNA methylation site cg22131907 in the preparation of products for diagnosing type 2 diabetes.
4. The application according to claim 3, characterized in that, Compared to healthy subjects, subjects with higher levels of cg22131907 methylation had a higher risk of developing type 2 diabetes.
5. The application according to claim 3, characterized in that, The reagents include primer pairs, a first probe, and a second probe; The nucleic acid sequences of the primer pair are shown in SEQ ID NO:1 and SEQ ID NO:2; The nucleic acid sequence of the first probe is shown in SEQ ID NO:3; The nucleic acid sequence of the second probe is shown in SEQ ID NO:
4.
6. A kit for diagnosing type 2 diabetes, characterized in that, The reagents include primer pairs, a first probe, and a second probe; The nucleic acid sequences of the primer pair are shown in SEQ ID NO:1 and SEQ ID NO:2; The nucleic acid sequence of the first probe is shown in SEQ ID NO:3; The nucleic acid sequence of the second probe is shown in SEQ ID NO:
4.
7. The reagent kit according to claim 6, characterized in that, The test samples for the kit include blood.
8. A device for diagnosing type 2 diabetes, characterized in that, It includes a data acquisition module and a prediction module; The data acquisition module is used to acquire data on the methylation level of the DNA methylation site cg22131907 in the subject to be tested. The prediction module is used to input the data of the methylation level of the DNA methylation site cg22131907 of the subject to be tested into a pre-trained prediction model, and to predict the risk of type 2 diabetes in the subject to be tested through the prediction model. The prediction model was trained using the following method: a. Obtain data on the methylation level of the DNA methylation site cg22131907 in healthy subjects and patients with type 2 diabetes; b. Use the data obtained in step a to train the prediction model and obtain the pre-trained prediction model.
9. The apparatus according to claim 8, characterized in that, The prediction model includes a logistic regression model.
10. The apparatus according to claim 8, characterized in that, Data on the methylation level of the DNA methylation site cg22131907 were obtained using the kit according to any one of claims 6 or 7.
Citation Information
Patent Citations
DNA methylation marker for prediction of generation risks of lung cancer and detection method and kit thereof
CN105861644A
Thyroid nodule-associated rDNA methylation markers and their applications
CN110982907B