A primer composition, kit and application for detecting rifampicin resistance of mycobacterium tuberculosis complex

By designing primer compositions that combine ARMS-PCR technology with specific and blocking primers, the problems of long detection cycles, low sensitivity, and incomplete site coverage in the detection of rifampicin resistance in Mycobacterium tuberculosis complex were solved, achieving rapid, sensitive, and accurate detection results.

CN122146908APending Publication Date: 2026-06-05BEIJING SINOMDGENE TECH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610572417.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-28
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing technologies for detecting rifampicin resistance in Mycobacterium tuberculosis complex groups suffer from problems such as long detection cycles, low sensitivity in detecting heterogeneous resistance, and incomplete coverage of detection sites, failing to meet the requirements for rapid, sensitive, and accurate detection.

Method used

A primer composition for detecting rifampicin resistance in Mycobacterium tuberculosis complex was designed. Using ARMS-PCR technology, specific primers and blocking primers were combined to amplify and detect multiple rpoB gene loci. The fluorescence signal was detected using TaqMan probes, achieving efficient detection of rifampicin resistance.

Benefits of technology

It achieves comprehensive coverage of high-frequency mutation sites, improves detection sensitivity by 40 times, can complete detection within 1 hour, is suitable for low-concentration samples, reduces the risk of missed detection and false positive results, and improves detection efficiency and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146908A_ABST
    Figure CN122146908A_ABST
Patent Text Reader

Abstract

The application discloses a primer composition, a kit and application for detecting rifampicin resistance of mycobacterium tuberculosis complex, and belongs to the technical field of biological medicine. The application provides a primer composition for rapidly, sensitively and comprehensively detecting rifampicin resistance of mycobacterium tuberculosis complex, and aims to solve problems of long detection period, low sensitivity of heterogenic resistance detection and incomplete coverage of mutation detection sites in the prior art. The technical scheme of the application is characterized in that a primer composition for detecting rifampicin resistance of mycobacterium tuberculosis complex is provided, at least one group of first primer pairs for specifically amplifying rifampicin resistance related sites is included, a key gene fragment of drug resistance can be efficiently amplified, high-sensitivity detection of heterogenic resistance is realized, and main drug resistance mutation sites are comprehensively covered.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically the field of molecular biology identification technology, and relates to a primer composition, kit, and application for detecting rifampicin resistance in Mycobacterium tuberculosis complex. Background Technology

[0002] For understanding the technical content of this invention: Tuberculosis (TB) is one of the leading causes of death from a single infectious source worldwide, posing a significant public health concern. Rifampicin (RIF), one of the most important first-line anti-TB drugs, works by specifically binding to the β subunit of Mycobacterium tuberculosis RNA polymerase (encoded by the rpoB gene), blocking transcriptional elongation. However, mutations in specific regions of the Mycobacterium tuberculosis rpoB gene, particularly mutations in the 81bp rifampicin resistance-determining region (RRDR), can significantly alter the conformation of RNA polymerase, reducing rifampicin binding affinity and leading to drug resistance. This results in rifampicin treatment failure or even ineffectiveness, further exacerbating the spread and control of TB.

[0003] Currently, methods for identifying drug resistance in Mycobacterium tuberculosis are mainly divided into two categories: (1) Traditional phenotypic drug susceptibility testing (DST): This method observes the inhibitory effect of drugs on bacterial growth through in vitro culture and is the gold standard for drug resistance detection, capable of identifying the most infectious patients. (2) Molecular biological detection methods: These methods have faster detection speeds; for example, the melting curve method is one of the commonly used techniques. In addition, some studies have used Amplification Refractory Mutation System (ARMS)-PCR technology for detection.

[0004] Relevant patent documents retrieved: The patent, published in China (CN109112226A) on January 1, 2019, entitled "A Method and Reagent Kit for Simultaneous Detection of Rifampicin and Isoniazid Resistance Gene Point Mutations in Mycobacterium tuberculosis," discloses a method and reagent kit for simultaneously detecting rifampicin and isoniazid resistance gene point mutations in Mycobacterium tuberculosis. Based on ARMS (Analogous Real-Time PCR), this patent uses mutant ARMS primers targeting the resistance gene mutation sites and ARMS primers targeting the wild-type template, along with their shared upstream or downstream primers, in the same reaction system. Both mutant and wild-type reaction tubes are used to detect the same sample. The drug resistance status of the sample is determined by the Ct and ΔCt values ​​of each detection site in the two reaction tubes. This invention is simple to operate and can perform Mycobacterium tuberculosis drug resistance detection in a short time using multiplex PCR.

[0005] Relevant non-patent literature retrieved: The journal title is *Journal of Hebei Medical University*, and the article title is "Methodological Study on Drug Susceptibility Testing of Mycobacterium tuberculosis using Sensititre® Tuberculosis Drug Susceptibility Plate," Volume No. 2016, 37(02):187-190, Publication Date: February 15, 2016. This article discloses the use of Sensititre® tuberculosis drug susceptibility plate and LJ ratio method to conduct drug susceptibility tests on 124 clinical isolates of Mycobacterium tuberculosis complex (including isoniazid, rifampin, ethambutol, streptomycin, ofloxacin, moxifloxacin, amikacin, rifabutin, para-aminosalicylic acid, ethionamide, cycloserine, and kanamycin), and compares the results of the two methods. The results show that both methods have good sensitivity and specificity, and the concordance rate for the detection results of the above drugs is above 90.0%.

[0006] The journal title is "Shenzhen Journal of Integrated Traditional and Western Medicine", the article title is "Evaluation of the Value of Fluorescent PCR Probe Melting Curve Method for Mycobacterium tuberculosis Complex Resistance to Rifampicin and Isoniazid", volume number 2021, 31(10):46-48, publication date 2021.05.30. This article explores the evaluation effect of using fluorescent polymerase chain reaction (PCR) probe melting curve method to detect Mycobacterium tuberculosis complex (MTBC) resistance to rifampicin and isoniazid. The results show that the fluorescent PCR probe melting curve method has high detection efficiency for MTBC resistance to rifampicin and isoniazid, and the consistency rate of the detection results with the proportional method drug susceptibility test is high.

[0007] The prior art represented by the aforementioned documents has at least the following unresolved technical problems or defects: (1) Long detection cycle: The phenotypic drug susceptibility test method used in the non-patent literature "Methodological study of drug susceptibility testing of Mycobacterium tuberculosis using Sensititre® tuberculosis drug susceptibility plate" has a long detection cycle (requiring several weeks to several months), which cannot meet the needs of rapid clinical diagnosis, may delay patient treatment, and increase the risk of transmission. At the same time, its accuracy is easily affected by culture conditions, and there is a risk of false positives or false negatives.

