MHC gene complex deletion animals

By introducing gRNA vectors into the mouse MHC gene population using CRISPR/Cas9 gene editing technology, the mouse MHC gene is disrupted or deleted and replaced with the human MHC gene. This solves the problem of the difficulty in preparing mice with missing MHC gene populations using existing technologies, and realizes the effective expression of human MHC protein and the simulation of immune response.

CN122161932APending Publication Date: 2026-06-05TOKYO METROPOLITAN INST OF MEDICAL SCI

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
TOKYO METROPOLITAN INST OF MEDICAL SCI
Filing Date
2024-09-13
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing technologies make it difficult to prepare mice with missing MHC gene clusters, and when using mouse MHC deletion models, human MHC expression is not ideal and cannot effectively simulate human immune responses.

Method used

Using CRISPR/Cas9 genome editing technology, a specific gRNA vector was introduced into cells containing mouse MHC gene clusters to disrupt or delete mouse MHC gene clusters. Subsequently, human MHC gene clusters were replaced on mouse chromosomes to create cell and animal models with MHC gene cluster deletion or disruption.

Benefits of technology

A mouse model with missing MHC gene clusters was successfully established, which can effectively express human MHC proteins and is used for specific analysis of MHC protein function, simulating human immune response.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122161932A_ABST
    Figure CN122161932A_ABST
Patent Text Reader

Abstract

The present application relates to a method for producing a cell, the method comprising: a step of destroying or deleting all or a part of a group of MHC genes (group of MHC genes 1) derived from a non-human mammal 1 from a cell having a chromosome in which all or a part of a group of major histocompatibility complex (MHC) genes of a wild-type chromosome of one of a pair of chromosomes of a non-human mammal (non-human mammal 1) is replaced with a group of MHC genes of another mammal (mammal 2) other than the non-human mammal 1, the produced cell having: a chromosome having a group of MHC genes (group of MHC genes 2) of the mammal 2 in a chromosome of the non-human mammal 1, and a chromosome in which all or a part of the group of MHC genes 1 is destroyed or deleted.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to chromosomes that disrupt or delete MHC gene clusters, cells containing such chromosomes, etc. Background Technology

[0002] Major histocompatibility complex (MHC) is a membrane protein that presents intracellular antigens to T cells. MHC genes include MHC class I, which presents intracellular antigens to CD8-positive T cells; MHC class II, which presents extracellular antigens to CD4-positive T cells; and non-classical MHCs, which contain molecules with physiological functions other than antigen presentation, such as regulation of antigen peptide presentation and regulation of NK cell activity. In mice, these MHC genes are located in the MHC region of chromosome 17, with 39 species present in the C57BL / 6 strain, but the number varies depending on the strain (Non-Patent Literature 1).

[0003] In pharmaceutical development utilizing the T-cell receptor (TCR) and other applications where mice are used as animal models, human MHC needs to be expressed in individuals that do not express mouse MHC to reproduce the human immune response. However, due to the large number of mouse MHC genes, creating mice with complete MHC gene deletions is technically very difficult, even using genome editing technology, and has not yet been successful. Therefore, mice with deletions of classic MHC genes that play a major role in antigen presentation, or mice with knockouts of the β2-microglobulin (B2M) gene that forms a complex with MHC class I, are currently used as alternatives to MHC class I deletion mice. However, in the former case, non-classical MHC is still expressed, and in the latter case, since the mouse MHC genes are not destroyed, human MHC needs to be expressed as a fusion protein with B2M, making these not ideal model systems.

[0004] Existing technical documents

[0005] Non-patent literature

[0006] Non-patent literature 1: Shiina, T., Blancher, A., Inoko, H., and Kulski, JK (2017) Comparative genomics of the human, macaque, and mouse majorhistocompatibility complex Immunology 150, 127-138 10.1111 / imm.12624

[0007] Content of the invention

[0008] The problem the invention aims to solve

[0009] In summary, the goal is to create animals with MHC gene cluster deletions. If MHC gene cluster deletion mice could be created, these problems would be solved. Furthermore, using MHC gene cluster deletion mice would allow for specific functional analyses of MHC proteins.

[0010] Problem Solving Methods

[0011] In order to solve the above problems, the inventors conducted in-depth research and successfully produced cells with alleles that disrupt or delete the mouse MHC gene population, thus completing the present invention.

[0012] That is, the present invention is as follows. [1]

[0014] A chromosome of a non-human mammal that is a chromosome of a non-human mammal in which all or part of the major histocompatibility complex (MHC) gene group is destroyed or missing. [2]

[0016] According to the chromosome described in [1], wherein,

[0017] Non-human mammals are rodents. [3]

[0019] According to the chromosome described in [2], wherein,

[0020] The rodent is the mouse. [4]

[0022] A cell that contains chromosomes as described in [1] in a homozygous or heterozygous form. [5]

[0024] According to [4], the cells are embryonic stem cells. [6]

[0026] A non-human mammal that has the chromosomes described in [1]. [7]

[0028] A method for manufacturing cells, said cells comprising: chromosomes containing the MHC gene group of mammal 2 (MHC gene group 2) in the chromosomes of a non-human mammal 1, and chromosomes in which all or part of the MHC gene group 1 is destroyed or missing, wherein the mammal 2 is a mammal other than the non-human mammal 1, and the MHC gene group 1 is an MHC gene group derived from the non-human mammal 1.

[0029] The method includes:

[0030] The process of destroying or deleting all or part of the MHC gene group (MHC gene group 1) of a non-human mammal 1 from a cell having chromosomes in a heterozygous form, wherein all or part of the major histocompatibility complex (MHC) gene group of a wild-type chromosome of a pair of chromosomes of a non-human mammal (non-human mammal 1) is replaced with a chromosome of the MHC gene group of another mammal (mammal 2) other than the aforementioned non-human mammal 1. [8]

[0032] According to the method described in [7], wherein,

[0033] The cells are embryonic stem cells. [9]

[0035] According to the method described in [7], wherein,

[0036] The process of disrupting or deleting the aforementioned MHC gene group 1 is based on the use of CRISPR / Cas9 genome editing technology.

[10]

[0038] According to the method described in [7], wherein,

[0039] Non-human mammal 1 is a rodent.

[11]

[0041] According to the method described in

[10] , wherein,

[0042] The rodent is the mouse.

[12]

[0044] According to the method described in

[11] , wherein,

[0045] The steps to destroy or delete all or part of the above-mentioned MHC gene group 1 include:

[0046] The process of using CRISPR / Cas9 genome editing technology to disrupt or delete all or part of the following gene groups: d1, d2, d3, d4, d5, and d6, in cells with mouse MHC gene groups consisting of the following gene groups.

[0047] The gene groups are: the d1 gene group consisting of the genes H2-M10.2, H2-M10.1, H2-M10.3, H2-M10.4, H2-M11, H2-M9, H2-M1, H2-M10.5, and H2-M10.6; the d2 gene group consisting of the genes H2-D1, H2-Q1, H2-Q2, H2-Q4, H2-Q5, H2-Q6, H2-Q7, and H2-Q10; and the gene group consisting of the genes H2-T24, H2-T23, H2-T22, and G. The d3 gene group consists of the genes M11127, H2-Bl, H2-T10, GM7030, GM8909, and H2-T3; the d4 gene group consists of the genes H2-Ob, H2-Ab1, H2-Aa, H2-Eb1, and H2-Eb2; the d5 gene group consists of the genes H2-DMa, H2-DMb2, and H2-DMb1; and the d6 gene group consists of the genes H2-K1, H2-Oa, H2-M5, H2-M3, and H2-M2.

[13]

[0049] According to the method described in

[12] , wherein,

[0050] The genome editing vector used in CRISPR / Cas9 genome editing technology is a combination of vectors consisting of gRNAs having the base sequences shown in SEQ ID NO. 53-67.

[14]

[0052] A method for preparing a non-human mammal 1, wherein the non-human mammal 1 has chromosomes in which all or part of the MHC gene group 1 is destroyed or missing.

[0053] The method includes:

[0054] The process of preparing a non-human mammal 1 using cells obtained by the method described in [7] and mating the non-human mammal 1, wherein the non-human mammal 1 has in a pair of chromosomes: a chromosome having the MHC gene group 2 of the mammal 2, and a chromosome in which all or part of the MHC gene group 1 is destroyed or missing.

[15]

[0056] A method for manufacturing cells, the method comprising:

[0057] The process of recovering cells with chromosomes that have been completely or partially destroyed or missing from a non-human mammal 1 prepared by the method described in

[14] .

[16]

[0059] A method for manufacturing chromosomes, the method comprising:

[0060] The process of recovering chromosomes with disrupted or missing MHC gene cluster 1 from non-human mammals 1 prepared by the method described in

[14] or cells manufactured by the method described in

[15] .

[17]

[0062] A genome editing vector, which is the genome editing vector used in the CRISPR / Cas9 genome editing technology described in

[13] ,

[0063] The genome editing vector comprises a combination of vectors consisting of gRNAs having the base sequences shown in SEQ ID NO. 53-67.

[0064] The effects of the invention

[0065] This invention provides animals with MHC gene group deletions. Attached Figure Description

[0066] Figure 1 This is a schematic diagram illustrating the recombinant process used in this invention to replace non-human MHC with human MHC. The diagram shows the case where the non-human animal is a mouse.

[0067] Figure 2 This is a schematic diagram showing the MHC region in human chromosomes.

[0068] Figure 3 This is a diagram illustrating the target region in the case of using genome editing targeting vectors.

[0069] Figure 4 This is a schematic diagram of the method for creating humanized mice from the MHC region.

[0070] Figure 5 This is a diagram showing the structure of the target vector.

[0071] (A) Structure of TV3R-dHLA. (B) Structure of TV4-dH2. (C) Structure of TV-Tl1 / 2-BS. The location of the homology arm used in the targeting vector on the genome is shown in the figure.

[0072] Figure 6 This is a diagram showing the isolation of an A9-MRC5 fusion cell clone with human chromosome 6.

[0073] (A) Genomic DNA was prepared from isolated A9-MRC5 fusion cell clones (hChA9#1, 5, 13, 17), and the presence of sequences on human chromosome 6 was analyzed by genomic PCR. (B) Human chromosome 6 was found in hChA9#5 by FISH analysis. Red: Centromere-specific probe of human chromosome 6.

[0074] Figure 7 This is a diagram showing the target of TV3R.

[0075] (A) TV3R-dHLA was targeted in A9-MRC5 fusion cell clones to isolate hygromycin-resistant clones. Genomic PCR analysis was performed to determine if recombination had occurred. * indicates the TV3RhChA9#5-45 (128) clone. (B) Recloning was performed from TV3RhChA9#5-45 (128), and analysis was conducted using genomic PCR. (C) FISH analysis was performed on TV3RhChA9#5-45a. Red: Centromere-specific probe for human chromosome 6.

[0076] Figure 8 This is a diagram showing the target of TV4.

[0077] (A) Genomic PCR analysis of TV4-dH2 targeting. * indicates TV4RENKA#17 clone. (B) DAPI staining confirmed that TV4RENKA#17 has 40 chromosomes.

[0078] Figure 9 This is a diagram showing the separation of the TV3-4RENKA clone.

[0079] FISH analysis was performed on the modified human chromosome 6 introduced into TV3-4RENKA#17 / 5-45a-3 cells. The arrows indicate the introduced modified human chromosome 6. The chromosome number was confirmed to be 41. Red: Mouse Cot-1 (a probe of the mouse genome sequence); Purple: RP11-54H13 (a probe within the human MHC region).

[0080] Figure 10 This is a diagram showing the separation of the TV3-4RENKATl3 / 4 clone.

[0081] (A) Recombination translocation based on Cre / loxP. (B) Confirmation of translocation based on genomic PCR. * indicates TV3-4RENKATl3 / 4#17-1. (C) FISH analysis was performed on TV3-4RENKATl3 / 4#17-1. The numbers in the FISH images correspond to the numbers of the translocated chromosomes in the schematic diagram. Red: Human Cot-1 (probe for human genome sequence), Green: Mouse Cot-1 (probe for mouse genome sequence). (D) FISH analysis was performed on TV3-4RENKATl3 / 4#17-1. The numbers in the FISH images correspond to the numbers of the translocated chromosomes in the schematic diagram. Red: RP11-54H13 (probe within the human MHC region), Green: RP23-147G23 (probe near the centromere side of the MHC region on mouse chromosome 17), Purple: RP23-119G24 (probe near the telomere side of the MHC region on mouse chromosome 17).

[0082] Figure 11 This is a diagram showing the separation of the TV3-4RENKATlb clone.

[0083] (A) Chromosomal translocation analysis by genomic PCR. * indicates the TV3-4RENKATlb#38 clone. (B) FISH analysis was performed on TV3-4RENKATlb#38. The numbers in the FISH images correspond to the translocation chromosome numbers in the schematic diagram. Red: RP23-147G23 (probe from the MHC region of mouse chromosome 17 near the centromere), green: human Cot-1 (probe from the human genome sequence), purple: RP23-306H20 (probe from the MHC region of mouse chromosome 17 near the telomere).

[0084] Figure 12 This is a diagram showing the isolation of the TV3-4RENKATlbdh6 clone.

[0085] (A) Sorting of TV3-4RENKATlbdh6. (B) FISH analysis was performed on TV3-4RENKATlb#38dh6#3. The numbers in the FISH images correspond to the translocation chromosome numbers in the schematic diagram. The chromosome number was confirmed to be 40. Red: RP23-147G23 (probe from the MHC region of mouse chromosome 17 near the centromere), green: human Cot-1 (probe from the human genome sequence), purple: RP23-361C19 (probe from the MHC region of mouse chromosome 17 near the telomere). (C) HLA haplotype analysis of TV3-4RENKATlbdh6#3 was performed using whole-genome sequencing.

[0086] Figure 13 This is a diagram showing an MHC humanized chimeric mouse.

[0087] (A) Appearance of the TV3-4RENKATlbdh6#3-derived chimeric mouse. (B) Structure of chromosome 17 in the MHC-humanized mouse. An EGFP expression cassette was inserted distal to the MHC region. (C) Flow cytometry analysis of EGFP expression in testicular cells of the TV3-4RENKATlbdh6#3-derived chimeric mouse.

[0088] Figure 14 This is a diagram illustrating the creation of MHC humanized (hybrid) mice.

[0089] (A) MHC humanized (hybrid) cells containing MHC humanized mouse chromosome 17 with an EGFP expression cassette inserted distal to the MHC region. (B) Individuals born via microfertilization using testicular cells from chimeric mice derived from TV3-4RENKATlbdh6#3. Left: Bright-field image. Right: Detection of EGFP fluorescence. (C) Genomes were prepared from pups obtained via microfertilization, and PCR analysis was performed to determine the presence of sequences within the human MHC region. Individuals numbered 7 and 12 were EGFP-negative pups.

