Primer pair and probe for detecting multiple respiratory tract fungi by means of counterflow amplification and application thereof
By designing primer pairs and probes with interface and fold sequences, combined with low-melting-point agarose, rapid, specific, and sensitive detection of various respiratory fungi by convective PCR was achieved. This solves the problems of long detection time, high cost, and insufficient sensitivity in existing technologies, and is suitable for rapid screening.
Patent Information
- Application Number
- CN202610516652.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-17
- Publication Date
- 2026-06-05
AI Technical Summary
Existing technologies are insufficient for the rapid, accurate, and low-cost simultaneous detection of multiple respiratory fungi, especially Aspergillus fumigatus, Cryptococcus neoformans, and Pneumocystis jirovecii. Furthermore, conventional convective PCR suffers from nonspecific amplification and insufficient sensitivity.
Primer pairs and probes with interface and folding sequences were designed to form a hairpin structure for convective PCR. The viscosity of the reaction system was adjusted by combining low-melting-point agarose to achieve rapid, specific and sensitive detection.
Simultaneous detection of three respiratory fungi in a single reaction tube is low-cost, highly accurate, and quick, requiring only 20-30 minutes, thus avoiding false positives and environmental contamination.
Smart Images

Figure CN122146923A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine, specifically relating to a convective amplification primer pair and probe for detecting various respiratory fungi and their applications. Background Technology
[0002] Respiratory infections are a group of common diseases caused by pathogens or fungi invading the respiratory tract and causing an inflammatory response. They primarily affect the respiratory system, including the nose, pharynx, larynx, trachea, bronchi, and lungs. Depending on the site of infection, they can be divided into upper respiratory tract infections (such as the common cold and pharyngitis) and lower respiratory tract infections (such as bronchitis and pneumonia). Respiratory infections are among the leading causes of morbidity and mortality worldwide, posing a persistent and severe challenge to public health systems.
[0003] Delayed or inaccurate diagnosis can lead to inappropriate antibiotic use, treatment failure, worsening of the condition, and even death, especially in immunocompromised, elderly, or pre-existing medical conditions. Furthermore, the clinical symptoms and signs caused by most respiratory pathogens are quite similar (often manifesting as fever, cough, or headache), making it extremely difficult to accurately predict the cause based solely on clinical symptoms and signs.
[0004] Aspergillus fumigatus is an important pathogenic bacterium belonging to the genus Aspergillus, and is a fungus that causes food spoilage. Aspergillus fumigatus colonies grow rapidly, appearing as fluffy or cottony clumps, dark greenish-brown, deepening in color with age. This fungus thrives at temperatures of 45°C or higher. It often appears in large numbers during the middle and late stages of grain heating and mold growth, promoting increased grain temperature and spoilage. Aspergillus fumigatus can parasitize the lungs of humans, birds, and other vertebrates, causing tuberculosis. It can also cause infections of the lungs, nose, eyes, brain, and bones in humans, especially in immunocompromised individuals.
[0005] Cryptococcus neoformans, also known as histolytic yeast, is a saprophytic fungus found in soil, pigeons, milk, and fruits. It can also be present in the human oral cavity and can infect both humans and animals. Infection is generally exogenous, but endogenous infection is also possible. In humans, it is usually an opportunistic pathogen. This bacterium mostly enters through the respiratory tract, causing mild inflammation in the lungs or asymptomatic transmission. It can also be introduced through broken skin and the intestines. When the body's immune function is weakened, it can spread throughout the body, primarily affecting the central nervous system, causing fungal meningitis, encephalitis, and cerebral granuloma. In addition, it can invade bones, muscles, lymph nodes, and skin and mucous membranes, causing chronic inflammation and abscesses. When the body's immunity is weakened, Cryptococcus neoformans mainly enters the body through the respiratory tract, causing lung infection. If it enters the bloodstream, it easily invades the central nervous system, leading to cryptococcal meningitis.
[0006] Pneumocystis pneumonia, also known as interstitial plasma cell pneumonia, is a respiratory fungal infection caused by Pneumocystis jirovecii. It primarily affects immunocompromised or immunodeficient individuals, such as HIV / AIDS patients, patients with malignant tumors, and patients receiving immunosuppressant therapy. The mortality rate is high, especially in immunosuppressed patients without HIV infection. Clinical symptoms of Pneumocystis pneumonia mainly include fever, dry cough, and progressive dyspnea. Some patients may also experience cyanosis, chest pain, and occasional sputum production; a few may also develop extrapulmonary manifestations or diffuse systemic lesions. The disease is contagious, primarily transmitted through droplets, with the source of infection being patients or carriers of Pneumocystis pneumonia.
[0007] The aforementioned three types of fungal cultures are complex to perform and grow slowly, making rapid diagnosis difficult. Common diagnostic methods for pulmonary fungal infections include pathological examination, microbiological testing, serological testing, imaging examination, and magnetic resonance imaging. Currently, pathological examination is the "gold standard" for clinical laboratory testing of fungal infections. However, its invasiveness often limits its application and its time-consuming nature (3-7 days), easily delaying diagnosis and treatment. Currently, there are very few direct identification methods or kits for pulmonary fungal infections on the market, and most existing kits are based on strains obtained from blood cultures, requiring further identification using PCR, mass spectrometry, etc., a cumbersome process. While kits for detecting specific fungal infections exist abroad, they are mostly based on real-time quantitative reverse transcription PCR (qRT-PCR) platforms and detect only a single fungal species, unable to simultaneously detect multiple fungi.