[0008] (2) Low sensitivity in detecting heterogeneous drug resistance: The melting curve method used in the non-patent literature "Value of Fluorescent PCR Probe Melting Curve Method for Evaluating the Resistance of Mycobacterium tuberculosis Complex to Rifampin and Isoniazid" still has a long detection time and high requirements for instruments. More importantly, the melting curve method has low sensitivity for detecting heterogeneous drug-resistant samples (i.e., samples containing both sensitive and drug-resistant bacteria) (usually only samples with a mutation rate >40%), and is prone to false positive results due to silent mutations.

[0009] (3) Incomplete detection site coverage: Although patent literature CN109112226A has realized the detection of rifampicin and isoniazid resistance genes based on ARMS-PCR technology, it only covers 5 mutation sites of the rpoB gene (rpoB516 A>T, rpoB526 C>T / G, rpoB531 C>G / T). Other high-frequency mutation sites with high carrier rates in the population cannot be detected, which poses a risk of missed detection. In addition, the sensitivity of this method is low, with a sensitivity of only 10 copies / reaction.

[0010] Therefore, there is an urgent need in this field for a method and product that can rapidly, sensitively, and accurately detect rifampicin resistance mutations in Mycobacterium tuberculosis complexes, especially one that can cover more high-frequency mutation sites and efficiently detect heterogeneous resistance. Summary of the Invention

[0011] The purpose of this invention is to provide: A primer composition, kit, and application for detecting rifampicin resistance in Mycobacterium tuberculosis complex, and related technologies, to solve technical problems such as long detection cycle, low sensitivity of heterogeneous drug resistance detection, or incomplete coverage of detection sites in existing technologies, or combinations thereof.

[0012] Terminology Explanation: Unless otherwise defined, all technical terms in this document have the same meanings as commonly understood by one of ordinary skill in the art to which the subject matter of the claims pertains. Unless otherwise stated, all patents, patent inventions, and publications cited in this document are incorporated herein by reference in their entirety. If multiple definitions exist for terms in this document, the definitions in this chapter shall prevail.

[0013] It should be understood that the above brief description and the following detailed description are exemplary and for illustrative purposes only, and do not limit the subject matter of the invention in any way. In this invention, the singular is used in conjunction with the plural unless otherwise specifically stated. It should also be noted that, unless otherwise stated, the use of “or” or “or” means “and / or”. Furthermore, the use of the term “comprising” and other forms such as “including,” “containing,” and “contains” are not limiting.

[0014] Definitions of standard terms can be found in the references “Molecular Cloning: A Laboratory Manual (3rd Edition), Science Press, authors: J. Sambrook and DW Russell, 2002.11”, “Modern Molecular Biology (5th Edition), Higher Education Press, authors: Zhu Yuxian, Li Yi, Zheng Xiaofeng and Guo Hongwei, 2019-06-19”, and “Genetic Engineering, Higher Education Press, 2013-08-01”.

[0015] Unless otherwise stated, conventional methods within the scope of the art, such as flow cytometry, real-time quantitative PCR (qPCR), eukaryotic transcriptome analysis, and cell differentiation identification, shall be used.

[0016] Unless specifically defined herein, the use of all commercially available products herein employs standard techniques. For example, it may be carried out using the manufacturer's instructions for use with the kit, or in accordance with methods known in the art or the description of this invention. The techniques and methods described herein can generally be implemented according to conventional methods well known in the art, based on the descriptions in the various summary and more specific documents cited and discussed in this specification.

[0017] The terms “optional / arbitrary” or “optionally / arbitrarily” mean that the event or situation described below may or may not occur, including both the occurrence and non-occurrence of the event or situation.

[0018] The term "Mycobacterium tuberculosis complex" used in this article refers to a group of mycobacteria with highly similar genomes that cause tuberculosis. It mainly includes Mycobacterium tuberculosis (MTB), Mycobacterium africanum, Mycobacterium canetti, Mycobacterium bovis, and Mycobacterium microti, among others.

[0019] As used in this article, "rifampin" refers to 3-[[(4-methyl-1-piperazinyl)imino]methyl]rifamycin, an organic compound with the chemical formula C64. 43 H 58 N4O 12 Rifamycin is a broad-spectrum antibiotic belonging to the rifamycin family. It has a strong antibacterial effect against Mycobacterium tuberculosis and is also effective against Gram-positive or Gram-negative bacteria and viruses. It is mainly used to treat tuberculosis, meningitis, and Staphylococcus aureus infection. Topical application can treat trachoma, etc.

[0020] The term "site" used in this article refers to a specific functional location in a chromosome or DNA sequence. In biology, it refers to both the physical location of a gene on a chromosome and regions on DNA that have expression or regulatory functions, also known as targets or markers.

[0021] The term "drug resistance" as used in this article refers to the tolerance of microorganisms, parasites, and tumor cells to the effects of chemotherapy drugs. Once drug resistance develops, the effectiveness of chemotherapy drugs is significantly reduced. Drug resistance can be divided into acquired resistance and natural resistance based on its cause.

[0022] The term "mutation" as used in this article refers to any heritable or non-heritable change in the genetic material DNA of an organism, including gene mutations and chromosomal aberrations. Mutations are mainly caused by DNA replication errors or external mutagenic factors, and can be classified into types such as base substitution, insertion, and deletion.

[0023] The term "rpoB" used in this article refers to the rpoB gene, a key gene in bacteria (such as Mycobacterium tuberculosis) that encodes the β subunit of RNA polymerase. The protein it expresses is the target of the antibiotic rifampin. The rpoB gene detection is a molecular detection technology that analyzes the mutations in the rpoB gene of pathogens to determine whether they have developed resistance to specific antibiotics. It is mainly used for screening Mycobacterium tuberculosis for drug resistance and guiding precision treatment of tuberculosis.

[0024] As used in this article, "primer" refers to a synthetically produced short oligonucleotide, typically 18-25 bases in length. In a PCR reaction, the primer binds complementary to a specific region of the template DNA, providing a starting point for DNA polymerase to extend the DNA.

[0025] As used in this article, the term "probe" refers to an oligonucleotide fragment labeled with both a fluorescent and a quenching group. In TaqMan quantitative PCR, the probe specifically binds to the target sequence between the primer and the target. During PCR amplification, the 5'→3' exonuclease activity of Taq DNA polymerase cleaves the probe, separating the fluorescent and quenching groups and releasing a fluorescent signal. The intensity of this signal reflects the amplification of the target DNA.