[0090] Figure 15 This is a diagram showing the creation of MHC humanized (hybrid) mice from XO ES cells.

[0091] (A) Chimeric mice cloned from TV3-4XOTlbdh6#11-1-4-57-3. Arrow: 100% chimeric mouse. (B) Pups of XO chimeric mice (female) and C57BL / 6 (male). XO ES cells from black-haired individuals will not be born unless germline transmission occurs. (C) Genotyping targeting the DAXX locus within the MHC region. Three primers (1-3) are used to determine whether the MHC region is of human or mouse origin. Red arrows indicate the positions of primers designed for sequences identical in humans and mice. Black indicates human or mouse-specific primers. (D) Example of genotyping of pups obtained by mating XO chimeric mice (female) and C57BL / 6 (male). W: wild-type mouse, H: MHC humanized (heterozygous) mouse.

[0092] Figure 16 This figure shows the results of human MHC protein expression analysis in MHC humanized (hybrid) mice.

[0093] (A) Western blot analysis was performed on the expression of human MHC proteins in spleen cells. Wt, spleen cells derived from wild-type mice; Het, spleen cells derived from MHC-humanized (hybrid) mice. (B) Flow cytometry analysis was performed on the surface expression of human MHC proteins in spleen cells. Wt, spleen cells derived from wild-type mice; Het, spleen cells derived from MHC-humanized (hybrid) mice.

[0094] Figure 17 This is a schematic diagram of the creation of mouse MHC gene populations without alleles using MHC humanized (hybrid) ES cells.

[0095] Figure 18 This diagram shows the structure of the MHC region in MHC-humanized (hybrid) ES cells and the distribution of the mouse MHC gene population.

[0096] The upper section represents the humanized MHC alleles, and the lower section represents the wild-type alleles. The mouse MHC gene population is classified into six gene groups from d1 to d6.

[0097] Figure 19 This diagram illustrates the steps involved in creating the mouse MHC deletion allele.

[0098] Figure 20 This is a diagram showing the separation of d1 clones using CRISPR / Cas9.

[0099] (A) Schematic diagram of the d1 cluster. CR indicates the target site of CRISPR / Cas9. Arrows indicate the location of primers used to confirm the deletion. (B) Analysis of isolated clones by genomic PCR. Arrows indicate the location of expected PCR amplification products. (C) FISH analysis of genomic PCR-positive clones. Red indicates mouse chromosome 17, purple indicates human MHC regions, and green indicates staining images using probes targeting the d1 cluster.

[0100] Figure 21 This is a diagram showing the separation of d2 clones using CRISPR / Cas9.

[0101] (A) Schematic diagram of the d2 cluster. CR indicates the target site of CRISPR / Cas9. Arrows indicate the location of primers used to confirm the deletion. (B) Analysis of isolated clones by genomic PCR. Arrows indicate the location of expected PCR amplification products. (C) FISH analysis of genomic PCR-positive clones. Red indicates mouse chromosome 17, purple indicates human MHC regions, and green indicates staining images using probes targeting the d2 cluster.

[0102] Figure 22This is a diagram showing the separation of d3 clones using CRISPR / Cas9.

[0103] (A) Schematic diagram of the d3 cluster. CR indicates the target site of CRISPR / Cas9. Arrows indicate the location of primers used to confirm the deletion. (B) Analysis of isolated clones by genomic PCR. Arrows indicate the location of expected PCR amplification products. (C) FISH analysis of genomic PCR-positive clones. Red indicates mouse chromosome 17, purple indicates human MHC regions, and green indicates staining images using probes targeting the d3 cluster.

[0104] Figure 23 This is a diagram showing the isolation of d4 clones using CRISPR / Cas9.

[0105] (A) Schematic diagram of the d4 cluster. CR indicates the target site of CRISPR / Cas9. Arrows indicate the location of primers used to confirm the deletion. (B) Analysis of isolated clones by genomic PCR. Arrows indicate the location of expected PCR amplification products.

[0106] Figure 24 This is a diagram showing the isolation of d5 clones using CRISPR / Cas9.

[0107] (A) Schematic diagram of the d5 cluster. CR indicates the target site of CRISPR / Cas9. Arrows indicate the location of primers used to confirm the deletion. (B) Isolated clones were analyzed by genomic PCR. Arrows indicate the location of the expected PCR amplification product. (C) Sequencing analysis of H2-M5 gene disruption in genomic PCR-positive clones.

[0108] Figure 25 This is a diagram showing the isolation of d6 clones using CRISPR / Cas9.

[0109] (A) Schematic diagram of the d6 gene cluster. (B) Sequencing analysis results of isolated d6 clone #198 are shown.

[0110] Figure 26 This is a graph showing the SNP analysis near H2-M2.

[0111] (A) Black dots represent the locations of SNPs near H2-M2. (B) For d6 clone #198, SNPs 1 and 2 (represented by the number 0) located upstream or downstream of H2-M2 were analyzed. (C) The chromosome number of d6 clone #198 was analyzed.

[0112] Figure 27 The differentiation of T cells in d5 homozygous mice is shown.

[0113] (A) Splenic cells or thymocytes were isolated from wild-type or d5 homozygous mice, and the expression of CD4 or CD8 in CD3-positive cells was analyzed. (B, C) Wild-type or d5 homozygous mice were immunized with SARS-CoV-2 S protein, and the serum anti-S1 IgG1 (B) or IgG2 antibody (C) was analyzed by ELISA.

[0114] Figure 28 The preparation of mice with missing MHC gene clusters is shown.

[0115] (A) The results of genomic PCR analysis of pups obtained by mating chimeric mice cloned from d6ES with wild-type mice. (B) A d6 heterozygous mouse that has undergone germline transmission. (C) The results of genomic PCR analysis of pups obtained by mating d6 heterozygous males with d6 heterozygous females. (D) A d6 homozygous mouse, individual number 3, obtained through mating. Detailed Implementation

[0116] This invention relates to chromosomes of non-human mammals in which the major histocompatibility complex (MHC) gene group is disrupted or missing. Furthermore, this invention relates to cells possessing such chromosomes in a homozygous or heterozygous form, and further to non-human mammals, etc., from which chromosomes with disrupted or missing MHC gene groups are prepared.

[0117] Furthermore, the present invention provides a method for manufacturing cells, the method comprising:

[0118] Cells are manufactured from cells possessing chromosomes in a heterozygous form, wherein the chromosome has a chromosome containing the MHC gene group 2 of mammal 2 in a chromosome of a non-human mammal 1, and a chromosome in which all or part of the MHC gene group 1 of the non-human mammal 1 is destroyed or missing, wherein the MHC gene group (also called "MHC gene group 1") of the wild-type chromosome of one chromosome of a pair of chromosomes of a non-human mammal (referred to as "non-human mammal 1") is replaced with the MHC gene group (also called "MHC gene group 2") of another mammal other than the aforementioned non-human mammal 1. The manufacturing method includes a step of destroying or deleting the MHC gene group 1 in the other wild-type chromosome of the aforementioned non-human mammal 1.

[0119] 1. Overview

[0120] Because sequences on autosomes exist in pairs, gene disruption or deletion of genome sequences using genome editing techniques can randomly occur on any one or two alleles. However, to create MHC-deficient non-human mammals, all MHC genes must be disrupted or deleted on one of the alleles. Furthermore, if the MHC region in a non-human mammal exists on only one allele, an MHC-deficient allele can be created. Therefore, the inventors used mice as an example to create humanized (hybrid) ES cells with the mouse MHC region present on only one allele. A method was designed to create mouse MHC-deficient alleles by disrupting or deleting the mouse MHC gene on the same allele using these ES cells, and ES cells with mouse MHC-deficient alleles were established.

[0121] The following describes the preparation of a cell in which the MHC gene group 1 of one wild-type chromosome of a pair of chromosomes of a non-human mammal that is heterozygous for wild type is replaced with the MHC gene group 2 of a chromosome of another mammal (referred to as "mammal 2") other than non-human mammal 1. Next, a method for destroying or deleting all or part of the MHC gene group 1 in the other wild-type chromosome of the aforementioned non-human mammal 1 from the chromosome of the aforementioned heterozygous cell will be described.

[0122] Non-human mammals 1 are animals whose MHC regions have been replaced by the MHC regions of other mammals. There are no specific limitations on the types of non-human mammals 1; examples include rodents such as mice, rats, guinea pigs, rabbits, and hamsters; livestock such as cattle, horses, pigs, and sheep; pets such as dogs and cats; and primates such as Japanese macaques and common marmosets. However, non-human mammals 1 are not limited to the above-mentioned animals.

[0123] Mammal 2 is an animal whose MHC region has been replaced by that of a non-human mammal 1. There is no particular limitation on the species of mammal 2, which includes humans in addition to the aforementioned non-human mammal 1.

[0124] 2. Cells in which the MHC of non-human mammal 1 is replaced by the MHC of mammal 2, and the preparation of non-human mammals.

[0125] (1) A method for replacing the MHC region of a non-human mammal 1 with the MHC region of a mammal 2.

[0126] A summary of the method for replacing the MHC region of a non-human mammal 1 with the MHC region of a mammal 2 is shown below. Figure 1 .exist Figure 1 For ease of explanation, we will use humans as an example, specifically as mammals.

[0127] exist Figure 1In the diagram, (a) is a schematic diagram of chromosome 6 of mammal 2 (human) before substitution and chromosome of non-human mammal 1 (non-human), and (c) is a schematic diagram of the chromosome after substitution of the MHC region. The substitution of the MHC region utilizes a two-step recombination process: translocation recombination from (a) to (b1) and translocation recombination from (b1) to (c) (referred to as "two-step recombination 1"), or a two-step recombination process: translocation recombination from (a) to (b2) and translocation recombination from (b2) to (c) (referred to as "two-step recombination 2"). The order of recombination in this invention is arbitrary; it can be either two-step recombination 1 or two-step recombination 2.

[0128] exist Figure 1 In this context, when observing the MHC region as the object of translocation recombination (also referred to as "displacement" or simply "recombination" in this specification), the telomere side is called the distal side, and the centromere side is called the proximal side. Furthermore, any position on the distal side from the human MHC region, i.e., between the human MHC region and the distal end, that becomes the boundary of recombination, is designated as P1; and any position on the distal side from the non-human MHC region, i.e., between the non-human MHC region and the distal end, that becomes the boundary of recombination and corresponds to the aforementioned P1, is designated as p1. Additionally, in Figure 1 In this context, any position proximal to the human MHC region (the target of recombination), i.e., between the human MHC region and the centromere, and which serves as the boundary of recombination, is designated as P2. Any position proximal to the non-human MHC region, i.e., between the non-human MHC region and the centromere, and which serves as the boundary of recombination and corresponds to the aforementioned P2, is designated as p2.

[0129] Thus, in the 2-step recombination 1, the recombination from (a) to (b1) is the first recombination, which is the recombination of the region from P1 to the distal end (telomere) and the region from p1 to the distal end (telomere). Then, the recombination from (b1) to (c) is the second recombination, which is the recombination of the region from P2 to the distal end (telomere) and the region from p2 to the distal end (telomere).

[0130] On the other hand, in the 2-step recombination 2, in Figure 1 Recombination between the human MHC region (p2) closer to the centromere and the distal region (p2) and the non-human MHC region (p2) closer to the centromere and the distal region is called "first recombination". Figure 1 (b2)). At this stage, recombination between the region from P1 to the distal end of the human chromosome and the region from P1 to the distal end of the non-human chromosome has not yet occurred. Then, the recombination between the region from P1 to the distal end of the human chromosome and the region from P1 to the distal end of the non-human chromosome is called "second recombination".

[0131] After recombination, MHC-humanized cells, such as ES cells, can be prepared and transplanted into early embryos of non-human mammals to create chimeric non-human animals. It should be noted that, preferably, any remaining human chromosomes in the cells are removed before recombination. Human chromosomes can be removed by passage culture in the absence of screening drugs. Furthermore, chromosomes in non-human mammals are diploid. In this invention, the chromosomes in the recombined non-human mammals whose MHC regions are replaced by human chromosome MHC regions can be homozygous (both chromosomes have humanized MHC regions) or heterozygous (one chromosome has humanized MHC regions). Heterozygous chromosomes are preferred to avoid the deletion or destruction of MHC regions in the non-human chromosomes described later.

[0132] Therefore, MHC-humanized heterozygous animals can subsequently be prepared through natural mating or microinsemination. It should be noted that MHC-humanized homozygous animals can also be prepared through natural mating or microinsemination.

[0133] Here, the human MHC is the same molecule as HLA, and the genes that determine this molecule are arranged in tandem on chromosome 6. The MHC region in non-human mammals varies from animal to animal; for example, it is on chromosome 17 in mice, chromosome 20 in rats, chromosome 12 in rabbits, and chromosome 7 in pigs. Furthermore, non-human mammals are not limited to the animals mentioned above; other examples include chromosome 20 in horses, chromosome 23 in cattle, chromosome 12 in dogs, and chromosome 4 in common marmosets, etc.

[0134] It should be noted that when describing genes encoding MHC in a gene region, the term "MHC region" is sometimes used. Additionally, in non-human mammals, such as mice, the MHC region is located on the long arm; therefore, for example, in... Figure 1 When non-human chromosomes are represented using mouse chromosomes, the long and short arms of the mouse chromosome are oriented in the opposite direction to those of the human chromosome.

[0135] The MHC region targeted for recombination can be the entire MHC region or a portion thereof. Within class I, it can be either classical class I molecules or non-classical class I molecules. In humans, classical class I molecules include HLA-A, HLA-B, and HLA-C, while non-classical class I molecules include HLA-E, HLA-F, HLA-G, MICA, and MICB.

[0136] Human class II genes are located in the human MHC class II region, and the DR, DQ, and DP loci encode the major products of this region. It should be noted that mouse H2-M2 and H2-M3 also exist in the mouse MHC; in this invention, these MHCs may not be included in the target region for replacement. Class III regions contain various genes other than those in the MHC, and in humans, this is the region more distal to HLA-DRA and more proximal to MICB.

[0137] For example, Figure 2 This is a schematic diagram showing the human MHC regions. The MHC regions to be substituted can be only type I regions, only type II regions, only type III regions, or combinations of these regions (including all combinations). Furthermore, type I regions can be regions containing classical type I MHC genes, regions containing non-classical type I MHC genes, or both. Therefore, in this invention, the regions can constitute each class; for example, in type I, it can be any one of HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G, MICA, and MICB, or combinations of two or more of these (including all combinations); in type II, it can be any one of HLA-DP, HLA-DQ, HLA-DR, HLA-DO, and HLA-DM, or combinations of two or more of these (including all combinations). Type III regions contain various genes other than MHC, and in humans, they are regions more distal to HLA-DRA and more proximal to MICB.