[0008] Chinese patent document CN115820921A discloses a primer-probe combination and its digital PCR kit for detecting three types of invasive lung fungi. The primer-probe combination for detecting these three fungi includes: primers and probes for detecting Aspergillus: primers with nucleotide sequences shown in SEQ ID NO:1-2 and probes with nucleotide sequences shown in SEQ ID NO:3; primers and probes for detecting Cryptococcus neoformans: primers with nucleotide sequences shown in SEQ ID NO:4-5 and probes with nucleotide sequences shown in SEQ ID NO:6; and / or primers and probes for detecting Yersinia pestis: primers with nucleotide sequences shown in SEQ ID NO:7-8 and probes with nucleotide sequences shown in SEQ ID NO:9. This prior art primarily employs digital PCR technology, resulting in high costs for detection instruments and consumables. Furthermore, the operation process is complex, and the detection time is long, 30-60 minutes longer than convective PCR, making it unsuitable for rapid emergency screening.
[0009] Chinese patent document CN111607658A discloses a primer-probe system kit and detection method for detecting human fungal infections. Firstly, this prior art discloses a primer-probe system capable of simultaneously detecting multiple pulmonary fungal infections, including the nucleotide sequence set shown in SEQ ID NO: 1-17. It also discloses a kit including this primer-probe system, and a method for fungal gene detection using this primer-probe system or kit. The kit disclosed in this prior art can rapidly, accurately, and with ultra-high sensitivity detect four fungi, including *Pneumocystis jirovecii*, *Mucor*, *Aspergillus*, and *Cryptococcus neoformans*. The core of this prior art is also the use of digital PCR equipment (droplet generator, chip amplification instrument, biochip reader), which has high instrument procurement and maintenance costs; consumables such as droplet chips and special reaction solutions are expensive, and the cost per sample detection far exceeds that of conventional qPCR; it requires professional technicians to operate and interpret GenePMS software data, which has a high barrier to entry and is difficult to popularize on a large scale. At the same time, the operation process is complex and the detection time is long, 30-60 minutes longer than countercurrent PCR, making it unsuitable for emergency rapid screening.
[0010] Convection PCR utilizes natural thermal convection to continuously circulate the reaction solution between different temperature zones, thus replacing the programmed heating / cooling of traditional thermal cyclers to achieve nucleic acid amplification. While numerous studies have reported on this technology, it generally suffers from non-specific amplification and insufficient detection sensitivity. Therefore, its current application is limited to fields with lower sensitivity requirements. For applications such as respiratory tract testing, which demand high sensitivity and specificity, there are no industrial-scale application cases yet. Improving the detection sensitivity and specificity of convection PCR is a key factor for its industrial application. Summary of the Invention
[0011] The purpose of this invention is to provide a convective amplification primer pair and probe for detecting various respiratory fungi and its application. By designing primer pairs and probes with folded sequences and interface sequences for convective PCR, the designed primer pairs have a high annealing temperature through the interface sequence, and the hairpin structure formed by the complementary interface sequence and the folded sequence can avoid non-specific amplification, thereby giving full play to the binding efficiency of primers and probes and improving the detection sensitivity.
[0012] To solve the aforementioned technical problems, the present invention specifically adopts the following technical solution: A first aspect of the present invention is to provide a convective amplification primer pair for detecting various respiratory fungi, said convective amplification primer pair including a *Aspergillus fumigatus* primer pair, a *Cryptococcus neoformans* primer pair, and a *Pneumocystis jirovecii* primer pair. The Aspergillus fumigatus primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:1; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:2. The novel Cryptococcus primer pair includes a Cryptococcus neoformans upstream primer and a Cryptococcus neoformans downstream primer. The nucleotide sequence of the Cryptococcus neoformans upstream primer is shown in SEQ ID NO:4; the nucleotide sequence of the Cryptococcus neoformans downstream primer is shown in SEQ ID NO:5. The *Pneumocystis jirovecii* species includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:7, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:8.
[0013] Preferably, the primer sequences in the Aspergillus fumigatus primer pair, the novel Cryptococcus primer pair, and the Pneumocystis jirovecii primer pair all include a target nucleic acid complementary sequence and an interface sequence. The interface sequence is located at the 5' end of the target nucleic acid complementary sequence and is not complementary to the target nucleic acid. The target nucleic acid complementary sequence has a folded sequence complementary to the interface sequence, thereby giving the primer sequence a curved hairpin structure.
[0014] Using the above technical solution, primer pairs with interface and folding sequences were designed. The interface sequence is located at the 5' end of the target nucleic acid complementary sequence and is not complementary to the target nucleic acid. The folding sequence is a segment of the target nucleic acid complementary sequence that is complementary to the interface sequence, forming a curved hairpin structure in the entire primer sequence. In the high-temperature region, the hairpin structure is maintained to avoid non-specific amplification, while in the low-temperature region, the hairpin structure opens due to the high temperature, thus achieving effective binding with the template strand. Compared with conventional primer-probe designs, this structure has been experimentally verified to significantly improve detection sensitivity, and can achieve specific, accurate, and sensitive rapid qualitative detection of the aforementioned respiratory fungi within 20-30 minutes.