[0026] The term "blocking primer" as used in this article refers to a specially modified oligonucleotide whose 3' end is blocked (e.g., by adding an MGB group or a C3 spacer), preventing extension in a PCR reaction. Its sequence perfectly matches the wild-type template, and its Tm value is higher than that of the upstream primer. In the reaction, the blocking primer preferentially binds to the wild-type template, preventing non-specific amplification of the upstream primer, thereby significantly improving the specificity of the detection system for mutant templates, especially suitable for samples with a high wild-type background.

[0027] The term "external control" as used in this article refers to endogenous controls or internal references. Designing primer and probe systems targeting conserved housekeeping genes or conserved regions in biological samples that do not induce drug resistance is crucial for monitoring the quality of nucleic acid extraction, the presence of PCR inhibitors, and the proper functioning of the PCR reaction system. This is an important quality control measure to ensure the validity and reliability of test results.

[0028] The term "amplification-restricted mutant system (ARMS)" as used in this article refers to allele-specific PCR, also known as allele-specific PCR. This method utilizes the lack of 3'→5' exonuclease activity in Taq DNA polymerase. Specific primers are designed to have their 3' terminal nucleotides complementary to either a mutant or wild-type template. During PCR, primers that perfectly match the template can extend and amplify effectively, while primers with mismatches cannot extend, thus enabling the detection of mutation sites. This invention uses ARMS-PCR technology, taking advantage of the lack of 3'→5' exonuclease activity in Taq DNA polymerase. Allele-specific extension is controlled through 3' terminal primer design, and fluorescence signal values ​​are detected using TaqMan probes to distinguish between wild-type and mutant alleles. By designing the 3' terminal nucleotides of the upstream primers for alleles to be identical to the mutant site and different from the wild-type site, under the action of Taq DNA polymerase, upstream primers that do not perfectly match the negative template will not form complete complementary base pairs, resulting in mismatches and no PCR product. Conversely, primer systems that match the positive template can amplify the corresponding PCR product. A TaqMan probe is placed between the forward and reverse primers. During PCR amplification, Taq DNA polymerase has 5'→3' exonuclease activity to cleave the probe, and the fluorescent group on the probe can generate a fluorescent signal that can be detected by the instrument.

[0029] In a first aspect, the present invention provides: a primer composition for detecting rifampicin resistance in Mycobacterium tuberculosis complex, the primer composition comprising a first primer for detecting the rifampicin resistance site; The nucleotide sequence of the first primer includes the sequences shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:27, or sequences that have at least 85% sequence identity with the shown sequences.

[0030] Further, the nucleotide sequence of the first primer includes sequences as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:27, or sequences having at least 90% sequence identity with the shown sequences.

[0031] Furthermore, the nucleotide sequence of the first primer includes sequences as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:27, or sequences having at least 95% sequence identity with the shown sequences.

[0032] Furthermore, the nucleotide sequence of the first primer includes sequences as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:27, or sequences having at least 99% sequence identity with the shown sequences.

[0033] Preferably, the nucleotide sequence of the first primer includes the sequences shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:27.

[0034] For example, the nucleotide sequence of the first primer is identical to the sequences shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:27, having a sequence identity of at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any value within the range of any two of the above values.

[0035] According to some embodiments of the present invention, the sites for detecting rifampicin resistance in the Mycobacterium tuberculosis complex include 12 sites of the rpoB gene: L511P, D516V, D516Y, H526D, H526L, H526N, H526R, H526Y, S531F, S531L, S531W, and L533P.

[0036] Specifically: (1) Specific primers for detecting L511P include: forward primer (Seq ID NO.2) and reverse primer (Seq ID NO.3); (2) Specific primers for detecting D516V include: forward primer (Seq ID NO.6) and reverse primer (Seq ID NO.3); (3) Specific primers for detecting D516Y include: forward primer (Seq ID NO.9) and reverse primer (Seq ID NO.3); (4) Specific primers for detecting H526D include: forward primer (Seq ID NO.11) and reverse primer (Seq ID NO.3); (5) Specific primers for detecting H526L include: forward primer (Seq ID NO.14) and reverse primer (Seq ID NO.3); (6) Specific primers for detecting H526N include: forward primer (Seq ID NO.16) and reverse primer (Seq ID NO.3); (7) Specific primers for detecting H526R include: forward primer (Seq ID NO.18) and reverse primer (Seq ID NO.3); (8) Specific primers for detecting H526Y include: forward primer (Seq ID NO.20) and reverse primer (Seq ID NO.3); (9) Specific primers for detecting S531F include: forward primer (Seq ID NO.22) and reverse primer (Seq ID NO.3); (10) Specific primers for detecting S531L include: forward primer (Seq ID NO.22) and reverse primer (Seq ID NO.3); (11) Specific primers for detecting S531W include: forward primer (Seq ID NO.25) and reverse primer (Seq ID NO.3); (12) Specific primers for detecting L533P include: forward primer (Seq ID NO.27) and reverse primer (Seq ID NO.3).

[0037] According to some embodiments of the present invention, the primer composition can be stored or used in the form of lyophilized powder or solution dissolved in buffer.

[0038] According to some embodiments of the present invention, the primer composition further includes a first probe for detecting the rifampicin resistance site and a blocking primer, wherein the nucleotide sequence of the first probe includes the sequence shown in SEQ ID NO:4 or a sequence having at least 85% sequence identity with the shown sequence, and the nucleotide sequence of the blocking primer includes the sequences shown in SEQ ID NO:7, SEQ ID NO:12, SEQ ID NO:23 or a sequence having at least 85% sequence identity with the shown sequence.

[0039] Furthermore, the nucleotide sequence of the first probe includes the sequence shown in SEQ ID NO:4 or a sequence having at least 90% sequence identity with the shown sequence.

[0040] Furthermore, the nucleotide sequence of the first probe includes the sequence shown in SEQ ID NO:4 or a sequence having at least 95% sequence identity with the shown sequence.

[0041] Preferably, the nucleotide sequence of the first probe is as shown in SEQ ID NO:4.

[0042] For example, the nucleotide sequence of the first probe is identical to the sequence shown in SEQ ID NO:4 with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any value within the range of any two of the above values.

[0043] Furthermore, the nucleotide sequence of the blocking primer includes sequences as shown in SEQ ID NO:7, SEQ ID NO:12, and SEQ ID NO:23, or sequences that have at least 90% sequence identity with the shown sequences.

[0044] Furthermore, the nucleotide sequence of the blocking primer includes sequences as shown in SEQ ID NO:7, SEQ ID NO:12, and SEQ ID NO:23, or sequences that have at least 95% sequence identity with the shown sequences.