[0138] Here, the MHC region to be recombined can be either the entire region or a portion thereof, as described above. Therefore, depending on the selection of the MHC region to be recombined, P1, p1, P2, and p2 may sometimes be located in an unselected MHC region.

[0139] In this invention, if it is a human MHC class I region, it preferably includes the entire region from MICB to HLA-F. Figure 2 The region shown in L2), if it is a type II region, preferably includes the entire region from HLA-DP to HLA-DR. Figure 2 The region shown in L1). Additionally, the Class III region is the region more distal to HLA-DRA and more proximal to MICB (…). Figure 2 (Region L3 shown in the middle). In one aspect of the invention, a further preferred method is to replace... Figure 2 The MHC region shown is the whole ( Figure 2 (The region represented by L4).

[0140] (2) Targeted vector

[0141] (2-1) The first recombination in step 1 and the second recombination in step 2

[0142] In this invention, the vector used to induce recombination is referred to as a targeting vector. The targeting vector used here is not limited to any vector capable of inducing the aforementioned recombination; it can be a vector utilizing a recombinase recognition sequence and the recombinase itself, or a vector utilizing a genome editing tool. If necessary, a genome editing tool can also be used to cut at the aforementioned P1 and p1 positions. When using a genome editing tool, the chromosome can be cut at the target position, thus easily inducing subsequent recombination.

[0143] <Recombination using recombinase>

[0144] Recombination using recombinases, such as the loxP recombinase and the Cre recombinase, can recognize specific sequences. The Cre / loxP specific recombination system is well-known. The Cre enzyme is a 343-amino acid protein derived from P1 phage that recognizes a specific 34 bp base sequence called the loxP site for site-specific recombination. The loxP site can be divided into three parts: 13-base, 8-base, and 13-base. The 13-base sequence is a complementary inverted repeat. The 8-base sequence, on the other hand, determines the orientation of the loxP site. Many mutant loxPs, known as Lox511 and lox2272, can also be used to recognize these recombinase sequences.

[0145] In another aspect of the invention, as other examples of site-specific recombination systems based on site-specific recombinases, in addition to the Cre / loxP system, the Flp / FRT system derived from yeast plasmid 2μ, the PhiC31 integrase system derived from bacteriophage PhiC31, and the Bxb1 integrase system derived from bacteriophage Bxb1 can also be used.

[0146] exist Figure 1 In this context, the target vector used for recombination from (a) to (b1) or from (b2) to (c) is either a combination of target vector 1 and target vector 2, or a combination of target vector 3. The combination of target vector 1 and target vector 2 is a vector that induces recombination using a recombinase recognition sequence and a recombinase, while target vector 3 is a vector that induces recombination using a genome editing tool.

[0147] (i) Targeting vector 1

[0148] Targeting vector 1 is integrated into an arbitrary position P1 on human chromosome 6, located distal to the MHC (human MHC) region on its short arm, which is the target of recombination. Targeting vector 1 induces translocation recombination between the region from P1 to the distal end and the region distal to the non-human MHC region on non-human mammalian chromosomes, which is the target of recombination, and the region corresponding to P1. Furthermore, targeting vector 1 contains gene cassette 1, which contains a recombinase recognition sequence, a portion of the sequence of drug resistance gene 1 reconstructed during translocation recombination for drug screening, and drug resistance gene 2 for targeted drug screening.

[0149] For the constructs contained in gene box 1, for example, the recombinase recognition sequence can be set to loxP, drug resistance gene 1 can be set to neomycin resistance gene, and drug resistance gene 2 can be set to hygromycin resistance gene.

[0150] Here, "correspondence" refers to the positional relationship of the recombination sites. That is, P1, p1, P2, and p2 are markers indicating whether the MHC region being recombinated is distal or proximal. Therefore, it is not required that the genes adjacent to P1 and p1, or P2 and p2, are identical. Depending on the mammalian species, sometimes the MHC region is inverted compared to the orientation of the human MHC region. In this case, for the loci flanking the site of integration of the targeting vector (P1), between the MOG locus and the GABBR1 locus in humans (see examples and...), Figure 5 In animals with MHC region inversions, p1 can be, for example, between the Kifc1 and Daxx loci.

[0151] Figure 5 This is a schematic diagram illustrating the structure of one embodiment of the targeting vector of the present invention. For ease of explanation, an example of a targeting vector in which the mouse MHC region is replaced with the human MHC region will be described.

[0152] exist Figure 5 In diagram A, "TV3R" represents gene box 1. The recombinase recognition sequence is indicated by the horizontal "▲" in the diagram, representing sequences such as the loxP sequence. In this invention, a portion of the sequence of the drug resistance gene 1 reconstructed during translocation recombination (a given portion of the drug resistance gene 1 used by the targeting vector 1) uses "3'neo". At this point, the drug resistance gene is the neomycin resistance gene. The targeted drug resistance gene 2 is labeled "Hyg", and at this point, the drug resistance gene is the hygromycin resistance gene.

[0153] Furthermore, the gene box 1 produced in the embodiments of the present invention contains a sequence represented by the following formula (1).

[0154] BGHpA-3'Neo-SA-loxP-EF1-Hyg-P2A-mRuby2-RGpA (1)

[0155] In formula (1), BGHpA represents the bovine growth hormone-derived polyadenylate tailing signal sequence, 3'Neo represents a portion of the sequence on the 3' side of the neomycin resistance gene, SA represents the splice acceptor sequence, loxP represents the recombinase recognition sequence, EF1 represents the human elongation factor 1α-derived promoter sequence, Hyg represents the hygromycin resistance gene, P2A represents the porcine cyclosporine virus-derived 2A sequence, mRuby2 represents the red fluorescent gene, and RGpA represents the rabbit β-globin-derived polyadenylate tailing signal sequence. In this invention, the Flp recombinase recognition sequence (FRT) can be added to box 1 shown in (1) above.

[0156] “TV3R-dHLA” is a homologous sequence of the target vector 1, which is connected to the regions on both sides of the integration site (P1) of TV3R.

[0157] exist Figure 5 In A, “PX458a-dHLACR1” is a genome editing vector, which is a vector that artificially cuts any position P1 of the chromosome to facilitate recombination targeting vector 1. The genome editing tools used for the genome editing vector can be any known tool. For example, tools using zinc finger nucleases (ZFNs), tools using TAL nucleases (TALENs), and tools using CRISPR-Cas9 can be cited.

[0158] PX458a-dHLACR1 is a CRISPR-Cas9 vector, consisting of a guide RNA sequence, a Cas9 sequence, and the gene sequence of the fluorescent protein Ametrine.

[0159] Figure 1 (d) shows a magnified view of the region from near to far from the MHC region. In an embodiment of the invention, the design was carried out by specifying P1 between the MOG and GABBR1 loci in the human chromosome and integrating the targeting vector 1 therein. Figure 5 A).

[0160] (ii) Targeting vector 2

[0161] The targeting vector 2 is integrated into the chromosome of a non-human mammal containing an MHC region, at a position p1 more distal to the non-human MHC region that corresponds to the aforementioned P1 as the object of recombination.

[0162] In the mice of the embodiment, the targeting vector 2 induces translocation recombination between the region from p1 to the distal end of the aforementioned chromosome and the region from p1 to the distal end of the aforementioned human chromosome. Furthermore, it includes a gene cassette 2 containing a recombinase recognition sequence, another portion of the drug resistance gene 1 for drug screening reconstructed during translocation recombination (a portion of the drug resistance gene 1 used by the targeting vector 1 other than the given portion of the sequence), and a targeted drug resistance gene 3 for drug screening.

[0163] For the constructs contained in gene box 2, for example, the recombinase recognition sequence can be set to loxP, drug resistance gene 1 can be set to neomycin resistance gene, and drug resistance gene 3 can be set to puromycin resistance gene.

[0164] As mentioned above, depending on the animal species, there are animals with MHC region inversion. In this case, the target vector 2 can also be integrated to position p1 corresponding to any position P1.

[0165] exist Figure 5 In section B, "TV4" represents gene box 2. Recombinase recognition sequences are indicated by horizontal "▲" marks in the diagram, such as the loxP sequence. In this invention, a portion of the sequence of drug resistance gene 1 reconstructed during translocation recombination for drug screening uses "5'neo". At this point, the drug resistance gene is the neomycin resistance gene. Drug resistance gene 2 used for targeted drug screening is labeled "Puro", and at this point, the drug resistance gene is the puromycin resistance gene.

[0166] Furthermore, the gene box 2 produced in the embodiments of the present invention contains a sequence represented by the following formula (2).

[0167] EF1-EGFP-P2A-5'Neo-SD-loxP-SA-T2A-Puro-RGpA (2)

[0168] In formula (2), EF1 represents the promoter sequence derived from human elongation factor 1α, EGFP represents the green fluorescent gene, P2A represents the 2A sequence derived from porcine cyclophosphamide virus, 5'Neo represents a portion of the 5' side sequence of the neomycin resistance gene, SD represents the splice donor sequence, loxP represents the recombinase recognition sequence, SA represents the splice acceptor sequence, T2A represents the 2A sequence derived from Thosea asigna virus, Puro represents the puromycin resistance gene, and RGpA represents the polyadenylated signal sequence derived from rabbit β-globin. In this invention, FRT can be added to box 2 shown in formula (2) above.

[0169] TV4-dH2 is a target vector 2, which is a homologous sequence of the region on both sides of the integration site (p1) of TV4 connected to TV4.

[0170] exist Figure 5 In section B, "PX458a-dH2CR1" is a genome editing vector, which is a vector that artificially cuts off any position p1 of the chromosome to facilitate recombination targeting vector 2. The genome editing tools used in the genome editing vector are the same as those described above. PX458a-dH2CR1 is a CRISPR-Cas9-based vector, for example, composed of a guide RNA sequence, a Cas9 sequence, and the gene sequence of the fluorescent protein Ametrine.

[0171] and Figure 1 (d) Similarly, in embodiments of the present invention, the targeting vector 2 was designed to be integrated between the Mog locus and the Gabbr1 locus in a non-human chromosome. Figure 5 B)

[0172] <Recombination using genome editing vectors>

[0173] (iii) Targeting vector 3

[0174] In another aspect of the invention, for the aforementioned first recombination, a genome editing tool can be used instead of recombination using recombinases. The targeting vector 3 induces translocation recombination between a region on human chromosome 6, from any position P1 further distal to the human MHC region (which is the target of recombination) and becoming the target of cleavage by the genome editing tool, and a region on a non-human mammalian chromosome containing MHC, from a region further distal to the non-human MHC region and corresponding to position p1 further distal to said P1.

[0175] In this case, substitution in the MHC region can be utilized Figure 1 Translocations from (a) to (b1) and from (b1) to (c) (2-step recombination 1), or translocations from (a) to (b2) and from (b2) to (c) (2-step recombination 2).

[0176] The targeting vector 3 comprises: a homologous sequence of a region between P1 and the human MHC region (referred to as "R1a"), a drug resistance gene 4 for targeted drug screening, and a homologous sequence of a region further distal to P1 (referred to as "R2b"), or comprises: a homologous sequence of a region further distal to P1 (referred to as "R1b"), a drug resistance gene 4 for targeted drug screening, and a homologous sequence of a region between P1 and the non-human MHC region (referred to as "R2a").

[0177] The positional relationship between R1a, R1b, R2a, and R2b is shown in the figure. Figure 3(a). It should be noted that the regions R1a, R1b, R2a and R2b can be any region observed from P1 and p1, preferably the region near P1 and p1.

[0178] The targeting vector 3 used in this invention may, for example, be composed of the R2a sequence, the CAG promoter sequence, the blast fungicide resistance gene, the polyadenylated signal sequence derived from rabbit β-globin, and the R1b sequence.

[0179] (2-2) The second recombination in step 1 of 2-step recombination, or the first recombination in step 2 of 2-step recombination.

[0180] In this invention, the second recombination in step 1 and the first recombination in step 2, i.e. Figure 1 The recombination from (b1) to (c) or Figure 1 The vector for recombination from (a) to (b2) is called the target vector 4.

[0181] The recombination described in this section can also be performed using a target vector that utilizes recombinases, as described above. Preliminary experiments by the inventors have shown that a target vector that utilizes genome editing tools can induce recombination more effectively than a target vector that utilizes recombinases, and the subsequent preparation of non-human mammals is also effective.

[0182] Therefore, in this invention, the second recombination in step 1 or the first recombination in step 2 is performed using a genome editing tool.

[0183] (iv) Targeting vector 4

[0184] For target vector 4, in the case of 2-step recombination 1, the chromosome after translocation recombination based on the effects of target vector 1 and target vector 2, or the effect of target vector 3 ( Figure 1 In (b1), translocation recombination is induced between a region from a location P2, which is closer to the human MHC region being recombined and is the target of the cut by the genome editing tool, to the distal region, and between a region from a location p2, which is closer to the non-human MHC region and corresponds to the aforementioned P2, to the distal region in the chromosome of a non-human mammal that has a non-human MHC.

[0185] Furthermore, regarding the use of target vector 4, in the case of two-step recombination 2, target vector 4 can be used first, followed by target vectors 1-3. In short, Figure 1 The recombinations shown in (a) to (c) can be performed by first performing recombination from P1 and p1 to the distal end, followed by recombination from P2 and p2 to the distal end. Figure 1(a), (b1) and (c) in that order), or after performing recombination from P2 and p2 to the distal end, recombination from P1 and p1 to the distal end can be performed. Figure 1 (in the order of (a), (b2) and (c)).

[0186] The targeting vector 4 comprises: a homologous sequence of the R3a region, which is more proximal to P2 (between P2 and the centromere), a drug resistance gene 5 (e.g., blast fungicide resistance gene) for targeted drug screening, and a homologous sequence of the R4b region, which is more proximal to P2 and the non-human MHC region; or it comprises: a homologous sequence of the R3b region, which is more proximal to P2 and the human MHC region, a drug resistance gene 5 for targeted drug screening, and a homologous sequence of the R4a region, which is more proximal to P2 (between P2 and the centromere).

[0187] The positional relationship between R3a, R3b, R4a, and R4b is shown in the figure. Figure 3 (b). It should be noted that the regions of R3a, R3b, R4a and R4b can be any region observed from P2 and p2, preferably the region near P2 and p2.

[0188] The targeting vector 4 used in this invention may, for example, be composed of the R3a sequence, the CAG promoter sequence, the blast fungicide resistance gene, the polyadenylated signal sequence derived from rabbit β-globin, and the R4b sequence.

[0189] Figure 1 (e) shows a magnified view of the region from near to far from the MHC region. In embodiments of the invention, the targeting vector 4 was designed to induce recombination between the KIFC1 and DAXX loci in human chromosomes and between the Kifc1 and Daxx loci in non-human chromosomes. Figure 5 C). Targeting vector 4 contains the blast fungicide (BS) resistance gene.