[0015] Preferably, both the interface sequence and the folded sequence contain 3-6 bases, and the total content of guanine and cytosine in the bases of the interface sequence and the folded sequence exceeds 50%. The amplification effect is better when the total content of guanine (G) and cytosine (C) in the bases exceeds 50%.
[0016] A second aspect of the present invention is to provide a countercurrent amplification probe for detecting various respiratory fungi as described in the first aspect of the present invention, wherein the nucleotide sequence of the Aspergillus fumigatus probe is shown in SEQ ID NO:3; The nucleotide sequence of the novel Cryptococcus probe is shown in SEQ ID NO:6; The nucleotide sequence of the Pneumocystis jirovecii probe is shown in SEQ ID NO:9; The probe sequence has a fluorescent group labeled at the 5' end, which is VIC, FAM, ROX, or CY5; and an MGB group labeled at the 3' end.
[0017] In some embodiments, the fluorescent groups of each probe sequence should be different and non-interfering with each other, that is, the fluorescent groups used in each fluorescent channel are different and will not affect each other's detection, so that multiple targets can be detected simultaneously using different channels.
[0018] Preferably, the Aspergillus fumigatus probe has a FAM fluorescent group labeled at its 5' end and an MGB group labeled at its 3' end; the novel Cryptococcus probe has a VIC fluorescent group labeled at its 5' end and an MGB group labeled at its 3' end; and the Pneumocystis jirovecii probe has a ROX fluorescent group labeled at its 5' end and an MGB group labeled at its 3' end.
[0019] A third aspect of the present invention is to provide an application of a convection amplification primer pair and probe for detecting multiple respiratory fungi, the application being the preparation of a kit for detecting multiple respiratory fungi, the kit comprising the convection amplification primer pair described in the first aspect of the present invention and the probe described in the second aspect of the present invention, wherein the convection amplification primer pair and the probe are both disposed in the same reaction tube, and the kit comprising a reaction system for nucleic acid amplification by convection PCR.
[0020] Preferably, the kit further includes an internal standard primer pair and an internal standard probe. The internal standard primer pair consists of an internal standard upstream primer and an internal standard downstream primer. Both the internal standard upstream primer and the internal standard downstream primer include a sequence complementary to the conserved region of the internal standard gene and an internal standard interface sequence. The internal standard interface sequence is located at the 5' end of the sequence complementary to the conserved region of the internal standard gene and is not complementary to the conserved region of the internal standard gene. The sequence complementary to the conserved region of the internal standard gene has an internal standard fold sequence complementary to the internal standard interface sequence, thereby giving the internal standard primer sequence a curved hairpin structure. The nucleotide sequence of the upstream primer of the internal standard is shown in SEQ ID NO:10; the nucleotide sequence of the downstream primer of the internal standard is shown in SEQ ID NO:11; The nucleotide sequence of the internal standard probe is shown in SEQ ID NO:12; the 5' end of the internal standard probe is labeled with a CY5 fluorescent group, and the 3' end is labeled with an MGB group.
[0021] Preferably, the number of bases in both the internal standard interface sequence and the internal standard fold sequence is 3-6, and the total content of guanine and cytosine in the bases of the internal standard interface sequence and the internal standard fold sequence exceeds 50%.
[0022] Preferably, the reaction system comprises: DNA polymerase, deoxynucleoside triphosphate (dNTPs), deoxyuridine triphosphate (dUTPs), UNG enzyme, and PCR buffer. The PCR buffer contains 0.10%–0.50% (w / w) low-melting-point agarose (gel temperature 26–30°C (1.5% Gel), sol temperature ≤65°C (1.5% Gel)). The preferred concentration of low-melting-point agarose is 0.15% (w / w). By adjusting the concentration of low-melting-point agarose, the viscosity of the reaction system can be adjusted, thereby controlling the convection rate of the reaction system and consequently regulating the binding time of primers to the template strand during convective PCR.
[0023] Preferably, the convective PCR includes an upper-temperature zone and a lower-temperature zone, wherein the temperature of the upper-temperature zone is 40-95℃, the temperature of the lower-temperature zone is 90-100℃, and the duration is 50-1500s. Preferably, both the upper-temperature zone and the lower-temperature zone are at 95℃, and the duration is preferably 300s.
[0024] Preferably, the convective amplification PCR includes a first stage and a second stage, wherein the lower temperature region of the first stage is 95°C and the upper temperature region is 95°C, and the duration is 300s; and the lower temperature region of the second stage is 95°C and the upper temperature region is 60°C, and the duration is 1500s.
[0025] Preferably, the method for detecting respiratory fungi using the kit comprises the following steps: S1: Extract nucleic acid from the sample; S2: Add the nucleic acid to the kit and perform counter-PCR amplification to obtain the analytical results; The types of samples include pathogen cultures, as well as one or more clinically collected oropharyngeal swabs, sputum, bronchoalveolar lavage fluid, and blood. The detection time of the kit is 20-30 minutes.