[0045] Preferably, the nucleotide sequence of the blocking primer includes the sequences shown in SEQ ID NO:7, SEQ ID NO:12, and SEQ ID NO:23.

[0046] For example, the nucleotide sequence of the blocking primer is identical to the sequence shown in SEQ ID NO:7, SEQ ID NO:12, and SEQ ID NO:23 with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any value within the range of any two of the above values.

[0047] According to some embodiments of the present invention, at least one nucleotide in the blocking primer is a modified nucleotide. For example, in the rpoB_D516V site blocking primer sequence, one nucleotide is an LNA-modified nucleotide.

[0048] Secondly, the present invention provides the application of the above primer composition in the preparation of a kit for detecting rifampicin resistance in Mycobacterium tuberculosis complex, wherein the application is for non-disease diagnosis and treatment purposes.

[0049] Thirdly, the present invention provides a kit for detecting rifampicin resistance in Mycobacterium tuberculosis complex, the kit comprising the primer composition described above.

[0050] According to some embodiments of the present invention, the kit further includes a second primer and a second probe for detecting an externally controlled gene, wherein the nucleotide sequence of the second primer includes the sequence shown in SEQ ID NO:29, SEQ ID NO:30 or a sequence having at least 85% sequence identity with the shown sequence, and the second probe includes the sequence shown in SEQ ID NO:31 or a sequence having at least 85% sequence identity with the shown sequence.

[0051] Furthermore, the nucleotide sequence of the second primer includes sequences as shown in SEQ ID NO:29 and SEQ ID NO:30, or sequences that have at least 90% sequence identity with the shown sequences.

[0052] Furthermore, the nucleotide sequence of the second primer includes sequences as shown in SEQ ID NO:29 and SEQ ID NO:30, or sequences that have at least 95% sequence identity with the shown sequences.

[0053] Preferably, the nucleotide sequence of the second primer includes the sequences shown in SEQ ID NO:29 and SEQ ID NO:30.

[0054] For example, the nucleotide sequence of the second primer is identical to the sequence shown in SEQ ID NO:29 and SEQ ID NO:30 with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any value within the range of any two of the above values.

[0055] Furthermore, the nucleotide sequence of the second probe includes the sequence shown in SEQ ID NO:31 or a sequence having at least 90% sequence identity with the shown sequence.

[0056] Furthermore, the nucleotide sequence of the second probe includes the sequence shown in SEQ ID NO:31 or a sequence having at least 95% sequence identity with the shown sequence.

[0057] Preferably, the nucleotide sequence of the second probe is as shown in SEQ ID NO:31.

[0058] For example, the nucleotide sequence of the second probe is identical to the sequence shown in SEQ ID NO:31 with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any value within the range of any two of the above values.

[0059] According to some embodiments of the present invention, the kit further includes a PCR reaction solution.

[0060] Preferably, the PCR reaction solution may include Taq DNA polymerase, dNTPs, and Mg. 2+ At least one of the following: and reaction buffer.

[0061] According to some embodiments of the present invention, the kit may further include a positive control and / or a negative control; preferably, the positive control comprises a recombinant plasmid or an inactivated strain of each rifampicin resistance (mutation) site within the detection range; the negative control is wild-type strain DNA without mutation sites or sterile water.

[0062] According to some embodiments of the present invention, the kit can be used for the detection of rifampicin resistance in Mycobacterium tuberculosis complex. The detection method includes detecting rifampicin resistance sites in the genome of the sample to be tested using the aforementioned primer composition or kit. The method described is not a disease diagnosis or treatment method.

[0063] According to some embodiments of the present invention, the detection method includes the following steps: S1, In the same reaction system, the DNA sample of Mycobacterium tuberculosis complex was amplified by ARMS-PCR using the primer composition or the kit to obtain the Ct value of each site and the Ct value of the external control gene. S2, calculate the ΔCt value. ΔCt value = site Ct value - external control Ct value. When the ΔCt value ≤ 11, the site is determined to be mutation positive. When the ΔCt value > 11, the site is determined to be mutation negative. If any site is determined to be mutation positive, it is interpreted as rifampicin resistance. If all sites are mutation negative, it is interpreted as rifampicin sensitivity.

[0064] For example, the reaction system includes: PCR reaction solution, corresponding first / second primers, probes, and DNA samples. For the detection of D516V, D516Y, H526D, H526R, H526Y, S531F, S531L, and S531W sites, corresponding blocking primers also need to be added.

[0065] Preferably, based on the shared primers, probes, and blockers, the reaction can be divided into 3 reaction tubes and 1 external control (internal control) tube: Reaction tube 1: L511P, S531W, S531L, S531F sites (shared reverse primers and probes); Reaction tube 2: D516V, D516Y, H526D, H526R, H526Y (shared reverse primers and probes; D516 sites share one blocker, H526 sites share another blocker); Reaction tube 3: H526N, H526L, L533P sites (shared reverse primers and probes); External control tube: conserved region of the rpoB gene (independent reaction tube, or as an internal control channel for multiplex reactions).

[0066] Furthermore, the reaction procedure for ARMS-PCR amplification includes: pre-denaturation at 94℃-96℃ for 1-3 minutes; followed by 42-47 cycles of denaturation at 94℃-96℃ for 18-22 seconds, annealing at 58℃-62℃, extension, and fluorescence collection for 40-50 seconds.

[0067] For example, the reaction procedure for ARMS-PCR amplification includes: pre-denaturation at 95°C for 2 minutes; followed by 45 cycles of denaturation at 95°C for 20 seconds, annealing at 60°C, extension, and fluorescence collection for 45 seconds.

[0068] Fourthly, the present invention provides the use of the above-described primer composition or the above-described kit in the preparation of a product for the detection of rifampicin resistance in Mycobacterium tuberculosis complex, wherein the use is for non-disease diagnosis and treatment purposes.

[0069] The non-disease diagnosis and treatment purposes include at least one of the following: scientific research, drug screening, monitoring of Mycobacterium tuberculosis drug resistance, public health monitoring, environmental sample testing, or quality control of reagent kits.

[0070] Specifically, scientific research may include: studies on the drug resistance mechanisms of Mycobacterium tuberculosis, analysis of drug resistance gene mutation profiles, etc.; drug screening may include: evaluating the inhibitory effects of novel anti-tuberculosis drugs on drug-resistant strains; drug resistance monitoring may include: monitoring the prevalence of drug resistance in Mycobacterium tuberculosis by public health institutions; environmental sample testing may include: detecting the presence of drug-resistant Mycobacterium tuberculosis contamination in environmental samples (such as medical wastewater and laboratory samples); and reagent kit quality control may include: quality testing to ensure batch-to-batch consistency of reagent kits during the production process.