[0190] exist Figure 5 In C, "PX458.1a-pHLACR2" is a genome editing vector, designed to facilitate the artificial cutting of chromosomes at arbitrary positions P2 to target vector 4-mediated translocation recombination. PX458.1a-pHLACR2 is a CRISPR-Cas9-based vector, consisting of, for example, a guide RNA sequence, a Cas9 sequence, and the gene sequence of the fluorescent protein Ametrine.

[0191] Similar to PX458.1a-pHLACR2, "PX458.1a-pH2CR1" is a genome editing vector designed to facilitate the artificial cutting of chromosomes at arbitrary positions p2 by targeting vector 4-mediated translocation recombination. PX458.1a-pH2CR1 is a CRISPR-Cas9-based vector, consisting of, for example, a guide RNA sequence, a Cas9 sequence, and the gene sequence of the fluorescent protein Ametrine.

[0192] <Drug resistance genes used for drug screening>

[0193] In this invention, as described above, drug resistance genes 1-5 for drug screening can be used in the targeting vector. The combination of each of the drug resistance genes 1-5 is arbitrary and can be appropriately selected according to the target drug screening.

[0194] Genes used as drug resistance genes 1 to 5 include, for example, neomycin resistance genes, hygromycin resistance genes, puromycin resistance genes, and blast fungicide resistance genes, but are not limited to these.

[0195] <Fluorescent genes used for recombination or screening confirmation>

[0196] In this invention, to confirm chromosome introduction, to confirm the retention of the introduced chromosome, or to confirm whether drug screening is performed as intended, a given fluorescent gene can be included in the targeting vector. The type of fluorescent gene can be arbitrarily selected, as long as it can be confirmed in each step, or the type of fluorescent gene can be changed depending on the vector used.

[0197] Examples of fluorescent genes include green fluorescent genes (GFP, EGFP, etc.), red fluorescent genes, and yellow fluorescent genes.

[0198] (3) Cells

[0199] To establish MHC-humanized non-human mammals, it is necessary to replace the endogenous MHC gene with the human MHC gene in the cells of non-human mammals.

[0200] In this invention, as described above, conventional homologous recombination or genome editing techniques can be used.

[0201] As for cells, any animal cell is acceptable, with no particular restrictions. Examples include ES cells, sperm stem cells, and fibroblasts, with ES cells being the preferred choice.

[0202] Examples of suitable cell culture media include GMEM (Glasgow's Minimal Essential Medium), DMEM (Dulbecco's Modified Eagle Medium), and RPMI 1640. Depending on the cell type, appropriate animal cell culture additives such as fetal bovine serum (FBS), non-essential amino acids, antibiotics (e.g., penicillin, streptomycin), and growth factors / cytokines (epithelial growth factor, fibroblast growth factor, leukemia inhibitory factor, etc.) can be added to the culture medium.

[0203] After culturing cells for a given time, they are incubated in a medium containing trypsin and then recovered. The recovered cells can be passaged multiple times as needed, with or without feeder cells. For confirmation that the cultured cells are the target cells, their marker genes can be used as indicators. In the case of ES cells, indicators such as Oct3 / 4, alkaline phosphatase, and Nanog can be used, and detection can be performed using any method such as RT-PCR or Western blotting. Additionally, ES cells can also be identified by colony morphology.

[0204] (4) Production of non-human mammals

[0205] For the creation of non-human mammals, in addition to the creation of chimeric animals using ES cells, standard methods such as somatic cell nuclear transfer and microinsemination using sperm stem cells can also be used.

[0206] There are no particular limitations on the non-human mammals that can be used for the experiment; examples include rodents, livestock, and primates. Examples of rodents include mice, rats, guinea pigs, and hamsters; examples of livestock include cattle, horses, pigs, and sheep; and examples of primates include Japanese macaques and common marmosets. In addition, other pets or laboratory animals such as dogs, cats, monkeys, and rabbits can also be used.

[0207] In this invention, rodents are preferred, and mice are more preferred.

[0208] In the case of chimeric animals, firstly, the ES cells established above are agglutinated with the early embryo or injected into the blastocyst. The embryo thus created is called a chimeric embryo, which is then transferred into the uterus of a pseudopregnant recipient to induce delivery, thereby creating a chimeric animal.

[0209] Here, "embryo" refers to the stage of individual development from fertilization to birth, including early embryos such as 2-cell embryos, 4-cell embryos, 8-cell embryos, morula, and blastocysts.

[0210] For ease of explanation, we will use ES cells as an example below.

[0211] As a method for creating aggregates using ES cells and embryos, known methods such as microinjection and aggregation can be used.

[0212] In the case of microinjection, ES cells are injected into the recovered embryos to create cell aggregates. Alternatively, in the case of agglutination, ES cells are agglutinated with normal embryos from which the zona pellucida has been removed. There are no particular limitations on the ES cells used here; examples include RENKA cells derived from C57BL / 6, Y chromosome-exfoliated XO cells derived from TT2 cells obtained by crossing C57BL / 6 with CBA F1 cells, and ES cells established from F1 cells obtained by crossing C57BL / 6 with DBA / sCrSlc.

[0213] On the other hand, pseudopregnant female animals used as pseudopregnancy recipients can be obtained by mating female animals with normal estrous cycles with castrated male animals, such as those that have undergone vasectomy. The prepared pseudopregnant animal is then implanted into the uterus using the method described above, followed by delivery, thereby creating a chimeric animal.

[0214] Animals from which ES cell transplantation embryos are derived are selected from such chimeric animals. The selected chimeric animals are then mated with animals of inbred strains. The introduction of ES cells into the chimeric animal strain can then be confirmed by the presence of coat color from animals derived from ES cells in the offspring.

[0215] Whether offspring animals possess humanized MHC genes can be determined by whether DNA fragments of the target size can be detected by cutting the DNA with restriction endonucleases, or by analysis using PCR.

[0216] 3. Production of chromosomes from non-human mammals with disrupted or missing MHC gene clusters, and cells containing these chromosomes in homozygous or heterozygous forms.

[0217] In MHC-humanized (hybrid) ES cells, because the MHC region of one allele has been humanized, when using mice as a non-human mammal as an example, the deletion induction and gene damage induced by CRISPR / Cas9 targeting sequences within the mouse MHC region will all occur on alleles containing the mouse MHC region. Figure 17Therefore, by disrupting and deleting the mouse MHC gene population in MHC-humanized (hybrid) ES cells, mouse MHC gene population deletion alleles can be prepared. Since MHC-humanized (hybrid) mice can be produced from MHC-humanized (hybrid) ES cells, mouse MHC gene population deletion mice can be produced by creating MHC-humanized (hybrid) ES cells.

[0218] In this example, humanized (hybrid) MHC humanized (MHC humanized) ES cells were created using XO ES cells derived from CBAxC57BL / 6 F1 mice, with the MHC regions from Daxx to Mog modified for humanization. Mouse MHC gene cluster deletion alleles were then constructed. First, observation of the MHC gene cluster distribution across the genome revealed that 34 out of 39 genes were present in 5 clusters without contamination with non-MHC genes. Figure 18 These clusters are named d1, d2, d3, d4, and d5 in order of size.

[0219] It is known that H2-K1, H2-Oa, H2-M5, H2-M3, and H2-M2 exist in isolation rather than forming clusters. These isolated MHC genes are classified as d6.

[0220] In this invention, to delete or disrupt MHC genes, for MHC genes from d1 to d5, two CRISPR / Cas9 sequences designed to clamp the entire locus or a portion of all MHC genes within a cluster can be used to delete the sequence. For the isolated MHC gene classified as d6, a CRISPR / Cas9 sequence designed to disrupt each MHC gene can be used. For example, to delete the MHC gene cluster at d1, two CRISPR / Cas9 sequences designed to clamp the entire locus or a portion of all MHC genes within a cluster can be used to delete the sequence. Figure 18 CRISPR / Cas9 was designed to target the regions within cluster d1 closest to the centromere, between the H2-M10.2 locus and d3, and the regions within cluster d1 closest to the telomere, between the H2-M10.6 locus and d6 (H2-M5 gene), to induce deletion. CRISPR / Cas9 can be designed for other clusters in the same way.

[0221] In non-human mammals (e.g., mice) and mammals (e.g., humans), the base sequences of the upstream and downstream genomes of the various MHC clusters are largely different. Therefore, in the design of CRISPR / Cas9, these different base sequences are used as targets. Thus, it is possible to disrupt or delete only the mouse MHC gene cluster (MHC gene cluster 1) from MHC-humanized hybrid cells.

[0222] For clusters from d1 to d5, CRISPR / Cas9 is designed to clamp each cluster, as described above. Furthermore, when deleting or disrupting gene clusters from d1 to d6, the deletion or disruption of a single gene cluster is not limited to one; two or more can be combined. For example, appropriate combinations could include d1 and d3, d2 and d3 (a combination of two clusters), d1, d3, and d2 (a combination of three clusters), and d5 with an MHC gene classified as d6 (a combination of a cluster and an isolated MHC gene).

[0223] When deleting or disrupting gene clusters from d1 to d6, the order in which the disruption or deletion begins is arbitrary. It can be done sequentially from d1 to d6, such as deleting d1 first, then d2, then d3, or the order can be disregarded. The deleted or disrupted clusters can be a subset or all of them.

[0224] Alternatively, a cluster can be divided into subgroups, and multiple deletion or deletion operations can be performed. For example, in Figure 18 In the cluster d1 shown, H2-M10.2 to H2-M11 can be divided into subgroups such as d1a and H2-M9 to H2-M10.6 can be divided into subgroups such as d1b. The clusters in each subgroup can be deleted or removed.

[0225] On the other hand, since the d6 gene group does not form clusters, CRISPR / Cas9 is designed to disrupt each gene individually. The d6 MHC gene group can be divided into subgroups, each of which is disrupted separately.

[0226] Here, in chromosomes possessing the MHC region of mammal 2 (e.g., human), sometimes a portion of the MHC gene from a non-human mammal 1 (e.g., mouse) remains. In this case, the wild-type allele causes the entire MHC gene cluster to be destroyed or deleted, and the remaining non-human mammal 1 MHC gene in the chromosome possessing the MHC region of mammal 2 is also destroyed. Figure 18 In addition to the human MHC region, mouse-derived H2-M3 and H2-M2 genes also remain, thus causing these residual genes to be damaged or missing.

[0227] Therefore, by deleting or disrupting the MHC gene clusters from d1 to d6, it is possible to delete all mouse MHC genes. In this invention, clusters from d1 to d6 can also be arbitrarily selected, and a portion of these clusters can be deleted or disrupted, or all of d1 to d6 can be deleted or disrupted.

[0228] In one aspect of the invention, such as Figure 19As shown, MHC genes contained in each cluster were sequentially deleted from d1 to d6, and clones from d1 to d6 were isolated. Clone d1 is a clone from the d1 cluster of humanized (hybrid) ES cells lacking the MHC gene; clone d2 is a clone from d1 lacking the MHC gene from the d2 cluster; clone d3 is a clone from d2 lacking the MHC gene from the d3 cluster; clone d4 is a clone from d3 lacking the MHC gene from the d4 cluster; clone d5 is a clone from d4 lacking the MHC gene from the d5 cluster and further having the H2-M5 gene disrupted; clone d6 is a clone from d5 with the H2-K1, H2-Oa, H2-M3, and H2-M2 genes disrupted. In the creation of d6 clones, the efficiency of gene destruction is reduced when all four genes are destroyed simultaneously. Therefore, depending on the situation, after separating the d6a clones H2-K1 and H2-M3, which only destroyed the d5 clone, H2-Oa and H2-M2 were destroyed to separate the d6 clone.

[0229] 4. Non-human mammals with chromosomes containing deletions or disruptions in the MHC gene group.

[0230] Non-human mammals can be prepared using ES cells with chromosomes containing all or no MHC gene group 1, as described above. For example, non-human mammals can be prepared by transplanting ES cells with chromosomes containing all or no MHC gene group 1 into an early embryo, or by performing somatic cell nuclear transfer on ES cells with chromosomes containing all or no MHC gene group 1.

[0231] In addition, chromosomes with disrupted or missing MHC gene group 1 can be introduced from the aforementioned cells into other cells through microcell-mediated chromosome transfer (MMCT).

[0232] Example

[0233] The present invention will be further described in detail below through embodiments. However, the scope of the present invention is not limited to these embodiments.

[0234] [Example 1]

[0235] 1. Fabrication of Targeted Vectors

[0236] <Method>

[0237] method

[0238] Production of TV3R-dHLA

[0239] pEF-GFP (Addgene plasmid # 11154; RRID: Addgene_11154) was digested with restriction endonucleases using EcoRI-HF (New England BioLabs) and NotI-HF (New England BioLabs). The hygromycin resistance gene was cloned downstream of the human elongation factor 1α-derived promoter sequence using the In-Fusion HD Cloning Kit (Clontech) according to the accompanying protocol, thus creating pEF-Hyg (SEQ ID NO.1). Next, the upstream side of the human elongation factor 1α-derived promoter sequence encoded by pEF-Hyg was digested with the restriction endonuclease SalI, and the synthesized DNA fragment FRT-BGHpA-3'Neo-SA-loxP (Thermo Fisher Scientific) (SEQ ID NO.2) was cloned using the In-Fusion HD Cloning Kit, thus creating TV3.

[0240] Next, using the genome of MRC5 cells as a template, the sequence containing the 5' and 3' homologous regions of the targeting vector TV3R-dHLA was amplified using the following primer set via PrimeSTAR (registered trademark) GXL DNA Polymerase (Takara) according to the accompanying protocol.

[0241] hMOG CR LA fw1: AATTAGCCATGTGTGGTGGCACACG (SEQ ID NO.3)

[0242] hMOG CR RA rv1: CCCTGAGAGTCCTGTGCATATCAGC (SEQ ID NO.4)

[0243] The entire homologous region was further amplified by Nested-PCR using the following primer set and cloned into pGEM (trademarked)-T Easy Vector (Promega) to create pGEMTe-dHLA.

[0244] hMOG nest fw1: TGAGGCAGGAGAATCACTTG (SEQ ID NO.5)

[0245] hMOG nest rv1: GCTAAGGATTAAATCACTGCGGTTATC (SEQ ID NO.6)

[0246] Next, using the following primer set, pGEMTe-dHLA was amplified by PrimeSTAR (trademark) GXL DNA Polymerase. TV3 was then digested with restriction endonucleases using SalI-HF (New England BioLabs) and HindIII-HF (New England BioLabs). The prepared fragment containing FRT-BGHpA-3'Neo-SA-loxP was cloned using the In-Fusion (trademark) HD ​​Cloning Kit to prepare TV3-dHLA.