[0026] In practical applications, the method for detecting respiratory fungi (i.e., Aspergillus fumigatus, Cryptococcus neoformans, and Pneumocystis jirovecii) using the aforementioned kit is simple and rapid. First, nucleic acids are extracted from the samples. A wide range of sample types are accepted, including pathogen cultures, as well as one or more samples from clinically collected oropharyngeal swabs, sputum, bronchoalveolar lavage fluid, and blood, meeting the needs of different clinical scenarios. Then, the nucleic acids are added to the kit for convection PCR amplification. The detection results are obtained by analyzing the signals from different fluorescence channels. This method not only improves detection efficiency but also provides strong evidence for clinicians to formulate timely treatment plans, contributing to improved patient prognosis.
[0027] Using the above-mentioned technical solution, a detection kit is prepared by placing three primer pairs and probes, all with folded sequences forming hairpin structures, and respiratory pathogens (i.e., Aspergillus fumigatus, Cryptococcus neoformans, and Pneumocystis jirovecii) in a single reaction tube. This kit enables the simultaneous detection of these three respiratory pathogens (Aspergillus fumigatus, Cryptococcus neoformans, and Pneumocystis jirovecii) in a single tube and in a single experiment. Furthermore, it employs convection PCR amplification, with an actual detection time of only approximately 20-30 minutes, offering advantages such as low cost, high accuracy and sensitivity, and short processing time. In addition, the entire detection process is performed under single-tube closed conditions, avoiding false positives and environmental contamination caused by cross-contamination between samples.
[0028] Preferably, the convection PCR amplification is divided into two stages: the first stage has a lower temperature region of 95°C and an upper temperature region of 95°C, lasting for 300 seconds; the second stage has a lower temperature region of 95°C and an upper temperature region of 60°C, lasting for 1500 seconds. Correspondingly, the detection time for convection PCR is 30 minutes; the detection limit is 500 copies / mL.
[0029] Beneficial technical effects: (1) Primer pairs and probes with interface sequences and folding sequences were designed. The interface sequence is located at the 5' end of the complementary sequence to the target nucleic acid and is not complementary to the target nucleic acid. Meanwhile, the folding sequence consists of 3-6 bases in the complementary sequence to the target nucleic acid and is complementary to the interface sequence. This makes the primer sequence form a hairpin structure. During convection PCR amplification, the hairpin structure is maintained in the upper temperature region to avoid non-specific amplification, while in the lower temperature region, the hairpin structure is opened due to the high temperature conditions, thereby achieving effective binding with the template strand and improving the sensitivity and specificity of detection.
[0030] (2) The kit provided by the present invention can detect three fungi that cause respiratory tract infections (i.e., Aspergillus fumigatus, Cryptococcus neoformans and Pneumocystis jirovecii) in one reaction tube and in one test. It is low in cost, high in accuracy and sensitivity, and short in time. The actual detection time is only about 20-30 minutes.
[0031] (3) The convection PCR device provided by the present invention is simple, low in cost and portable, and has a wide range of applicable scenarios.
[0032] (4) The present invention uses low melting point agarose, and the viscosity of the reaction system can be adjusted according to the amplification requirements of different targets, thereby achieving the best amplification conditions. Attached Figure Description
[0033] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. In all the drawings, similar parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn to scale. Obviously, the drawings described below are some embodiments of the present invention, and those skilled in the art can obtain other drawings based on these drawings without creative effort.
[0034] Figure 1 This is a specific embodiment 1 of the present invention, showing the amplification curve of Aspergillus fumigatus nucleic acid. Figure 2 This is a novel Cryptococcus nucleic acid amplification curve of a specific embodiment 1 of the present invention; Figure 3 This is a nucleic acid amplification curve of Pneumocystis jirovecii in a specific embodiment 1 of the present invention; Figure 4 This is an amplification curve of the ACTB internal standard in a specific embodiment 1 of the present invention; Figure 5 The amplification curve of Aspergillus fumigatus with an interface sequence but no folded sequence is shown in Comparative Example 1 of the present invention. Figure 6 This is the amplification curve of the novel Cryptococcus neoformans using conventional primers in Comparative Example 2 of the present invention; Figure 7 The nucleic acid amplification curve of Pneumocystis jirovecii in Comparative Example 3 of the present invention has an interface sequence and a folding sequence, and the number of bases in the folding part is 5. Figure 8 This is a nucleic acid amplification curve for multiple detection of other pathogens in specific embodiment 2 of the present invention; Figure 9 This is a nucleic acid amplification curve comparing the addition of low-melting-point agarose with and without specific embodiment 3 of the present invention; Figure 10 This is a nucleic acid amplification curve of the reagent kit for multiple detection of other pathogens in Specific Embodiment 6 of the present invention; Figure 11 The structural diagram of the novel Cryptococcus upstream primer designed for this invention. Detailed Implementation
[0035] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.
[0036] In this document, "and / or" includes any and all combinations of one or more of the listed related items.
[0037] In this article, "multiple" means two or more, that is, it includes two, three, four, five, etc.