[0071] Examples 1-2 of this invention at least support the protection scope of "primer composition for detecting rifampicin resistance in Mycobacterium tuberculosis complex".

[0072] The "primer composition for detecting rifampicin resistance in Mycobacterium tuberculosis complex" is derived from the foregoing explanation and / or the corresponding primers in Examples 1-2. Therefore, those skilled in the art can reasonably presume that the "primer composition for detecting rifampicin resistance in Mycobacterium tuberculosis complex," its subordinate concepts, its substantially equivalent technical means, and technical means that can replace it based on the existing level of technology and within the scope of conventional technical means and common knowledge, should all fall within the protection scope of the "primer composition for detecting rifampicin resistance in Mycobacterium tuberculosis complex."

[0073] Examples 1-2 of this invention at least support the protection scope of the "reagent kit".

[0074] The term "reagent kit" is derived from the foregoing explanation and / or the corresponding reagent kits in Examples 1-2. Therefore, those skilled in the art can reasonably presume that "reagent kit," its subordinate concepts, its substantially equivalent technical means, and technical means that can replace it within the scope of conventional technical means and common knowledge based on the existing level of technology should all fall within the protection scope of "reagent kit."

[0075] The present invention has at least the following beneficial effects: Compared with existing technologies, this invention provides a primer composition, kit, method, and application for detecting rifampicin resistance in Mycobacterium tuberculosis complex, which has better technical effects, specifically reflected in the following aspects: (1) Comprehensive detection site coverage: The primer composition of the present invention can detect more than 97% of the high-frequency mutations related to rifampicin resistance in the Chinese population, effectively reducing the risk of missed detection.

[0076] (2) High sensitivity for detecting heterogeneous drug-resistant samples: The primer composition and kit of this invention can stably detect heterogeneous drug-resistant samples with a mutation frequency as low as 1% against a background of 500 copies of total nucleic acid. Compared with the detection limit (>40%) of the melting curve method, the detection sensitivity of this invention is improved by more than 40 times, which can effectively detect early drug-resistant and low-proportion drug-resistant strains, providing a more reliable basis for precision medicine in clinical practice.

[0077] (3) Solved the problem of detection sensitivity for low concentrations of drug-resistant bacteria: The primer composition and kit of the present invention can detect drug-resistant mutation sites with a sensitivity of up to 2.5 copies / reaction, which can meet the detection needs of low concentration samples in clinical practice.

[0078] (4) Low non-specific amplification: After adding Blocker to the kit of the present invention, non-specific amplification of sensitive samples is effectively suppressed, and the detection efficiency of mutant samples is basically unaffected. The detection specificity is significantly improved, ensuring the accuracy of the results.

[0079] (5) Short detection cycle: The primer composition and kit of the present invention are adapted to ARMS-PCR technology, which can effectively shorten the detection time to 1 hour and 40 minutes. Compared with phenotypic drug susceptibility testing (several weeks), the detection efficiency is increased by hundreds of times; compared with melting curve method (several hours), the detection time is shortened by more than 50%.

[0080] (6) High detection efficiency: The primer composition of the present invention can detect 12 sites using 4 reactions, effectively reducing the amount of sample used and improving detection efficiency.

[0081] Considering the possibility of this invention entering other countries, this invention also provides the following technical solutions: A method for diagnosing whether a tuberculosis patient is infected with a rifampicin-resistant strain, the method comprising detecting rifampicin-resistant strains in the subject using the primer composition described above or the kit described above.

[0082] The subjects include mammals and / or humans.

[0083] The subjects are preferably human. Attached Figure Description

[0084] Figure 1 The graph shows the detection effect of the primer composition in Example 2 on the L511P heterogeneous drug resistance reference in Effect Example 2.

[0085] Figure 2 The graph shows the detection effect of the primer composition in Example 2 on the S531W heterogeneous drug resistance reference in Effect Example 2.

[0086] Figure 3 The graph shows the detection effect of the primer composition in Example 2 on the S531F heterogeneous drug resistance reference in Effect Example 2.

[0087] Figure 4 The graph shows the detection effect of the primer composition in Example 2 on the S531L heterogeneous drug resistance reference in Effect Example 2.

[0088] Figure 5 The graph shows the detection effect of the primer composition in Example 2 on the D516V heterogeneous drug resistance reference in Effect Example 2.

[0089] Figure 6 The graph shows the detection effect of the primer composition in Example 2 on the D516Y heterogeneous drug resistance reference in Effect Example 2.

[0090] Figure 7 The graph shows the detection effect of the primer composition in Example 2 on the H526D heterogeneous drug resistance reference in Effect Example 2.

[0091] Figure 8The graph shows the detection effect of the primer composition in Example 2 on the H526R heterogeneous drug resistance reference in Effect Example 2.

[0092] Figure 9 The graph shows the detection effect of the primer composition in Example 2 on the H526Y heterogeneous drug resistance reference in Effect Example 2.

[0093] Figure 10 The graph shows the detection effect of the primer composition in Example 2 on the H526N heterogeneous drug resistance reference in Effect Example 2.

[0094] Figure 11 The graph shows the detection effect of the primer composition in Example 2 on the H526L heterogeneous drug resistance reference in Effect Example 2.

[0095] Figure 12 The graph shows the detection effect of the primer composition in Example 2 on the L533P heterogeneous drug resistance reference in Effect Example 2. Detailed Implementation

[0096] Unless otherwise specified, all raw materials and reagents used in this invention were purchased from commercial suppliers, and experiments were conducted in accordance with the operating instructions. Unless otherwise specified, all instruments, equipment, and apparatus used in this invention are conventional instruments, equipment, and apparatus, and experiments were conducted in accordance with the operating instructions and the accompanying reagents.

[0097] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified in the embodiments, conditions are performed under conventional conditions or conditions recommended by the manufacturer. All reagents or instruments without specified manufacturers are commercially available conventional products. Numerous specific details are provided in the following detailed embodiments to better illustrate the invention. The specific embodiments described herein are for illustrative purposes only and are not intended to constitute any limitation on the invention.

[0098] Data analysis and statistical analysis were performed using professional data processing software, and significance analysis was conducted using one-way ANOVA. P <0.05 indicates a significant difference.

[0099] The main instrument used in the following examples is a real-time PCR instrument (Shanghai Hongshi Medical Technology Co., Ltd., SLAN-96S).

[0100] Example 1: Detection Site Selection The present invention selects the following 12 sites as detection sites, as shown in Table 1.