[0247] TV3-dHLA inf fw1: GACCTGCAGCCCAAGCTACCAGGGATAACAGGGGAACAG (SEQ IDNO.7)

[0248] TV3-dHLA inf rv1: GAATAGGAACTTCGTCGACTGTCAAGCAGCTAGCAGGC (SEQ IDNO.8)

[0249] Furthermore, using the following primer set, the synthesized DNA fragment P2A-mRuby2 (SEQ ID NO.9) (Thermo Fisher Scientific) was amplified by PrimeSTAR (registered trademark) GXL DNA Polymerase. After digesting the amplified product and TV3-dHLA with the restriction endonuclease BssHII (New England BioLabs), the two were ligated using the Ligation-Convenience Kit (Nippon gene) to create TV3R-dHLA.

[0250] RGpA seq fw1: ACTACTCCCAGTCATAGCTG (SEQ ID NO.10)

[0251] BGHpA seq rv1: CTATTGTCTTCCCAATCCTCC (SEQ ID NO.11)

[0252] Production of TV4-dH2

[0253] pEF-GFP (Addgene plasmid # 11154; http: / / n2t.net / addgene:11154; RRID:Addgene_11154) was digested with restriction endonucleases using EcoRI-HF and NotI-HF. The EGFP gene was then cloned downstream of the human elongation factor 1α-derived promoter sequence using the In-Fusion HD Cloning Kit according to the accompanying protocol, producing pEF-EGFP2 (SEQ ID NO. 12). Next, pEF-EGFP2 was digested with restriction endonucleases using BsrGI (New England BioLabs). The sequence P2A-5'Neo-SD-loxP-SA-T2A-Puro (Thermo Fisher Scientific) (SEQ ID NO. 13), synthesized as two DNA fragments, was cloned into the In-Fusion HD Cloning Kit, producing TV4dF.

[0254] TV4 was prepared by digesting TV4dF with restriction endonucleases using SalI-HF and then linking it to annealed oligonucleotides using the Ligation-Convenience Kit.

[0255] FRT fw: TCGAGGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCG (SEQID NO.14)

[0256] FRT rv: TCGACGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCC (SEQID NO.15)

[0257] Next, using the genome of C57BL / 6 mice as a template, the sequence containing the 5' and 3' homologous regions of the targeting vector TV4-dH2 was amplified using the following primer set via PrimeSTAR (registered trademark) GXL DNA Polymerase according to the accompanying protocol.

[0258] Mog CR LA fw1: GCGTCAGATCTCATTATGGATGGCTG (SEQ ID NO.16)

[0259] Mog CR RA rv1: CGAGCCTATGAGGGTCATTCTCACTC (SEQ ID NO.17)

[0260] Furthermore, the homologous region was amplified by Nested-PCR using the following primer set and cloned into pGEM (trademarked)-T Easy Vector (Promega) to create pGEMTe-dH2.

[0261] Mog nest fw1: GAACTCAGGACCTTCAGAAG (SEQ ID NO.18)

[0262] Mog nest rv1: CAACTAACACAGTTACTCCCATAAC (SEQ ID NO.19)

[0263] Next, using the following primer set, pGEMTe-dH2 was amplified by PrimeSTAR (trademark) GXL DNA Polymerase. TV4 was digested with restriction endonucleases using SalI-HF and HindIII-HF. The prepared fragment containing P2A-5'Neo-SD-loxP-SA-T2A-Puro was cloned using the In-Fusion (trademark) HD ​​Cloning Kit to produce TV4-dH2.

[0264] TV4-dH2 inf fw1: GTATAGGAACTTCGTCGAACGCTGGTAACATTTGCCAACATCT (SEQ IDNO.20)

[0265] TV4-dH2 inf rv1: ACCTGCAGCCCAAGCTTTGTTGGCCTGATATCTCATTAAATCTG (SEQ IDNO.21)

[0266] TV-TI1 / 2-BS production

[0267] Using pGEM (registered trademark)-T Easy Vector as the vector backbone, the Hprt expression vector TV-Tl1 / 2-Hprt (SEQ ID NO.22), which contains the 5' and 3' homologous regions used by TV-Tl1 / 2-BS, was digested with restriction endonucleases using XhoI (New England BioLabs) and XbaI (New England BioLabs). The DNA fragment (IDT) (SEQ ID NO.23) containing the blast fungicide resistance gene, which was synthesized, was cloned into it using the In-Fusion (registered trademark) HD ​​Cloning Kit to create TV-Tl1 / 2-BS.

[0268] Creation of genome editing vectors (1)

[0269] PX458a-dHLACR1 and PX458a-dH2CR1 gRNAs were designed for the following sequences. In the expression of gRNAs and Cas9, PX458a (SEQ ID NO.24) was prepared by modifying pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138; http: / / n2t.net / addgene:48138; RRID: Addgene 48138) and replacing the EGFP gene with the fluorescent protein Ametrine.

[0270] PX458a-dHLACR1: CTAGCTGCTGACAGTAACC (SEQ ID NO.25)

[0271] PX458a-dH2CR1: GATATCAGGCCAACAAACGC (SEQ ID NO.26)

[0272] Creation of genome editing vectors (2)

[0273] gRNAs PX458.1a-pHLACR2 and PX458.1a-pH2CR1 were designed for the following sequences. In the expression of gRNA and Cas9, PX458.1a (SEQ ID NO. 27) with the gRNA scaffold sequence modified was used.

[0274] PX458.1a-pHLACR2: GACTCATAAACCGGAGGAGC (SEQ ID NO.28)

[0275] PX458.1a-pH2CR1: CGTGTAGTAGGCGCCCGTTA (SEQ ID NO.29)

[0276] Preparation of drug-resistant mouse fetal fibroblasts (MEF)

[0277] To facilitate the culture of ES cells on feeder cells during drug screening, drug-resistant MEFs were created. First, MEFs were prepared from embryos at 14.5 days of gestation. The MEFs were then infected with a lentivirus expressing a gene (HBPN), which is a gene consisting of hygromycin resistance, blastomycin resistance, puromycin resistance, and neomycin resistance genes linked in a 2A sequence. To enhance the proliferation capacity of MEFs, HBPN-expressing MEFs were cultured under hypoxic conditions of 5% oxygen / 5% CO2 and treated with mitomycin C to create drug-resistant MEFs.

[0278] Cloning of MRC5-A9 fusion cells hChA9

[0279] GenomONE-CF (Ishihara Sangyo) was used to fuse MRC5 and A9 cells infused with the Neo resistance gene via lentivirus, and Ouabain-resistant / G418-resistant cells were isolated as fusion cells. Human cells were Ouabain-sensitive, while mouse cells were Ouabain-insensitive. Fusion cells could be screened by adding G418 and Ouabain to the culture medium. Fusion cells containing human chromosome 6 were identified by genomic PCR using the following primer set located in the region between the KIFC1 and DAXX genes.

[0280] pHLA probe fw2: AGTAAATCCTGACTGAGCACCTCCTG (SEQ ID NO.30)

[0281] pHLA probe rv1: GCTTGCGTGAGGCTGAAGTGTC (SEQ ID NO.31)

[0282] In addition, in the detection of human chromosome 6 by gene FISH, referring to the report of Jabs et al. (Am. J. Hum. Genet. 41:374-390, 1987), specific sequences targeting the centromere of human chromosome 6 and artificially synthesized DNA fragments were collected for probe preparation.

[0283] The synthesized sequence is as follows.

[0284] AAGGAGTTTCTGAGATTGCTTCTGTCTAGCTTTTATGGAAAGATATTTCCTTTTCTACCATAGGCCTCAAAGCGCTCTTAGTATACACTTCCAAATTCTACAAAGAGAGTGTTACTAAACCGCTCTCTCAAAGGAAATGTTAAACTCTATGAGTTGAAACACAGCACACAAACAGTTCTGAGACACTTCTGTCTGCCTTTTATGTGAAG ACATCCCTTTCCAAAGAATGCCTCCAAGGGTTCAAAATATCCACTTGTAGACTTTACAAAGAGAGTGTTCAAAACTTTCTCTACCAAAAGAAAGGTTAAAGACGGTGAGTTCAAACGCACACATCACAAAGTTGTTTCTAAGAATCATCTACTATGTTCTAGAGATGTTCCTTTCTATCATAGCTCAATGTCTAAATATCCACTGAATC (SEQ ID NO.32)

[0285] Cloning of TV3RhChA9

[0286] The clone obtained by targeting MRC5-A9 fusion cells with TV3R-dHLA (TV3RhChA9) was created by transfecting hChA9 cells with PX458a-dHLACR1 and the targeting vector TV3R-dHLA using PEI max (Polysciences). PX458a-dHLACR1 was co-introduced to improve the homologous recombination efficiency of the targeting vector. On the second day after transfection, the expression of the fluorescent gene mRuby2 on TV3R-dHLA was used as an indicator to sort the vector into cells, and clones with mRuby2-positive hygromycin resistance were isolated. Genomic DNA was prepared from the isolated clones, and clones that underwent recombination were identified by PCR. The primers used for PCR are as follows. The same analysis was performed when recloning was carried out from the isolated clones.

[0287] dHLA 5 typing fw1: CTTGGGGTCCAGAGAAGAAAATCACTC (SEQ ID NO.33)

[0288] BGHpA typing fw1: CTCTATGGCTTCTGAGGCGGAAAGAAC (SEQ ID NO.34)

[0289] TV4RENKA clone

[0290] TV4RENKA is an ES cell clone created by transfecting PX458a-dH2CR1 and the targeting vector TV4-dH2 into RENKA cells using Lipofectamine 3000 (Thermo Fisher Scientific). PX458a-dH2CR1 was co-introduced to improve the homologous recombination efficiency of the targeting vector. EGFP-positive clones were isolated, and clones exhibiting recombination were identified by genomic PCR. Clonal isolation for XO and BDF1 cells can be performed similarly.

[0291] The primers used for PCR are as follows.

[0292] Mog 3' typing fw1: CGGAGCCTCACGCGATGATCTA (SEQ ID NO.35)

[0293] Mog 3' typing fw2: AGTACACTGTAGTTGTCCTCAGATACTCC (SEQ ID NO.36)

[0294] Mog 3' typing rv1: TCCACCCCAAACATTTCCACTAACTG (SEQ ID NO.37)

[0295] TV3-4 RENKA clone

[0296] TV3-4RENKA is an ES cell clone created by introducing a modified human chromosome 6 from TV3RhChA9 into TV4RENKA using the retro-MMCT method (Suzuki, T. et al. (2016) PloS One, 11(6):e0157187.). Cells with mRuby2-positive hygromycin resistance were cloned, and clones with 41 chromosomes were isolated. In FISH analysis, mouse Cot-1 labeled with Cy3 and RP11-54H13 labeled with Cy5 were detected.

[0297] TV3-4 RENKATl3 / 4 clone

[0298] The Cre expression vector was introduced into TV3-4RENKA using Lipofectamine 3000, inducing chromosomal translocations at loxP. Clones exhibiting chromosomal translocations were isolated using G418 resistance as an indicator, designated as "TV3-4RENKAT13 / 4". Genomic PCR confirmed recombination, and FISH analysis confirmed the translocation between mouse chromosome 17 and human chromosome 6.

[0299] The primers used for PCR are as follows.

[0300] 5Neo_O fw1: TGCCAGGCCAGGATCTGCTG (SEQ ID NO.38)

[0301] Neo_O rv1: ATCCGGTGCTTGGCTTGATG (SEQ ID NO.39)

[0302] In the FISH analysis, Cy3-labeled RP11-54H13, DY490-labeled RP23-147G23 and Cy5-labeled RP23-119G24, or Cy3-labeled human Cot-1 and DY490-labeled mouse Cot-1 were detected.

[0303] TV3-4 RENKATlb clone

[0304] In the TV3-4RENKATlb clone, TV-Tl1 / 2-BS, PX458.1a-pHLACR2, and PX458.1a-pH2CR1 were co-introduced into TV3-4RENKATl3 / 4 using Lipofectamine 3000. On the second day after transfection, Ametrine-positive cells were sorted, and clones resistant to blast fungicides were isolated. Genomic PCR confirmed recombination, and FISH analysis confirmed MHC region substitution.

[0305] The primers used for PCR are as follows.

[0306] pH2 seq fw: CACATGTCCCTTCTGCCATAAG (SEQ ID NO.40)

[0307] Tlb typing rv1: AGAGATCACTGAAGCTGCTAC (SEQ ID NO.41)

[0308] In the FISH analysis, Cy3-labeled RP11-147G23, DY490-labeled human Cot-1, and Cy5-labeled RP23-306H20 were detected.

[0309] TV3-4RENKATlbdh6 clone

[0310] To isolate the detached human chromosome 6 clone TV3-4RENKATlbdh6 from TV3-4RENKATlb, mRuby2-negative cells were sorted and seeded onto feeder cells for clone isolation. Further, FISH analysis of the 40-chromosome clone (39 in the XO case) confirmed the detachment of the human chromosome 6. FISH analysis used Cy3-labeled RP11-147G23, DY490-labeled human Cot-1, and Cy5-labeled RP23-361C19 for detection. The isolation of TV3-4XOTlbdh6 and TV3-4BDF1Tlbdh6 was performed using the same procedure as for TV3-4RENKATlbdh6.

[0311] 2. Production of MHC humanized mice

[0312] MHC humanized chimeric mice were created using MHC humanized ES cells and ICR-derived embryos via a combined chimerism method. For MHC humanized mice, in the case of chimeric mice created using RENKA-derived MHC humanized ES cells, sperm cells were isolated from the testes and microfertilized with oocytes from B6 / DBA F1 mice or ICR mice. Additionally, in the case of female chimeric mice created using XO ES cells to generate MHC humanized ES cells, MHC humanized chimeric mice (MHC humanized heterozygous mice) were created by mating them with male C57BL / 6 mice. The establishment of MHC humanized mice was confirmed by EGFP fluorescence and genomic PCR in the pups.

[0313] The primer set used for genomic PCR is as follows.