[0038] As used in this specification, the term "about" typically means + / -5% of the value, more typically + / -4%, more typically + / -3%, more typically + / -2%, even more typically + / -1%, even more typically + / -0.5%.
[0039] In this specification, certain embodiments may be disclosed in a range-bound format. It should be understood that this "range-bound" description is merely for convenience and brevity and should not be construed as a rigid limitation on the disclosed range. Therefore, the description of a range should be considered as having specifically disclosed all possible subranges and the individual numerical values within those ranges. For example, a description of the range 1-6 should be considered as having specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and the individual numbers within those ranges, such as 1, 2, 3, 4, 5, and 6. This rule applies regardless of the breadth of the range.
[0040] Definition of noun: As used herein, “nucleic acid” refers to DNA, RNA, or DNA / RNA hybrid molecules existing in single-stranded or double-stranded form. In some embodiments, nucleic acid samples may be isolated from cells or viruses. In some embodiments, nucleic acid samples may include chromosomal DNA, plasmid DNA, recombinant DNA, messenger RNA, ribosomal RNA, transfer RNA, double-stranded RNA, or other RNA present in cells or viruses. Nucleic acids are derived from artificially prepared pathogen cultures, as well as from one or more clinically collected oropharyngeal swabs, sputum, bronchoalveolar lavage fluid, nasal or lung aspirates, tissue samples, or cells and blood.
[0041] As used herein, "target nucleic acid" or "template nucleic acid" refers to a single-stranded or double-stranded DNA or RNA fragment or sequence that is intended to be selectively amplified. The target nucleic acid may be a fragment contained within a longer double-stranded or single-stranded nucleic acid or may be the entire double-stranded or single-stranded nucleic acid. This invention does not impose a specific limitation on the length of the target nucleic acid. In some embodiments, the length of the target nucleic acid is less than 1000 bp, for example, less than 1000, 900, 800, 700, 600, 500, 400, 300, 200, or 100 bp.
[0042] As used herein, “denaturation” refers to the dissociation of all or part of the two complementary strands of a double-stranded nucleic acid using high temperature. As used herein, “annealing” refers to the sequence-specific binding of a primer to a single-stranded nucleic acid template. A primer may bind to the complementary sequence of only one template strand without binding to other regions of the template.
[0043] As used herein, a "primer" refers to a single-stranded nucleic acid or oligonucleotide capable of binding in a sequence-specific manner to a single-stranded region on a target nucleic acid, allowing polymerase-dependent replication of the target nucleic acid. In some embodiments, the target nucleic acid may be a double-stranded nucleic acid such as double-stranded DNA, or a single-stranded nucleic acid such as single-stranded RNA or DNA. If the target nucleic acid is double-stranded, it may be denatured by heating or using an enzyme to induce DNA polymerase activity and amplify the desired single-stranded template or template region.
[0044] As used in this article, convective PCR is an isothermal amplification technique that does not require temperature control equipment. Its core principle is to use the temperature gradient within the reaction system to drive solution convection, thereby achieving nucleic acid denaturation, annealing, and extension cycles, and completing the isothermal amplification method for nucleic acid amplification.
[0045] The following detailed descriptions and discussions of primer pair design and application effects are provided through specific examples.
[0046] First, the primer and probe information of this invention is introduced. The primer pairs and probe sequences designed in specific embodiment 1 and comparative embodiments 1-3 are shown in Table 1. Figure 11 As shown.
[0047] Table 1. Primer pairs and probe sequences designed for Specific Example 1 and Comparative Examples 1-3 Note: In Table 1, a single underline indicates an interface sequence; a double underline indicates a fold sequence, i.e., the position that forms a curved hairpin structure.
[0048] The sequence of the target nucleic acid was obtained from the NCBI database website as follows: Aspergillus fumigatus (AF): TGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCGCCGGGGAGGCCTTGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAG (SEQ ID NO: 19); Cryptococcus neoformans (CN): CTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTT (SEQ ID NO: 20); Pneumocystis jiroveci (PJ): GCACTGAATATCTCGAGGGAGTATGAAAATATTTATCTCAGATATTTAATCTCAAAATAACTATTTCTTAAAATAAATAATCAGACTATGTGCGATAAGGTAGATAGTCGAAAGGGAAACAGCCCAGAACAGTAATTAAAGTCCC (SEQ ID NO: 21); ACTB internal standard: CAAGCAGGAGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTCTAGGCGGACTATGACTTAGTTGCGTTACACCCTTTCTT (SEQ ID NO: 22).
[0049] The nucleic acids in the amplification systems of all examples were the target nucleic acids; Enzyme mix (including buffer) (using commercially available reagents) represents an enzyme mixture (containing reaction buffer), where 1× indicates the concentration of the enzyme mixture. The specific components of this enzyme mixture are: polymerase, UNG enzyme, and buffer (containing Mg). 2+ ), dN(U)TPs, etc.
[0050] Low melting point agarose (A600015) was purchased from Sangon Biotech (Shanghai) Co., Ltd. It was prepared into a 1.5% solution using DEPC-treated water, heated to 40°C, and mixed thoroughly before use.