[0101] Table 1

[0102] Example 2 Primer composition and kit for detecting rifampicin resistance in Mycobacterium tuberculosis complex (1) Design and synthesis of detection primers (forward and reverse primers), probes, and blockers. Based on the target sequences of rpoB, primers and probes were designed for detection at the L511P site; the D516V / Y site; the H526D / R / Y / N / L site; the S531W / L / F site; the L533P site; and primers and probes for the external control rpoB gene (internal reference). All primers and probes were designed independently by this invention and synthesized by Sangon Biotech (Shanghai) Co., Ltd., and their specific sequences are shown in Table 2.

[0103] Table 2

[0104] The specific primer and probe sequences are as follows: (1) rpoB_L511P site target sequence Seq ID NO.1: TCGGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTGCCCGATCGAAACCCCTGAGGGGCCCAACATCGGTCTGATCG.

[0105] (2) rpoB_L511P forward primer sequence Seq ID NO.2: TCGGCACCAGCCAGCC.

[0106] (3) rpoB_L511P / D516V / D516Y / H526D / H526L / H526N / H526R / H526Y / S531F / S531L / S531W / L533P reverse primer sequence Seq ID NO.3: CGATCAGACCGATGTTG.

[0107] (4) rpoB_L511P / D516V / D516Y / H526D / H526L / H526N / H526R / H526Y / S531F / S531L / S531W / L533P probe sequence Seq ID NO.4: FAM-AGCCCGGCACGCTCACGTGACA-BHQ1.

[0108] (5) rpoB_D516V site target sequence Seq ID NO.5: CAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTGCCCGATCGAAACCCCTGAGGGGCCCAACATCGGTCTGATCG.

[0109] (6) Forward primer sequence for rpoB_D516V site, Seq ID NO.6: CAGCTGAGCCAATTCATGGT.

[0110] (7) Blocker sequence of rpoB_D516V site, Seq ID NO.7 TCATGGACCAGAACA-MGB. (Where the sixth letter G is an LNA modifier) (8) rpoB_D516Y target sequence Seq ID NO.8: GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTGCCCGATCGAAACCCTGAGGGGCCCAACATCGGTCTGATCG.

[0111] (9) rpoB_D516Y forward primer sequence Seq ID NO.9: GCCAGCTGAGCCAATTCATGT.

[0112] (10) rpoB_H526D site target sequence Seq ID NO.10: CGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTGCCCGATCGAAACCCCTGAGGGGCCCAACATCGGTCTGATCG.

[0113] (11) Forward primer sequence for rpoB_H526D site, Seq ID NO.11: CGCTGTCGGGGTTGACCG.

[0114] (12) Blocker sequence of rpoB_H526D site, Seq ID NO.12: GTTGACCCACAAGCG-MGB.

[0115] (13) rpoB_H526L site target sequence Seq ID NO.13: CTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTGCCCGATCGAAACCCCTGAGGGGCCCAACATCGGTCTGATCG.

[0116] (14) Forward primer sequence for rpoB_H526L site, Seq ID NO.14: GCTGTCGGGGTTGACCCT.

[0117] (15) rpoB_H526N site target sequence Seq ID NO.15: CCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTGCCCGATCGAAACCCTGAGGGGCCCAACATCGGTCTGATCG.

[0118] (16) Forward primer sequence for rpoB_H526N site, Seq ID NO.16: CCGCTGTCGGGGTTGACCA.

[0119] (17) rpoB_H526R site target sequence Seq ID NO.17: GCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTGCCCGATCGAAACCCCTGAGGGGCCCAACATCGGTCTGATCG.

[0120] (18) Forward primer sequence for rpoB_H526R site, Seq ID NO.18: GCTGTCGGGGTTGACCCG.

[0121] (19) rpoB_H526Y site target sequence Seq ID NO.19: GCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTGCCCGATCGAAACCCCTGAGGGGCCCAACATCGGTCTGATCG.

[0122] (20) Forward primer sequence for rpoB_H526Y site, Seq ID NO.20: GCTGTCGGGGTTGACCT.

[0123] (21) rpoB_S531F / S531L site target sequence Seq ID NO.21: ACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTGCCCGATCGAAACCCCTGAGGGGCCCAACATCGGTCTGATCG.

[0124] (22) Forward primer sequence for rpoB_S531F / S531L site, Seq ID NO.22: ACACAAGCGCCGACTGTT.

[0125] (23) Blocker sequence of rpoB_S531F / S531L / S531W site, Seq ID NO.23: CGACTGTCGGCGCT-MGB.

[0126] (24) rpoB_S531W target sequence Seq ID NO.24: CCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTGCCCGATCGAAACCCCTGAGGGGCCCAACATCGGTCTGATCG.

[0127] (25) Forward primer sequence for rpoB_S531W site, Seq ID NO.25: CCACAAGCGCCGACTGTG.

[0128] (26) rpoB_L533P site target sequence Seq ID NO.26: CCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTGCACCCGTCGCACTACGGCCGGATGTGCCCGATCGAAACCCCTGAGGGGCCCAACATCGGTCTGATCG.

[0129] (27) Forward primer sequence for rpoB_L533P site, Seq ID NO.27: CCGACTGTCGGCGCC.

[0130] (28) rpoB external control target sequence Seq ID NO.28: CTCGCTGTCGGTGTACGCGGGTCAACCCGTTCGGGTTCATCGAAACGCCGTACCGCAAGGTGGTCGACGGCGTGGTTAGCGACGAGATCGTGTACCTGACCGCCGAC.

[0131] (29) rpoB external control forward primer sequence Seq ID NO.29: CTCGCTGTCGGTGTACGC.

[0132] (30) rpoB external control reverse primer sequence Seq ID NO.30 GTCGGCGGTCAGGTACACG.

[0133] (31) rpoB internal reference probe sequence Seq ID NO.31: FAM-ACGCCGTCGACCACCTT-MGB.

[0134] Among them, primer-probe combinations for the D516V / Y, H526D / R / Y, and S531W / L / F sites are prone to non-specific amplification in the detection of rifampicin-resistant sensitive samples. To address this, corresponding blocks were designed to improve the specificity of the detection. The 3' ends of the blocks are all modified to prevent extension. The Tm value of the blocks is 5-10°C higher than that of the primers, and the blocks overlap with the upstream primers by more than 3 bases. Simultaneously, ARMS-PCR was used to detect high-concentration (10,000 copies) rifampicin-sensitive simulated samples and low-concentration (1,000 copies) rifampicin-resistant simulated samples with the above mutation types. The reaction system is shown in Table 3, and the amplification reaction conditions are shown in Table 4. The results showed that the primer-probe combination without Blocker would produce non-specific amplification in rifampicin-sensitive simulated samples. Adding Blocker would inhibit the non-specific amplification of sensitive samples, and the addition of Blocker would have little effect on the detection of drug-resistant samples. The results are shown in Table 5.