[0314] DAXX:

[0315] Fw, TCTAGTCCCTTCAAGGGCTGAG (SEQ ID NO.42)

[0316] Rv, ACAATGTCTCTCTGAAGGCTGTAC (SEQ ID NO.43)

[0317] MICA:

[0318] Fw, AACATCACCGTGACATGCAG (SEQ ID NO.44)

[0319] Rv, TGTCTGCCAATGACTCTGAAG (SEQ ID NO.45)

[0320] MOG:

[0321] Fw, CAGCTGCAGCAATTACCGGAGTG (SEQ ID NO.46)

[0322] Rv, GAAGGGAGGCATGTCAGTAGGTC (SEQ ID NO.47)

[0323] S76:

[0324] Fw, CCTTTGTGACAGCGCACGTT (SEQ ID NO.48)

[0325] Rv, CCAGACACTAGGGGCTTTCGT (SEQ ID NO.49)

[0326] DAXX (confirmed based on 3 primers):

[0327] Human / mouse common primer, CGGCTGGATGAGGTCATCTCCAA (SEQ ID NO.50)

[0328] Mouse-specific primers, GACTCAACTCTGGGAGCTCATG (SEQ ID NO.51)

[0329] Human-specific primer, GTTTCAAACAGGTGGCTCATGC (SEQ ID NO.52)

[0330] 3. Results and Investigation

[0331] Construction of vectors for replacing MHC regions

[0332] First, a series of vectors required for recombination operations were constructed. Considering the impact of transposition on the expression of surrounding genes, targeting vectors TV3R-dHLA and TV4-dH2 were designed for recombination between the MOG and GABBR1 loci, which are located distal to the MHC region in humans or mice and have large intergenic sequences, to introduce TV3R or TV4 sequences. Figure 5 (A, B). In addition, to improve homologous recombination efficiency, CRISPR vectors PX458a-dHLACR1 and PX458a-dH2CR1 were created that induce DNA double-strand cleavage at their respective target sites.

[0333] TV3R encodes the loxP sequence required for translocation induction, the 3' side sequence of the Neo resistance gene for G418 resistance during translocation recombination, the FRT sequence for removing the sequence in the targeting vector after translocation induction, the hygromycin resistance gene for drug screening during targeting, and the red fluorescent gene mRuby2 for detecting the presence of the targeted chromosome.

[0334] On the other hand, TV4 encodes the loxP sequence required for translocation induction, the 5' flanking sequence of the Neo resistance gene for G418 resistance during translocation recombination, the FRT sequence for removing the sequence within the targeting vector after translocation induction, the puromycin resistance gene for drug screening during targeting, and the green fluorescent gene EGFP for detecting the presence of the targeted chromosome. The TV3R and TV4 sequences were designed to retain the EGFP expression unit and the reconstructed Neo resistance gene in mouse chromosome 17 after translocation induction, allowing for the selection of MHC humanized mouse chromosome 17 maintainer cells via drug and fluorescence.

[0335] Next, the targeting vector TV-Tl 1 / 2-BS for inducing translocation recombination between the DAXX and KIFC1 loci, which are proximal to the MHC region in humans and mice and have large intergenic sequences, and the CRISPR vectors PX458.1a-pHLACR2 and PX458.1a-pH2CR1 for cleaving their respective target sites to improve recombination efficiency were prepared. Figure 5 C). Because the blast fungicide resistance gene expression cassette was introduced into the TV-Tl 1 / 2-BS, the recombinant cells were designed to be screened for blast fungicide resistance. Furthermore, the vector was designed to ultimately recombine the blast fungicide resistance gene onto the residual human chromosome 6 removed from ES cells. Therefore, no exogenous gene expression cassette was introduced proximal to the MHC region of humanized mouse chromosome 17, thus minimizing the impact on gene expression around the humanized MHC region.

[0336] Production of A9-MRC5 fusion cells

[0337] To introduce human chromosome 6 from normal human fibroblast MRC5 cells into mouse ES cells (hereinafter referred to as ES cells), it is necessary to create fusion cells of MRC5 cells and mouse fibroblast A9 cells with high chromosome supply capacity. Therefore, firstly, to screen the fusion cells for drugs, a neomycin resistance gene was introduced into MRC5 cells using lentivirus (…). Figure 4Step 1 (circled number 1. Subsequent steps following Step 1 will also be numbered with circles, similar to Step 1). Next, neomycin-resistant MRC5 cells were fused with A9 cells to isolate the fusion cell line hChA9, which is resistant to both guanylin and G418, drugs that selectively kill human cells. Figure 4 (Step 2).

[0338] Genomic PCR confirmed the presence of human HLA sequences in the isolated clones, and signals were detected in clones #1, 5, and 13. Figure 6 A). Furthermore, to confirm the presence of human chromosome 6 in hChA9#5, analysis was performed using a centromere sequence-specific probe of human chromosome 6 via FISH. The results confirmed the presence of two human chromosomes 6 in this fusion cell clone. Figure 6 B).

[0339] TV3R Target

[0340] The target vector TV3R-dHLA was introduced into the distal MHC region of human chromosome 6 in hChA9#5, introducing the sequence required for MHC region replacement. Figure 4 (Step 3).

[0341] As a result, clones resistant to hygromycin were isolated, and genomic PCR analysis revealed multiple targeted cells, TV3RhChA9 (…). Figure 7 A). To rule out the possibility of cloning contamination, TV3RhChA9#5-45 (128) was re-cloned, and TV3RhChA9#5-45a (128) was isolated. Figure 7 B). FISH analysis of TV3RhChA9#5-45a (128) confirmed that more than half of the cells retained one human chromosome 6. Figure 7 C). Therefore, TV3RhChA9#5-45a(128) was used as a donor cell for modifying human chromosome 6.

[0342] TV4's target

[0343] TV4-dH2 was targeted to the distal MHC region on chromosome 17 of the RENKA cell line in B6-derived mouse ES cells, and the sequence required to replace the MHC region was introduced. Figure 4 (Step 4).

[0344] Analysis of EGFP-positive clones by genomic PCR confirmed a large number of clones that had undergone recombination. Figure 8A). For EGFP within the TV4 sequence, its mere presence in the MHC humanized allele is sufficient for confirming germline transmission. Therefore, the clone TV4RENKA#17, with 40 chromosomes targeted by a single allele, was used for subsequent experiments. Figure 8 ).

[0345] Introduction of modifications to human chromosome 6

[0346] The modified human chromosome 6 of TV3RhChA9#5-45a (128) was introduced into TV4RENKA#17. Figure 4 (Step 5). Typically, ES cells have low chromosome transfer efficiency, and fused cells tend to have lower chromosome supply capacity compared to A9 cells. Therefore, it was considered that previous chromosome transfer methods using polyethylene glycol (PEG-MMCT) might not be effective. Therefore, a highly efficient chromosome transfer method utilizing an ecotropic envelope protein derived from mouse leukemia virus (retro-MMCT) was used to transfer modified human chromosome 6.

[0347] Hygromycin-resistant / mRuby2-positive ES cells were cloned, chromosome specimens were prepared, and karyotype analysis was performed. Normal mouse cells have 40 chromosomes (XO: 39), while TV3-4RENKA#17 / 5-45a-3 was confirmed to have 41 chromosomes (XO: 40). Furthermore, it was confirmed that it retains a submesocentric chromosome characteristic of human chromosome 6, and therefore further FISH analysis was performed, revealing that this chromosome contains a human MHC region. Therefore, it can be considered that the modification of human chromosome 6 (…) was successfully introduced. Figure 9 ).

[0348] Induction of chromosomal translocation using Cre / loxP

[0349] The recombinase Cre can induce translocations between loxP sequences located on separate chromosomes. Therefore, a translocation can be induced between the distal MHC region of the modified human chromosome 6 maintained by TV3-4RENKA#17 / 5-45a-3 and the modified mouse chromosome 17, resulting in transient expression of the recombinase Cre in TV3-4RENKA#17 / 5-45a-3. Figure 4 Step 6). During induced translocation recombination between loxPs present in the TV3 and TV4 sequences, the Neo resistance gene is reconstructed ( Figure 10A), therefore, clones resistant to G418 were isolated. Among these clones, genomic PCR and FISH confirmed a chromosome number of 41 (40 for XO) and that translocation recombination had occurred. This clone was designated "TV3-4RENKA Tl3 / 4#17-1" for subsequent experiments. Figure 10 BD).

[0350] Induction of chromosomal translocation using CRISPR / Cas9

[0351] For translocations in the proximal MHC region, ES cells were initially prepared with the Dre recognition sequence rox introduced proximally, as the translocation was intended to be induced using the same recombinase Dre as the distal translocation. However, Dre-based translocation efficiency is low, and the expression of the HPRT gene, intended as a selection marker, is highly demanding in ES cells. Therefore, it was found that HPRT gene expression reconstructed via recombination translocation could not tolerate HAT-based selection culture. Consequently, the modification of mouse chromosome 17 was changed to include only TV4, halting the destruction of the HPRT gene in ES cells and creating TV3-4RENKA Tl3 / 4#17-1.

[0352] Therefore, CRISPR / Cas9 was used to induce translocations proximal to the MHC region. Specifically, CRISPR vectors and translocation-inducing targeting vectors TV-Tl1 / 2-BS, which cut the KIFC1 to DAXX gene regions on mouse chromosome 17 and human chromosome 6 respectively, were introduced into TV3-4RENKA Tl3 / 4#17-1, and clones resistant to blast fungicide were isolated. Figure 4 (Step 7). The cloned TV3-4RENKA Tlb#38 contained 41 chromosomes (40 for XO), and translocation recombination was confirmed by genomic PCR. Furthermore, FISH analysis revealed a translocation between the modified human chromosome 6 and the modified chromosome 17, but not between the modified chromosome 6 and the wild-type chromosome 17. Therefore, TV3-4RENKA Tlb#38 was used for subsequent experiments. Figure 11 ).

[0353] Isolation of MHC humanized ES cells

[0354] To ensure the undifferentiated nature of MHC-humanized ES cells, the initial plan was to introduce the MHC-humanized mouse chromosome 17 prepared so far into ES cells with a low passage count, thereby creating MHC-humanized ES cells by deleting the endogenous mouse chromosome 17. Figure 4(Step 8'). However, this operation requires the creation of ES-A9 fusion cells and the introduction of MHC humanized chromosomes into the ES cells. During this process, frequent chromosomal abnormalities were observed, limiting the operation. Therefore, an attempt was made to allow the human chromosome to detach naturally from TV3-4RENKA Tlb#38, isolate multiple MHC humanized ES clones, and create chimeric mice (…). Figure 4 (Step 8).

[0355] Human chromosomes have been reported to readily detach in mouse cells. Therefore, culturing TV3-4RENKA Tlb#38 for several days in the absence of selection drugs induced the shedding of residual human chromosome 6. In the isolation of clones with residual human chromosome 6 shedding, 6-thioguanine, which is capable of screening HPRT gene-deficient cells, was initially planned as a selection drug; however, as mentioned above, it was found that the Hprt gene was difficult to use as a selection marker in ES cells.

[0356] Therefore, using the expression of the fluorescent gene mRuby2, designed to resemble the residual human chromosome 6, as an indicator, mRuby2-negative cells were sorted to isolate clones. As a result, the isolation of the TV3-4RENKATlb#38dh6 clone, derived from the detachment of the residual human chromosome 6, was successfully achieved. Figure 12 Of these, the TV3-4RENKA Tlbdh6#3 mouse chromosome 17, with 40 chromosomes (39 for XO) and confirmed to have MHC humanized chromosome 17 by FISH, was used for subsequent experiments. Furthermore, using the mouse genome sequence and sequences within the human MHC region as references, whole-genome sequencing analysis of the TV3-4RENKA Tlbdh6#3 was performed to identify the haplotype of the introduced human MHC gene group. Figure 12 C).

[0357] Establishment of MHC humanized mice

[0358] Chimeric mice were created from TV3-4RENKATlb#38dh6#3, resulting in three mice with a coat color chimerism rate of 50%–60%. Figure 13 A)( Figure 4 (Step 9).

[0359] ES-derived cells with humanized MHC chromosomes were designed to express EGFP. Figure 13 B). Therefore, the contribution rate of MHC humanized ES cells in the testes was analyzed using EGFP expression as an indicator, and the results showed that almost 100% were EGFP positive. Figure 13C). Therefore, it can be concluded that if testicular cells are subjected to intracytoplasmic sperm injection (ICSI / ROSI), the probability of obtaining offspring is high. Thus, intracytoplasmic sperm injection was performed using testicular cells from chimeric mice. Figure 4 (Step 10).

[0360] As a result, MHC-humanized ES cell line propagation was successfully obtained, and MHC-humanized mice exhibiting whole-body green fluorescence were produced. Figure 14 A, B). Furthermore, genomic PCR also confirmed that EGFP-positive individuals possessed sequences from the human MHC region (A, B). Figure 14 C). These results show that MHC humanized (hybrid) mice have been successfully established.

[0361] Creation of MHC humanized mice based on natural mating of chimeric mice

[0362] So far, results have shown that MHC-humanized chimeric mice derived from B6-derived ES cells have low reproductive capacity. Therefore, MHC humanization of XO ES cells (B6 / CBA F1) that develop into females was also performed to create chimeric mice. Figure 15 A)( Figure 4 (Step 9), and mated with wild-type mice.

[0363] As a result, MHC humanized heterozygous mice were successfully obtained through natural mating. Figure 15 BD) ( Figure 4 (Step 10).

[0364] 4. Expression analysis of human MHC genes in MHC-humanized (hybrid) mice

[0365] <Method>

[0366] Expression analysis of human MHC (also known as HLA) proteins

[0367] In the preparation of spleen cells, the removed spleen was first minced with a scalpel, and then the tissue slide was ground using a frosted glass slide. Next, the cells were hemolyzed with 0.83% ammonium chloride, and spleen cells were prepared using a nylon mesh. In flow cytometry analysis, cells were stained with Pacific Blue-labeled anti-mouse CD19 antibody (Biolegend), APC-labeled anti-HLA class I antibody (MBL) using the APC Conjugation Kit-Lightning-Link (Abcam), or APC-labeled anti-HLA-DR, DP, DQ antibody (Biolegend), and analyzed using FACS AriaIII (BD). In Western blot-based analysis, detection was performed using anti-HLA-A, B, C antibody (MBL), anti-HLA-A antibody (Abcam), anti-HLA-DRA antibody (Abcam), or HRP-labeled anti-ACTB antibody (Genscript).

[0368] In the preparation of lung-derived fibroblasts, the extracted lung tissue was first minced with a knife, then treated with 0.1% collagenase A (Roche) for 1 hour. After the cells were freed by pipetting, they were passed through a nylon mesh to prepare lung-derived fibroblasts. The lung-derived fibroblasts were cultured in 10% FCS supplemented with DMEM.

[0369] result

[0370] The expression of human MHC genes in spleen cells was analyzed at the protein level. First, spleen cells were prepared from wild-type (Wt) and MHC-humanized (hybrid) mice (Het) derived from XO ES cells. The expression of human MHC proteins was analyzed using Western blotting with anti-HLA-A, B, C, anti-HLA-A, and anti-HLA-DRA antibodies. The results showed that human MHC expression was specifically detected in Het-derived spleen cells. Figure 16 A).