[0051] Specific Example 1: In Specific Example 1, all three primer pairs and the internal standard primer pair were designed with interface and folding sequences, as shown in Table 1. The primer pairs and probe combinations in Specific Example 1 were then detected, specifically as follows: Aspergillus fumigatus culture medium, Cryptococcus neoformans culture medium, and Pneumocystis jirovecii culture medium were diluted with physiological saline to 1×10⁻⁶. 3 Copies / mL, and clinically negative bronchoalveolar lavage fluid samples were collected. Using a commercial nucleic acid extraction kit (Guangdong-Guangzhou Medical Device Registration No. 20170583), nucleic acid was extracted from the samples according to the instructions. Then, countercurrent PCR amplification was performed on the samples, and the results were as follows: Figures 1-4As shown. It can be seen that the primer pairs and probe combination of the present invention can detect Aspergillus fumigatus (…). Figure 1 Cryptococcus neoformans ( Figure 2 ), Pneumocystis jirovecii ( Figure 3 ) and human-derived ACTB internal standard ( Figure 4 ).
[0052] The amplification system of Aspergillus fumigatus is shown in Table 2.
[0053] Table 2. Amplification system of Aspergillus fumigatus The novel Cryptococcus amplification system is shown in Table 3.
[0054] Table 3. Amplification system of Cryptococcus neoformans The amplification system of Pneumocystis jirovecii is shown in Table 4.
[0055] Table 4. Amplification system of Pneumocystis jirovecii The ACTB amplification system is shown in Table 5.
[0056] Table 5. Amplification systems of ACTB internal standard PCR instrument: Convection PCR instrument; Amplification program: Stage 1: Lower temperature region 95℃, upper temperature region 95℃, duration 300s. Stage 2: Lower temperature region 95℃, upper temperature region 60℃, duration 1500s.
[0057] The amplification effects of the designed primers are compared and illustrated below through several comparative examples.
[0058] Comparative Example 1: In this comparative example, both the upstream and downstream primers of the Aspergillus fumigatus primer pair are designed with interface sequences, but no folding sequences are designed.
[0059] The Aspergillus fumigatus culture medium was diluted with physiological saline to 1×10⁻⁶. 3 Copies / mL, nucleic acid was extracted and subjected to countercurrent PCR amplification and detection. Results are as follows: Figure 5 As shown, with Figure 1 Compared to the detection results, each primer sequence introduced an interface sequence, but the lack of a folded sequence prevented the formation of a curved hairpin structure. Although amplification occurred, the amplification effect was poor. The amplification system is shown in Table 6.
[0060] Table 6. Amplification system compared with Example 1 PCR instrument: Convection PCR instrument; Amplification program: Stage 1: Lower temperature region 95℃, upper temperature region 95℃, duration 300s. Stage 2: Lower temperature region 95℃, upper temperature region 60℃, duration 1500s.
[0061] Comparative Example 2: In this comparative example, neither the upstream nor downstream primer of the novel Cryptococcus primer pair is designed with interface or folding sequences.
[0062] Cryptococcus neoformans culture medium was diluted with physiological saline to 1×10⁻⁶. 3 The samples were collected at a concentration of copies / mL and nucleic acid was extracted for counter-current PCR amplification and detection. The test result was negative. Figure 6 ),and Figure 2 Compared to the detection results, the primer pairs that did not introduce interface sequences or design folding sequences in each sequence resulted in significantly poor amplification performance. The amplification system is shown in Table 7.
[0063] Table 7. Amplification system compared with Example 2 PCR instrument: Convection PCR instrument; Amplification program: Stage 1: Lower temperature region 95℃, upper temperature region 95℃, duration 300s. Stage 2: Lower temperature region 95℃, upper temperature region 60℃, duration 1500s.
[0064] Comparative Example 3: In this comparative example, both the upstream and downstream primers of the *Pneumocystis jirovecii* primer pair were designed with interface sequences and folding sequences, but the GC content in the interface and folding sequences of each primer sequence was reduced to below 50%.
[0065] The culture medium of Pneumocystis jirovecii was diluted with physiological saline to 1×10⁻⁶. 3 Copies / mL, nucleic acid was extracted and subjected to countercurrent PCR amplification and detection. Results are as follows: Figure 7 As shown, with Figure 3 Compared to the detection results, the amplification effect decreased because each primer in the primer pair introduced interface and folding sequences to form a curved hairpin structure (GC content less than 50%). The amplification system is shown in Table 8.
[0066] Table 8. Amplification system compared with Example 3 PCR instrument: Convection PCR instrument; Amplification program: Stage 1: Lower temperature region 95℃, upper temperature region 95℃, duration 300s. Stage 2: Lower temperature region 95℃, upper temperature region 60℃, duration 1500s.
[0067] Specific Implementation Example 2: The multiplex system validation using the primer pair and probe combination from Specific Implementation Example 1 is specifically as follows: Aspergillus fumigatus culture medium, Cryptococcus neoformans culture medium, and Pneumocystis jirovecii culture medium were diluted with bronchoalveolar lavage fluid to a concentration of 1×10⁻⁶. 3 Copies / mL are reserved for use, and the above samples are directly subjected to convective PCR amplification and detection.