[0135] Table 3

[0136] Table 4

[0137] Table 5

[0138] Note: In Table 5, “NoCt” means “No Cycle Threshold”, which means there is no cycle threshold or no Ct value. This indicates that the fluorescence signal of the sample did not reach the detection threshold set by the instrument, and the result is judged as negative, indicating that the target mutation was not detected.

[0139] The primer composition of this embodiment includes the forward primers shown in Table 1 with sequences SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:27, and the reverse primer shown in SEQ ID NO:3. The kit includes the probe shown in SEQ ID NO:4 of the aforementioned primer composition, the blocking primers shown in SEQ ID NO:7, SEQ ID NO:12, and SEQ ID NO:23, the forward primer of the external control gene shown in SEQ ID NO:29, the reverse primer of the external control gene shown in SEQ ID NO:30, and the probe of the external control gene shown in SEQ ID NO:31.

[0140] Comparative Example 1 Comparative Example 1 provides a primer composition, the target sequence, primer sequence, probe and blocker information of which are shown in Table 6.

[0141] Table 6

[0142] The specific primer and probe sequences for Comparative Example 1 are as follows: (1) L511P forward primer sequence Seq ID NO.32: CGGCACCAGCCAGTC.

[0143] (2) L511P reverse primer sequence Seq ID NO.33: GGTTTCGATCGGGCACAT.

[0144] (3) L511P probe sequence Seq ID NO.34: TCTGTCACGTGAGCGTGCC.

[0145] (4) Forward primer sequence for rpoB_D516V site Seq ID NO.35: CCAGCTGAGCCAATTCATTGT.

[0146] (5) Blocker sequence of rpoB_D516V site Seq ID NO.36: TCATGGACCAGAACA.

[0147] (6) rpoB_D516Y forward primer sequence Seq ID NO.37: CCAGCTGAGCCAATTCAAGT.

[0148] (7) Forward primer sequence for rpoB_H526D site Seq ID NO.38: GCTGTCGGGGTTGACGG.

[0149] (8) Blocker sequence of rpoB_H526D site Seq ID NO.39: TTGACCCACAAGC.

[0150] (9) Forward primer sequence for rpoB_H526L site Seq ID NO.40: CTGTCGGGGTTGACGCT.

[0151] (10) Forward primer sequence for rpoB_H526N site Seq ID NO.41: GCTGTCGGGGTTGATCA.

[0152] (11) Forward primer sequence for rpoB_H526R site Seq ID NO.42: GCTGTCGGGGTTGACGCG.

[0153] (12) Forward primer sequence for rpoB_H526Y site Seq ID NO.43: GCTGTCGGGGTTGACAT.

[0154] (13) Forward primer sequence of rpoB_S531F / S531L site Seq ID NO.44:ACAAGCGCCGACTGAT.

[0155] (14) Blocker sequence of rpoB_S531F / S531L site Seq ID NO.45:ACTGTCGGCGCTG-MGB.

[0156] (15) The forward primer sequence of the rpoB_S531W site is Seq ID NO.46: ACAAGCGCCGACTGCG.

[0157] (16) Forward primer sequence of rpoB_L533P site Seq ID NO.47:GCGACGACTGTCGGCTCC.

[0158] Comparative Example 2 The primer combination design, reaction system and reaction amplification conditions in Comparative Example 2 were based on CN109112226A, as detailed in Tables 7-11.

[0159] Table 7. Reaction system of Comparative Example 2

[0160] Table 8. Reaction system of Comparative Example 2

[0161] Table 9. Amplification reaction conditions for Comparative Example 2

[0162] Table 10 Primers for Comparative Example 2

[0163] Table 11 Comparative Example 2 Probe

[0164] Example 1: Detection Sensitivity Verification Using mutant plasmids (catalog numbers P240603014-1 to P240603014-12) synthesized by Langjing Biotechnology, containing L511P, D516V, D516Y, H526D, H526R, H526Y, H526N, H526L, S531W, S531L, S531F, and L533P sites, respectively, reference samples were prepared at 1000 copies / mL (5 copies / reaction), 500 copies / mL (2.5 copies / reaction), and 100 copies / mL (0.5 copies / reaction) according to the reaction system in Table 3 and the amplification reaction conditions in Table 4, the detection sensitivity of the primer composition and kit was verified. Based on the shared primers, probes, and blockers, the reaction tubes can be divided into three reaction tubes and one external control (internal control) tube: Reaction tube 1: L511P, S531W, S531L, S531F sites (shared reverse primers and probes); Reaction tube 2: D516V, D516Y, H526D, H526R, H526Y (shared reverse primers and probes; D516 sites share one blocker, H526 sites share another blocker); Reaction tube 3: H526N, H526L, L533P sites (shared reverse primers and probes); External control tube: conserved region of the rpoB gene (independent reaction tube, or as an internal control channel for multiplex reactions).

[0165] The results showed that the primer combination and kit in Example 2 could detect 2.5 copies / reaction of the reference material, as detailed in Table 11; while in Comparative Example 1, the primer combination Seq ID NO.32-Seq ID NO.47 only detected 5 copies / reaction of the reference material at some sites, and no 5 copies / reaction was detected at the S531L site, as detailed in Table 12. The results indicate that the kit in Example 2 of this invention has higher detection sensitivity compared to Comparative Example 1.

[0166] Table 11

[0167] Table 12

[0168] Example 2: Validation of sensitivity for detecting heterogeneous drug resistance Using rifampicin-sensitive third-party Mycobacterium tuberculosis standards (Guangzhou Bondsheng Biotechnology Co., Ltd., catalog number BDS-IQC-060), mutant plasmids at the L511P, D516V, D516Y, H526D, H526R, H526Y, H526N, H526L, S531W, S531L, S531F, and L533P sites were first diluted to 100 copies / μL, then mixed in a certain proportion to prepare reference standards with mutation frequencies of 5%, 2%, and 1%. The total sample loading was 500 copies. Following the reaction system in Table 3 and the amplification reaction conditions in Table 4, the detection sensitivity of the primer combination and kit for heterogeneous drug-resistant samples was verified. For the detection effect of the heterogeneous drug-resistant reference standards, please refer to [link to relevant documentation]. Figures 1-12 Example 2 shows that the kit detection system can detect 1% of heterogeneous drug-resistant reference material in a background of 500 copies. The results are shown in Table 13.