[0371] Next, the expression of HLA proteins on the cell surface was analyzed. Splenic cells are mainly composed of B cells and T cells, and it was confirmed that MHC class I was expressed in all cells and MHC class II was expressed in B cells. Therefore, flow cytometry was used to analyze the expression of antibodies against CD19 (a marker for B cells), anti-HLA class I antibodies recognizing human MHC class I, and anti-HLA-DP, DQ, and DR antibodies recognizing human MHC class II. The results showed that HLA class I was detected in all Het-derived spleen cells, confirming the specific expression of HLA-DP, DQ, and DR in Het-derived B cells. Figure 16 B).

[0372] [Example 2]

[0373] Preparation of cells and animals capable of deleting and eliminating chromosomes in the MHC region

[0374] In MHC-humanized (hybrid) ES cells, because the MHC region of one allele has been humanized, the induction of CRISPR / Cas9-based genome sequence deletion and gene destruction targeting sequences within the mouse MHC region will occur entirely on alleles containing the mouse MHC region. Figure 17 Therefore, if the mouse MHC gene cluster is disrupted or deleted in MHC humanized (hybrid) ES cells, mouse MHC gene cluster deletion alleles can be prepared. Since MHC humanized (hybrid) mice can be produced from MHC humanized (hybrid) ES cells, mouse MHC gene cluster deletion mice can be produced by creating MHC humanized (hybrid) ES cells with mouse MHC gene cluster deletion.

[0375] <Summary of this embodiment>

[0376] In this example, humanized MHC humanized (hybrid) ES cells were created using the MHC regions from Daxx to Mog of XO ES cells derived from CBAxC57BL / 6 F1 mice to generate mouse MHC gene cluster deletion alleles. First, the distribution of the MHC gene clusters on the genome was observed, revealing that 35 out of 39 genes were present in 5 clusters without contamination with non-MHC genes. Figure 18These clusters are designated d1, d2, d3, d4, and d5 according to their size. Five MHC genes, H2-K1, H2-Oa, H2-M5, H2-M3, and H2-M2, exist in isolation and do not form clusters. These isolated MHC genes are classified as d6. MHC genes within clusters are deleted using two CRISPR / Cas9 inhibitors designed to clamp the clusters, while isolated MHC genes are disrupted using CRISPR / Cas9 inhibitors designed to destroy the protein-coding sequences of each MHC gene.

[0377] Specifically, such as Figure 19 As shown, MHC genes were sequentially deleted, and clones from d1 to d6 were isolated. Clone d1 is a clone from the d1 cluster of humanized (hybrid) ES cells lacking the MHC gene; clone d2 is a clone from d1 lacking the MHC gene from the d2 cluster; clone d3 is a clone from d2 lacking the MHC gene from the d3 cluster; clone d4 is a clone from d3 lacking the MHC gene from the d4 cluster; clone d5 is a clone from d4 lacking the MHC gene from the d5 cluster and further having the H2-M5 gene disrupted; clone d6 is a clone from d5 where the H2-K1, H2-Oa, H2-M3, and H2-M2 genes were disrupted. In the creation of d6 clones, the efficiency of gene destruction is reduced when all four genes are destroyed simultaneously. Therefore, depending on the situation, after separating the d6a clones H2-K1 and H2-M3, which only destroyed the d5 clone, H2-Oa and H2-M2 were destroyed to separate the d6 clone.

[0378] <Method>

[0379] Production of genome editing vectors

[0380] The expression of gRNA and Cas9 was achieved by modifying pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid#48138; http: / / n2t.net / addgene:48138; RRID: Addgene 48138) and replacing the marker fluorescent gene with Ametrine, resulting in PX458.1a.

[0381] The following vector was used for deletion of the d1 cluster. The sequence of the gRNA is as follows.

[0382] PX458.1a-M10.2upCR1: ATGCTGTACTGCCATACGAA (SEQ ID NO.53)

[0383] PX458.1a-M10.6downCR1: GATGTATCCACTCACGCACT (SEQ ID NO.54)

[0384] The following vector was used for deletion of the d2 cluster. The sequence of the gRNA is as follows.

[0385] PX458.1a-H2D1upCR1: ATTAAGGACACTAATACCTG (SEQ ID NO.55)

[0386] PX458.1a-Q10downCR1: CACACATTGCTGATCTGCTG (SEQ ID NO.56)

[0387] The following vector was used for deletion of the d3 cluster. The sequence of the gRNA is as follows.

[0388] PX458.1a-T24upCR1: AATATGATTGGATTGTACGT (SEQ ID NO.57)

[0389] PX458.1a-T3downCR1: CATCAATGCATAGATGTCTG (SEQ ID NO.58)

[0390] The following vector was used for deletion of the d4 cluster. The sequence of the gRNA is as follows.

[0391] PX458.1a-H2ObupCR1: TCATCTGGGGAAGTGCATCG (SEQ ID NO.59)

[0392] PX458.1a-H2Eb2CR1: AAGACTGGAGTTGTGTCCAC (SEQ ID NO.60)

[0393] The following vectors were used for the deletion of the d5 cluster and the disruption of H2-M5. The sequence of the gRNA is as follows.

[0394] PX458.1a-H2DMaupCR1:GATGCTCTGTTGAAACGTGA (SEQ ID NO.61)

[0395] PX458.1a-DMb1downCR1: CCAAGCAATCTGACCTGCTG (SEQ ID NO.62)

[0396] PX458.1a-H2-M5CR1: CATGAGAAGCACGCATACGA (SEQ ID NO.63)

[0397] The following vectors were used to disrupt H2-K1, H2-Oa, H2-M3, and H2-M2 contained in d6. The sequences of the gRNAs are as follows.

[0398] PX458.1a-H2M2CR1: CTGAGATCACCCGTAGAGAG (SEQ ID NO.64)

[0399] PX458.1a-H2M3CR1: CTTCATCCTTCTGCCAGGTC (SEQ ID NO.65)

[0400] PX458.1a-H2OaCR1: GCTGACAGCTCTGGTTCGGT (SEQ ID NO.66)

[0401] PX458.1a-H2K1CR1: TCTGCTGTGATGGGTCACAT (SEQ ID NO.67)

[0402] Isolation of d1 clones

[0403] In the creation of d1 clones after deleting the mouse MHC gene contained in d1, PX458.1a-M10.2upCR1 and PX458.1a-M10.6downCR1 were transfected into MHC humanized (hybrid) ES cells using a Lipofectamine 3000 (Thermo Fisher Scientific). The day after transfection, cells were sorted based on the expression of the fluorescent gene Ametrine. Cells were reseeded on day 2 or 3 post-sorting for clone isolation. Genomic DNA was prepared from the isolated clones, and PCR was used to identify clones with the d1 cluster deleted. The primers used for PCR are as follows.

[0404] M10.2up cel fw1: TCTGATGGAGGTCAGCCAGAC (SEQ ID NO.68)

[0405] M10.6down cel rv1:TGTGTTTCCTACTGCAAGGATC (SEQ ID NO.69)

[0406] FISH analysis was performed on PCR-positive clones with normal chromosome numbers, confirming that the d1 cluster had been deleted. In the FISH analysis, Cy3-labeled RP23-147G23 was used for detection of mouse chromosome 17, DY490-labeled RP23-355M14 was used for detection of the d1 cluster, and Cy5-labeled RP11-54H13 was used for detection of the human MHC region.

[0407] Isolation of d2 clones

[0408] In the creation of d2 clones after deleting mouse MHC genes contained in d1 and d2, PX458.1a-H2D1upCR1 and PX458.1a-Q10downCR1 were transfected into d1 clones using Lipofectamine 3000. Cells were sorted the following day using the expression of the fluorescent gene Ametrine as an indicator. Cells were reseeded on the second or third day after sorting for clone isolation. Genomic DNA was prepared from the isolated clones, and PCR was used to identify clones with the d2 cluster deleted. The primers used for PCR are as follows.

[0409] H2D1up cel fw1:TGACGCCATGCTTCGGCTAGC (SEQ ID NO.70)

[0410] Q10down cel rv1:CAGACCCAGTTTGAGTCAGTAG (SEQ ID NO.71)

[0411] FISH analysis was performed on PCR-positive clones with normal chromosome numbers, confirming that the d2 cluster had been deleted. In the FISH analysis, Cy3-labeled RP23-147G23 was used for detection of mouse chromosome 17, DY490-labeled RP23-101J16 was used for detection of the d2 cluster, and Cy5-labeled RP11-54H13 was used for detection of the human MHC region.

[0412] Isolation of d3 clones

[0413] In the creation of d3 clones after deleting mouse MHC genes contained in d1, d2, and d3, PX458.1a-T24upCR1 and PX458.1a-T3downCR1 were transfected into d2 clones using Lipofectamine 3000. Cells were sorted the following day using the expression of the fluorescent protein ametrine as an indicator. Cells were reseeded on day 2 or 3 after sorting, and clones were isolated. Genomic DNA was prepared from the isolated clones, and PCR was used to identify clones with the d3 cluster deleted. The primers used for PCR are as follows.

[0414] T24up cel seq fw1:AAGAGCTTAAGGCTGCTCTG (SEQ ID NO.72)

[0415] T3down cel rv1:CCAGGAGATGTCTCAATGCT (SEQ ID NO.73)

[0416] FISH analysis was performed on PCR-positive clones with normal chromosome numbers, confirming the deletion of the d3 cluster. In the FISH analysis, Cy3-labeled RP23-147G23 was used for detection of mouse chromosome 17, DY490-labeled RP23-268P19 was used for detection of the d3 cluster, and Cy5-labeled RP11-54H13 was used for detection of the human MHC region.

[0417] Isolation of d4 clones

[0418] In the creation of d4 clones after deleting mouse MHC genes contained in d1, d2, d3, and d4, PX458.1a-H2ObupCR1 and PX458.1a-H2Eb2CR1 were transfected into d3 clones using Lipofectamine 3000. The next day, cells were sorted based on the expression of the fluorescent protein ametrine. Cells were reseeded on day 2 or 3 after sorting, and clones were isolated. Genomic DNA was prepared from the isolated clones, and PCR was used to identify clones with the d4 cluster deleted. The primers used for PCR are as follows.

[0419] H2-Ob up cel fw1:TCATCACATAATGTAAAGATACCTGTG (SEQ ID NO.74)

[0420] H2-Eb2 CR1 cel rv1:GTGGAGTCACCCATGTGCTT (SEQ ID NO.75)

[0421] After confirming that the chromosome number of the PCR-positive clones was normal, they were used to create the d5 clone.

[0422] Isolation of d5 clones

[0423] In the creation of d5 clones (clones with deleted mouse MHC genes in d1, d2, d3, d4, and d5, and with H2-M5 disrupted), PX458.1a-H2DMaupCR1, PX458.1a-DMb1downCR1, and PX458.1a-H2-M5CR1 were transfected into d4 clones using Lipofectamine 3000. Cell sorting was performed the next day using the expression of the fluorescent protein ametrine as an indicator. Cells were reseeded on the second or third day after sorting, and clone isolation was performed. Genomic DNA was prepared from the isolated clones, and PCR was used to identify clones with the d5 cluster deleted. The primers used for PCR are as follows.

[0424] H2DMA up cel fw1:ATTTGTAGCCTCACATTCAATGC (SEQ ID NO.76)

[0425] DMb1 down cel rv1:GGCTGTTGACTTCCCAACTCTAATC (SEQ ID NO.77)

[0426] For PCR-positive clones, further analysis of H2-M5 gene disruption was performed. First, using the genomic DNA of each clone as a template, the sequence containing the target region of PX458.1a-H2-M5CR1 was amplified using the primers described below.

[0427] H2M5 CR1 cel fw2: TGCTCACCGGAGCTTTGGCCTTGAC (SEQ ID NO.78)

[0428] H2M5CR1 cel rv2: ACTGAAGCAATGTTTATGGACCATC (SEQ ID NO.79)

[0429] The PCR products were purified using Sephadex G-50 (Cytiva) or FavorPrep GEL / PCR Purification Mini Kit (Favorgen), and the target gene was confirmed to have been destroyed by sequencing analysis using the primers described below.

[0430] H2M5CR1 cel seq rv2: CAAGATGGACTTCGGGACTC (SEQ ID NO.80)

[0431] For clones that have confirmed the deletion of the d5 cluster and the disruption of H2-M5, the chromosome number is confirmed to be normal before they are used to create d6 clones.

[0432] Isolation of d6 clones

[0433] From the d6 clones containing all mouse MHC genes deleted or disrupted from d1 to d6, PX458.1a-H2M2CR1, PX458.1a-H2M3CR1, PX458.1a-H2OaCR1, and PX458.1a-H2K1CR1 were transfected into the d5 clone using Lipofectamine 3000. The cells were sorted the following day using the expression of the fluorescent protein ametrine as an indicator. Cells were reseeded on the second or third day after sorting for clone isolation. Since the efficiency of isolating d6 clones decreased when all four genes were disrupted simultaneously, d6a clones with disrupted H2-K1 and H2-M3 genes from the d5 clone were isolated, and then H2-Oa and H2-M2 genes were disrupted to create the d6 clones.

[0434] Genomic DNA was prepared from isolated clones, and the primers used below amplified sequences containing target sites of gRNAs designed for each MHC gene.

[0435] H2K1

[0436] H2-K1 CR1 cel fw1:CCTTCCAGGATCATACAGCC (SEQ ID NO.81)

[0437] H2-K1 CR1 cel rv1:CTCCACAAGCTCCATGTCCT (SEQ ID NO.82)

[0438] H2-M3

[0439] H2-M3 CR1 cel fw1: TGGATCCAGACTCCCGTATG (SEQ ID NO.83)

[0440] H2-M3 CR1 cel rv1: GTGAGAGTCATGATGCCCAG (SEQ ID NO.84)

[0441] H2-M2

[0442] H2-M2 CR1 cel fw1: GGAGGATGAAAGGGCTAAGC (SEQ ID NO.85)

[0443] H2-M2 CR cel rv1: CTCAGGAGACATGAGCTCCAG (SEQ ID NO.86)

[0444] H2-Oa

[0445] H2-Oa CR1 cel fw1: TTTGGAGACTTCGCCCACTC (SEQ ID NO.87)

[0446] H2-Oa CR1 cel rv1: ACTCTGGGAGGCACTAGGAG (SEQ ID NO.88)

[0447] Each PCR product was purified using Sephadex G-50 or FavorPrep GEL / PCR Purification Mini Kit, and the target gene was confirmed to have been destroyed by sequencing analysis using the primers listed below.