[0068] Specifically, Figure 8 In the middle, there are 4 amplification curves from left to right, which are Aspergillus fumigatus (… Figure 8 1) Cryptococcus neoformans ( Figure 8 2) Pneumocystis jirovecii ( Figure 8 3) and ACTB internal standard ( Figure 8 The amplification curves for section 4) are shown in Table 9. The amplification system is shown in Table 9.
[0069] Table 9. Amplification system of specific embodiment 2 PCR instrument: Convection PCR instrument; Amplification program: Stage 1: Lower temperature region 95℃, upper temperature region 95℃, duration 300s. Stage 2: Lower temperature region 95℃, upper temperature region 60℃, duration 1500s.
[0070] Specific Example 3: A comparative analysis of the detection effects of adding low-melting-point agarose to the system is conducted, specifically as follows: Aspergillus fumigatus culture medium was diluted with bronchoalveolar lavage fluid to 1000 copies / mL for later use. Amplification systems with and without agarose were prepared separately, as shown in Table 10. The samples to be tested were directly subjected to convective PCR amplification and detection using the two systems respectively.
[0071] Specifically, Figure 9 There are two amplification curves in total. The amplification curve that detected positive was the amplification system with added low melting point agarose (experimental group), and the amplification curve that detected negative was the amplification system without added low melting point agarose (control group).
[0072] Table 10 Amplification system of specific embodiment 3 PCR instrument: Convection PCR instrument; Amplification program: Stage 1: Lower temperature region is 95℃, upper temperature region is 95℃, duration is 300s. Stage 2: Lower temperature region is 95℃, upper temperature region is 60℃, duration is 1500s.
[0073] Tests showed that both the target gene and the internal control gene could be amplified within a detection time of 20-30 minutes, and this data was optimized. After experimental testing, the optimal condition was determined to be 30 minutes.
[0074] Testing showed that amplification could be achieved within a reaction time range of 50-500 seconds in the first stage, and this data was optimized. After experimental testing, the optimal condition was determined to be 300 seconds.
[0075] In some specific embodiments, the kit further includes: DNA polymerase, deoxynucleoside triphosphate (dNTP), UNG enzyme, and PCR buffer for PCR amplification. The PCR buffer can amplify both the target gene and the internal control gene by adding 0.10-0.50% (w / w) low-melting-point agarose. After experimental testing, the optimal amount was determined to be 0.15% (w / w) low-melting-point agarose, and the addition of low-melting-point agarose was superior to the control group without it.
[0076] Specific Example 4: Sensitivity verification of the kit prepared using the primer pair and probe combination in Specific Example 1 is specifically as follows: Aspergillus fumigatus culture medium, Cryptococcus neoformans culture medium, and Pneumocystis jirovecii culture medium were diluted with bronchoalveolar lavage fluid to 1000 copies / mL, 500 copies / mL, 200 copies / mL, and 100 copies / mL, respectively, for later use. The above samples were directly subjected to convective PCR amplification and detection according to the amplification system and amplification procedure of Specific Example 2, with each gradient being detected 10 times.
[0077] The specific results are shown in Table 11. All three pathogens were 100% detectable at a concentration of 500 copies / mL.
[0078] Table 11 Sensitivity Verification Results Specific Example 5: Using the primer pairs and probes from Specific Example 1 to specifically detect other fungi, specifically as follows: Detect 1×10 according to the amplification system and amplification procedure of specific embodiment 2. 6 Respiratory syncytial virus copies / mL, 1×10 6 copies / mL rhinovirus, 1×10 6 copies / mL of Bocavirus, 1×10 6 copies / mL human metapneumovirus, 1×106 copies / mL of Streptococcus pneumoniae, 1×10 6 copies / mL Legionella pneumophila, 1×10 6 copies / mL of Mycoplasma pneumoniae, 1×10 6 Copies / mL of Bordetella pertussis. As shown in Table 12, the detection results for all the above viruses were negative. The above results indicate that the primer-probe combination of the present invention has excellent specificity and does not cross-react with other common respiratory fungi and bacteria.
[0079] Table 12 Specific detection results Specific Example 6: Produce the corresponding reagent kit according to the amplification system of Specific Example 2, and test the repeatability and stability of the reagent kit.
[0080] Aspergillus fumigatus culture medium, Cryptococcus neoformans culture medium, and Pneumocystis jirovecii culture medium were diluted with bronchoalveolar lavage fluid to 500 copies / mL for later use. The kits were stored at -20±5℃ and 37℃ for one month, respectively, and then the above samples were directly subjected to convective PCR amplification and detection.
[0081] Specifically, Figure 10 In the image, there are eight amplification curves from left to right, representing the detection of Aspergillus fumigatus by the kit stored under two different conditions. Figure 10 1) Cryptococcus neoformans ( Figure 10 2) Pneumocystis jirovecii ( Figure 10 3) and internal standard ( Figure 10 The amplification curves in section 4) show that the kit performance did not significantly decrease after being stored at 37°C for one month, and the kit exhibited good repeatability and stability.
[0082] It should be noted that, in this document, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Unless otherwise specified, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes that element.