[0169] Comparative Example 2 used prepared reference samples with mutation frequencies of 5%, 2%, and 1% for D516Y, H526D, H526Y, S531W, and S531L, respectively, to verify the detection sensitivity of the primer combinations in Table 10 and the probes in Table 11 for detecting heterogeneous drug-resistant samples according to the reaction system in Table 7 and the amplification reaction conditions in Table 9. The results are shown in Table 14. The results show that the Comparative Example 2 system can only detect 5% of the heterogeneous drug-resistant reference samples (interpretation of detection results: ΔCt > 12 for wild type, 0 ≤ ΔCt ≤ 12 for mutant type).

[0170] The results showed that, compared with Comparative Example 2, the kit in Example 2 of this invention had higher sensitivity in detecting heterogeneous drug resistance.

[0171] Table 13

[0172] Table 14

[0173] Verification of technical effectiveness and / or analysis of technical problem solving This invention addresses the technical problems of existing rifampicin resistance detection technologies for Mycobacterium tuberculosis, such as low detection site coverage, insufficient sensitivity in heterogeneous resistant samples, and severe interference from nonspecific amplification. It provides a primer composition and kit for the joint detection of 12 high-frequency mutation sites based on ARMS-PCR technology. Through a series of experimental verifications, this invention has achieved the following technical effects: 1. Solved the problem of low detection site coverage: The number of detection sites in this invention covers more than 97% of the high-frequency rifampicin resistance-related mutations in the Chinese population, significantly reducing the risk of missed detection.

[0174] 2. This invention solves the problem of low sensitivity in detecting heterogeneous drug-resistant samples: The primer composition and kit of this invention can stably detect heterogeneous drug-resistant samples with a mutation frequency as low as 1% against a background of 500 copies of total nucleic acid. Compared with the detection limit (>40%) of the melting curve method, the detection sensitivity of this invention is improved by more than 40 times, effectively identifying early-stage drug-resistant and low-proportion drug-resistant strains, providing a more reliable basis for precision medicine in clinical practice.

[0175] 3. Solved the problem of non-specific amplification interference: After adding Blocker to the kit of this invention, non-specific amplification of sensitive samples is effectively suppressed, and the detection efficiency of mutant samples is basically unaffected, the detection specificity is significantly improved, and the accuracy of the results is guaranteed.

[0176] 4. Solved the problem of detection sensitivity for low-concentration drug-resistant bacteria: The primer composition and kit of this invention have a detection sensitivity of up to 2.5 copies / reaction for drug-resistant mutation sites, which can meet the detection needs of low-concentration clinical samples.

[0177] 5. Solves the problem of long detection cycle: Based on ARMS-PCR technology, this invention shortens the detection time to 1 hour and 40 minutes. Compared with phenotypic drug susceptibility testing (several weeks), the detection efficiency is improved by hundreds of times; compared with melting curve method (several hours), the detection time is shortened by more than 50%.

[0178] 6. Solved the problem of low detection efficiency: By optimizing the combination of multiple primers and probes, 12 sites can be detected using 4 reactions, effectively reducing the amount of sample used.

[0179] In summary, this invention systematically solves several technical problems in existing technologies, such as low detection site coverage, poor sensitivity in detecting heterogeneous drug resistance, and non-specific amplification interference, through the combined detection of 12 high-frequency mutation sites and the specific inhibition of blocking primers. Furthermore, this primer composition and kit are compatible with ARMS-PCR technology and optimized rapid amplification procedures, significantly shortening the detection cycle.

[0180] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A primer composition for detecting rifampicin resistance in Mycobacterium tuberculosis complex, characterized in that, The primer composition includes a first primer for detecting the rifampicin resistance site; The nucleotide sequence of the first primer includes the sequences shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, and SEQ ID NO:27, or sequences that have at least 85% sequence identity with the shown sequences.

2. The primer composition according to claim 1, characterized in that, The rifampicin resistance sites include 12 sites on the rpoB gene: L511P, D516V, D516Y, H526D, H526L, H526N, H526R, H526Y, S531F, S531L, S531W, and L533P.

3. The primer composition according to claim 1, characterized in that, The primer composition further includes a first probe for detecting the rifampicin resistance site and a blocking primer, wherein the nucleotide sequence of the first probe includes the sequence shown in SEQ ID NO:4 or a sequence having at least 85% sequence identity with the shown sequence, and the nucleotide sequence of the blocking primer includes the sequences shown in SEQ ID NO:7, SEQ ID NO:12, SEQ ID NO:23 or a sequence having at least 85% sequence identity with the shown sequence.

4. The primer composition according to claim 3, characterized in that, At least one nucleotide in the blocking primer is a modified nucleotide.

5. The use of the primer composition according to any one of claims 1-4 in the preparation of a kit for detecting rifampicin resistance in Mycobacterium tuberculosis complex, wherein the use is for non-disease diagnosis and treatment purposes.

6. A kit for detecting rifampicin resistance in Mycobacterium tuberculosis complex, characterized in that, The kit comprises the primer composition according to any one of claims 1-4.

7. The reagent kit according to claim 6, characterized in that, The kit further includes a second primer and a second probe for detecting the externally controlled gene. The nucleotide sequence of the second primer includes the sequence shown in SEQ ID NO:29 or SEQ ID NO:30, or a sequence having at least 85% sequence identity with the shown sequence. The second probe includes the sequence shown in SEQ ID NO:31, or a sequence having at least 85% sequence identity with the shown sequence.

8. The reagent kit according to claim 6, characterized in that, The kit also includes PCR reaction solution.

9. The reagent kit according to claim 6, characterized in that, The method for detecting rifampicin resistance in Mycobacterium tuberculosis complex using the kit includes the following steps: S1, In the same reaction system, the DNA sample of Mycobacterium tuberculosis complex was amplified by ARMS-PCR using the kit to obtain the Ct value of each site and the Ct value of the external control gene. S2, calculate the ΔCt value. ΔCt value = site Ct value - external control gene Ct value. When the ΔCt value ≤ 11, the site is determined to be mutation positive. When the ΔCt value > 11, the site is determined to be mutation negative. If any site is determined to be mutation positive, it is interpreted as rifampicin resistance. If all sites are mutation negative, it is interpreted as rifampicin sensitivity.

10. The use of the primer composition of any one of claims 1-4 or the kit of any one of claims 6-9 in the preparation of a product for the detection of rifampicin resistance in Mycobacterium tuberculosis complex, wherein the use is for non-disease diagnosis and treatment purposes.

Citation Information

Patent Citations

  • Method for simultaneously detecting point mutation of mycobacterium tuberculosis rifampicin and isoniazid drug-resisting gene and kit of method

    CN109112226A