[0448] H2K1

[0449] H2-K1 CR1 seq fw1: CAATGGCTCATGTGGATTCC (SEQ ID NO.89)

[0450] H2-M3

[0451] H2-M3 CR1 seq rv1: CTTCCTTACCCCATTTCAGG (SEQ ID NO.90)

[0452] H2-M2

[0453] H2-M2 CR seq fw1: CTACTTCACGCATACCGTCAG (SEQ ID NO.91)

[0454] H2-Oa

[0455] H2-Oa CR1 seq rv1: CACCTGCAGAAACGTTCTGG (SEQ ID NO.92)

[0456] In SNP analysis upstream and downstream of the H2-M2 gRNA target site, genomic sequences containing the SNP sites were amplified and confirmed by sequencing analysis. All PCR products were purified using Sephadex G-50 or the FavorPrep GEL / PCR Purification Mini Kit. The primer sequences used for genomic sequence amplification and sequencing analysis are as follows.

[0457] Amplification of the genomic sequence containing the SNP (GRCm38 / mm10, chr17:37466727) located upstream of the H2-M2 gRNA target site.

[0458] H2M2 up SNP fw1: ATCATTCCTAGGCTGCATCACTCAG (SEQ ID NO.93)

[0459] H2M2 up SNP rv1: CCTCACTCATGGAGGAGGCTGATGC (SEQ ID NO.94)

[0460] Sequencing analysis

[0461] H2M2 up SNP seq fw1: TTCACTTTCTGGGAAGTACG (SEQ ID NO.95)

[0462] The SNP sequence is A in CBA and C in C57BL / 6.

[0463] Amplification of genomic sequences containing SNPs (GRCm38 / mm10, chr17:37491000, 37491007) downstream of the H2-M2 gRNA target site.

[0464] H2-M2 down SNP fw1: GACCGTAGGACCATTTGCCATGTTC (SEQ ID NO.96)

[0465] H2-M2 down SNP rv1: TCACTGATACCAAGCAGTAGTTCTG (SEQ ID NO.97)

[0466] Sequencing analysis

[0467] H2-M2 down SNP seq fw1: ACACTTGAAGTTATTGTCATACAG (SEQ ID NO.98)

[0468] For the SNP sequence, 37491000 is C in CBA and T in C57BL / 6, and 37491007 is C in CBA and A in C57BL / 6.

[0469] For clones that have confirmed gene damage and SNP retention, normal chromosome number has been confirmed.

[0470] Analysis of d5 homozygous mice

[0471] In the analysis of CD4-positive T cells, spleen cells or thymocytes from wild-type or d5 homozygous mice were prepared and stained with anti-CD3, CD4, and CD8 antibodies (Biolegend). For CD3-positive cells, the proportions of CD4- and CD8-positive cells were analyzed using FACSAriaIII (BDBiosciences).

[0472] In the class conversion analysis, 11–15-week-old wild-type (n=3) or d5 homozygous mice (n=1) were subcutaneously immunized with 10 μg of recombinant SARS-CoV-2 S Protein S1+S2 (Biolegend) and 50 μg of poly (I:C) (Invivogen). Three weeks later, a booster immunization was performed with 10 μg of recombinant SARS-CoV-2 S Protein S1+S2 and 50 μg of poly (I:C). Serum was recovered one week after the booster immunization, and anti-S1 IgG1 and IgG2 were analyzed by ELISA.

[0473] Analysis of d6 chimeric mice

[0474] In the analysis of chromosomes with MHC gene cluster deletions, the following primers were used for identification via the deletion of the d5 cluster. The size of the PCR product was 447 bp in the wild type and 633 bp in the case of ES clones created from d6 mice with d5 ​​deletion.

[0475] Fw1: ATTTGTAGCCTCACATTCAATGC (SEQ ID NO.99)

[0476] Rv1: GGCTGTTGACTTCCCAACTCTAATC (SEQ ID NO.100)

[0477] Rv2: AGCACAGCTCCTGACTTCTG (SEQ ID NO.101)

[0478] <Results>

[0479] Isolation of d1 clones

[0480] gRNAs were designed within the protein-coding sequences of the upstream portion of the H2-M10.2 locus and the H2-M10.6 locus. The d1 cluster was then isolated by using CRISPR / Cas9 to induce deletion in MHC humanized (hybrid) ES cells using these two gRNAs. Figure 20 A primer set was designed to generate PCR amplification products in the case of a genomic sequence deletion sandwiched between two CRISPR / Cas9 target sequences. Genomic PCR was performed using this primer set, resulting in multiple PCR-positive clones. FISH analysis was performed on clone #26, which was confirmed to have a normal chromosome number (39 in XO ES cells) among the PCR-positive clones, using a probe that recognizes the d1 cluster. The results confirmed the deletion of the d1 cluster.

[0481] Isolation of d2 clones

[0482] gRNAs were designed within the protein-coding sequences of the upstream portion of the H2-D1 locus and the H2-Q10 locus. The d2 clone was isolated by using CRISPR / Cas9 to induce deletion of the d2 cluster in d1 clone #26. Figure 21 A primer set was designed to generate PCR amplification products in the case of a genomic sequence deletion sandwiched between two CRISPR / Cas9 target sequences. Genomic PCR was performed using this primer set, resulting in multiple PCR-positive clones. FISH analysis was performed on clone #85, a PCR-positive clone with a normal chromosome number, using a probe that recognizes the d2 cluster, confirming the deletion of the d2 cluster.

[0483] Isolation of d3 clones

[0484] gRNAs were designed upstream of the H2-T24 locus and downstream of the H2-T3 locus. The d3 clone was isolated by using CRISPR / Cas9 to induce deletion of the d3 cluster in d2 clone #85. Figure 22 A primer set was designed to generate PCR amplification products in the case of a genomic sequence deletion sandwiched between two CRISPR / Cas9 target sequences. Genomic PCR was performed using this primer set, resulting in multiple PCR-positive clones. FISH analysis was performed on clone #26, which was confirmed to have a normal chromosome number among the PCR-positive clones, using a probe that recognizes the d3 cluster. The results confirmed the deletion of the d3 cluster.

[0485] Isolation of d4 clones

[0486] gRNAs were designed in the upstream region of the H2-Ob locus and within the protein-coding sequences of the H2-Eb2 locus. The d4 clone was isolated by using CRISPR / Cas9 to induce deletion of the d4 cluster in d3 clone #26. Figure 23 A primer set was designed to generate PCR amplification products in the event of a genomic sequence deletion sandwiched between two CRISPR / Cas9 target sequences. Genomic PCR was performed using this primer set, resulting in multiple PCR-positive clones. Furthermore, the PCR-positive d4 clone #72 was confirmed to have a normal chromosome number.

[0487] Isolation of d5 clones

[0488] gRNAs were designed within the protein-coding sequence of the H2-DMa locus and downstream of the H2-DMb1 locus. Deletion of the d5 cluster of clone #72 (d4) was induced using CRISPR / Cas9 with these two gRNAs. Furthermore, gene disruption of H2-M5 was simultaneously achieved using gRNAs designed within the H2-M5 protein-coding region, leading to the isolation of the d5 clone. Figure 24 A primer set was designed to generate PCR amplification products in the event of a genomic sequence deletion sandwiched by the two CRISPR / Cas9 target sequences mentioned above. Genomic PCR was performed using this primer set, resulting in multiple PCR-positive clones. Next, sequencing analysis was performed on the PCR-positive clones to determine whether the H2-M5 gene was damaged. The results confirmed a 13-base deletion in clone #22 of d5. Further chromosome number analysis was performed on the clones confirming H2-M5 gene damage, confirming that clone #22 of d5 had a normal chromosome number.

[0489] Isolation of d6 clones

[0490] Using gRNAs designed within the protein-coding sequences of H2-K1, H2-Oa, H2-M2, and H2-M3, gene disruption of d5 clone #22 was performed via CRISPR / Cas9, leading to the isolation of d6 clone. Figure 25 ).

[0491] To confirm gene disruption using CRISPR / Cas9, sequencing analysis was performed, identifying four clones with completely disrupted genes. For H2-M2 and H2-M3, due to their location outside the humanized MHC region, the genes exist in two copies in the genome. Since the mutations enter their respective alleles, it is considered that two sequences might be detected during sequencing analysis. The ES cells used in this example were F1 cells derived from CBA and C57BL / 6, and the human MHC region is located on the CBA-derived chromosome. Therefore, for H2-M3, sequencing primers that specifically detect the C57BL / 6 allele using SNPs confirmed gene disruption. For H2-M2, no SNPs were found near the CRISPR / Cas9 target site, making allele-specific sequencing analysis difficult. Therefore, sequencing analysis was performed using primers that detect both alleles, and the results were... Figure 25 Only one sequence was detected in the d6 clone #198 shown. This could indicate either that the same mutation occurred in both alleles, or that a large deletion was induced between adjacent CRISPR / Cas9 target sequences by introducing multiple CRISPR / Cas9s, leaving only one allele that can be amplified by PCR.

[0492] Therefore, the analysis focused on whether SNPs near H2-M2 could be detected, and whether large deletions had occurred. Figure 26 As a result, SNPs located upstream and downstream of H2-M2 were detected in clone #198, thus confirming that no large deletions were induced. Since the chromosome number of #198 was also normal, it can be considered that the creation of ES cells with alleles of all 39 mouse MHC genes destroyed was successfully achieved.

[0493] Production of d5 cloned mice

[0494] For the d5 ES clone isolated during the process of inducing mouse MHC deletion, 35 out of 39 mouse MHC genes were disrupted / deleted, resulting in mouse MHC class II genes that do not perform antigen presentation. Therefore, the use of d5 ES clones to generate d5 homozygous mice was used to analyze whether the function of mouse MHC class II genes was actually lost.

[0495] First, the differentiation of T cells in wild-type and d5 homozygous mice was analyzed. Since d5 homozygous mice cannot perform MHC class II antigen presentation, it can be assumed that CD4-positive T cells will not differentiate. Therefore, the proportion of CD4-positive T cells in the spleen and thymus of d5 homozygous mice was analyzed, and the results showed that their proportion was significantly reduced (…). Figure 27In addition, to analyze antibody class switching in d5 homozygous mice, d5 homozygous mice were immunized with the SARS-CoV-2 spike protein, and the serum anti-S1 IgG1 and IgG2 were analyzed. The results showed that IgG1 and IgG2, which recognize the spike protein, were extremely rare or absent in d5 homozygous mice. Based on these results, it can be concluded that because d5 homozygous mice do not express mouse MHC class II cells, which play a role in antigen presentation, functional CD4-positive T cells are significantly reduced or absent.

[0496] Preparation of MHC gene cluster deletion mice

[0497] To create mice with all MHC genes destroyed or deleted, chimeric mice were cloned from d6ES and allowed to spread through germline distribution, resulting in d6 heterozygous mice. Figure 28 A, B). Next, genomic PCR was used to analyze the pups obtained by mating these d6 heterozygous mice, confirming the existence of homozygous mice with a MHC gene deletion chromosome (MHC gene deletion mice). Figure 28 C, D).

Claims

1. A chromosome of a non-human mammal, wherein all or part of the major histocompatibility complex (MHC) gene group is destroyed or missing.

2. The chromosome according to claim 1, wherein, Non-human mammals are rodents.

3. The chromosome according to claim 2, wherein, The rodent is the mouse.

4. A cell comprising the chromosome of claim 1 in a homozygous or heterozygous form.

5. The cell according to claim 4, wherein it is an embryonic stem cell.

6. A non-human mammal having the chromosomes described in claim 1.

7. A method for manufacturing a cell, said cell comprising: a chromosome containing the MHC gene group of mammal 2 (MHC gene group 2) in the chromosome of a non-human mammal 1, and a chromosome in which all or part of the MHC gene group 1 is destroyed or missing, wherein the mammal 2 is a mammal other than said non-human mammal 1, and the MHC gene group 1 is an MHC gene group derived from non-human mammal 1. The method includes: The process of destroying or deleting all or part of the MHC gene group (MHC gene group 1) of a non-human mammal 1 from a cell having chromosomes in a heterozygous form, wherein all or part of the major histocompatibility complex (MHC) gene group of a wild-type chromosome of a pair of chromosomes of a non-human mammal (non-human mammal 1) is replaced with a chromosome of the MHC gene group of another mammal (mammal 2) other than said non-human mammal 1.

8. The method according to claim 7, wherein, The cells are embryonic stem cells.

9. The method according to claim 7, wherein, The process of disrupting or deleting the MHC gene group 1 is based on a genome editing technology using CRISPR / Cas9.

10. The method according to claim 7, wherein, Non-human mammal 1 is a rodent.

11. The method according to claim 10, wherein, The rodent is the mouse.

12. The method according to claim 11, wherein, The steps to destroy or delete all or part of the MHC gene group 1 include: The process of using CRISPR / Cas9 genome editing technology to disrupt or delete all or part of the following gene groups: d1, d2, d3, d4, d5, and d6, in cells with mouse MHC gene groups consisting of the following gene groups. The gene groups are: the d1 gene group consisting of the genes H2-M10.2, H2-M10.1, H2-M10.3, H2-M10.4, H2-M11, H2-M9, H2-M1, H2-M10.5, and H2-M10.6; the d2 gene group consisting of the genes H2-D1, H2-Q1, H2-Q2, H2-Q4, H2-Q5, H2-Q6, H2-Q7, and H2-Q10; and the gene group consisting of the genes H2-T24, H2-T23, H2-T22, and G. The d3 gene group consists of the genes M11127, H2-BI, H2-T10, GM7030, GM8909, and H2-T3; the d4 gene group consists of the genes H2-Ob, H2-Ab1, H2-Aa, H2-Eb1, and H2-Eb2; the d5 gene group consists of the genes H2-DMa, H2-DMb2, and H2-DMb1; and the d6 gene group consists of the genes H2-K1, H2-Oa, H2-M5, H2-M3, and H2-M2.

13. The method according to claim 12, wherein, The genome editing vector used in CRISPR / Cas9 genome editing technology is a combination of vectors consisting of gRNAs having the base sequences shown in SEQ ID NO. 53-67.

14. A method for preparing a non-human mammal 1, wherein the non-human mammal 1 has chromosomes in which all or part of the MHC gene group 1 is destroyed or missing. The method includes: The process of preparing a non-human mammal 1 using cells obtained by the method of claim 7 and mating the non-human mammal 1, wherein the non-human mammal 1 has in a pair of chromosomes: a chromosome having the MHC gene group 2 of the mammal 2, and a chromosome in which all or part of the MHC gene group 1 is destroyed or missing.

15. A method for manufacturing cells, the method comprising: The process of recovering cells from non-human mammals 1 prepared by the method of claim 14 that have chromosomes with all or part of the MHC gene group 1 that are destroyed or missing.

16. A method for manufacturing chromosomes, the method comprising: The process of recovering chromosomes with disrupted or missing MHC gene cluster 1 from non-human mammals 1 prepared by the method of claim 14 or cells manufactured by the method of claim 15.

17. A genome editing vector, which is the genome editing vector used in the CRISPR / Cas9 genome editing technology as described in claim 13. The genome editing vector comprises a combination of vectors consisting of gRNAs having the base sequences shown in SEQ ID NO. 53-67.