[0083] The embodiments of the present invention have been described above with reference to the accompanying drawings. However, the present invention is not limited to the specific embodiments described above. The specific embodiments described above are merely illustrative and not restrictive. Those skilled in the art can make many other forms under the guidance of the present invention without departing from the spirit and scope of the claims. All of these forms are within the protection scope of the present invention.
Claims
1. A pair of convective amplification primers for detecting multiple respiratory fungi, characterized in that, The convective amplification primer pairs include Aspergillus fumigatus primer pairs, Cryptococcus neoformans primer pairs, and Pneumocystis jirovecii primer pairs. The Aspergillus fumigatus primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:1; the nucleotide sequence of the downstream primer is shown in SEQ ID NO:
2. The novel Cryptococcus primer pair includes a Cryptococcus neoformans upstream primer and a Cryptococcus neoformans downstream primer. The nucleotide sequence of the Cryptococcus neoformans upstream primer is shown in SEQ ID NO:4; the nucleotide sequence of the Cryptococcus neoformans downstream primer is shown in SEQ ID NO:
5. The *Pneumocystis jirovecii* primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO:7; the nucleotide sequence of which is shown in SEQ ID NO:
8. The primer sequences in the Aspergillus fumigatus primer pairs, the novel Cryptococcus primer pairs, and the Pneumocystis jirovecii primer pairs all include a target nucleic acid complementary sequence and an interface sequence. The interface sequence is located at the 5' end of the target nucleic acid complementary sequence and is not complementary to the target nucleic acid. The target nucleic acid complementary sequence has a folded sequence that is complementary to the interface sequence, thereby giving the primer sequence a curved hairpin structure.
2. The convective amplification primer pair for detecting various respiratory fungi according to claim 1, characterized in that, The number of bases in both the interface sequence and the folded sequence is 3-6; and the total content of guanine and cytosine in the bases of the interface sequence and the folded sequence exceeds 50%.
3. A probe for detecting the convective amplification of various respiratory fungi as described in claim 1 or 2, characterized in that, The probe sequence has a fluorescent group labeled at the 5' end, which is FAM, VIC, ROX, or CY5; and an MGB group labeled at the 3' end. The nucleotide sequence of the Aspergillus fumigatus probe is shown in SEQ ID NO:3; The nucleotide sequence of the novel Cryptococcus probe is shown in SEQ ID NO:6; The nucleotide sequence of the Pneumocystis jirovecii probe is shown in SEQ ID NO:
9.
4. The probe according to claim 3, characterized in that, The Aspergillus fumigatus probe has a FAM fluorescent group labeled at its 5' end and an MGB group labeled at its 3' end; the novel Cryptococcus probe has a VIC fluorescent group labeled at its 5' end and an MGB group labeled at its 3' end; the Pneumocystis jirovecii probe has a ROX fluorescent group labeled at its 5' end and an MGB group labeled at its 3' end.
5. An application of a primer pair and probe for detecting various respiratory fungi, characterized in that, The application is to prepare a kit for detecting various respiratory fungi. The kit includes the convection amplification primer pair as described in claim 1 or 2 and the probe as described in claim 3 or 4, and the convection amplification primer pair and the probe are both placed in the same reaction tube. The kit also includes a reaction system for nucleic acid amplification by convection PCR.
6. The application according to claim 5, characterized in that, The kit also includes internal standard primer pairs and internal standard probes. The nucleotide sequence of the upstream primer of the internal standard is shown in SEQ ID NO:10; the nucleotide sequence of the downstream primer of the internal standard is shown in SEQ ID NO:11; The nucleotide sequence of the internal standard probe is shown in SEQ ID NO:12; the 5' end of the internal standard probe is labeled with a CY5 fluorescent group, and the 3' end is labeled with an MGB group.
7. The application according to claim 6, characterized in that, Both the upstream and downstream internal standard primers include a sequence complementary to the conserved region of the internal standard gene and an internal standard interface sequence. The internal standard interface sequence is located at the 5' end of the sequence complementary to the conserved region of the internal standard gene and is not complementary to the conserved region of the internal standard gene. The sequence complementary to the conserved region of the internal standard gene has an internal standard fold sequence complementary to the internal standard interface sequence, thereby giving the internal standard primer sequence a curved hairpin structure.
8. The application according to claim 5, characterized in that, The reaction system includes DNA polymerase, deoxynucleoside triphosphate (dNTP), UNG enzyme, and PCR buffer, wherein the PCR buffer contains 0.10-0.50% (w / w) agarose.
9. The application according to claim 8, characterized in that, The kit is used for convective PCR amplification, which includes an upper temperature region and a lower temperature region. The temperature of the upper temperature region is 40-95℃, and the temperature of the lower temperature region is 90-100℃, with a duration of 50-1500s.
10. The application according to claim 9, characterized in that, The convective amplification PCR includes a first stage and a second stage. The lower temperature region of the first stage is 95°C, the upper temperature region is 95°C, and the duration is 300s. The lower temperature region of the second stage is 95°C, the upper temperature region is 60°C, and the duration is 1500s.
Citation Information
Patent Citations
Primer probe system for human fungal infection detection, kit and detection method
CN111607658A
Primer probe combination for detecting three lung invasive fungi and digital PCR (Polymerase Chain Reaction) kit thereof
CN115820921A