Lilium polysaccharide composition, preparation method and application thereof

Abstract

This invention discloses a lily polysaccharide composition, its preparation method, and its applications, belonging to the field of biomedicine and functional food technology. The lily polysaccharide composition includes water-extracted polysaccharides, acid-extracted polysaccharides, and alkali-extracted polysaccharides extracted from lily. Furthermore, this invention provides a method for preparing the above-mentioned lily polysaccharide composition, comprising the following steps: S1, preparation of water-extracted polysaccharide LSWP; S2, preparation of acid-extracted polysaccharide LSAP; S3, preparation of alkali-extracted polysaccharide LSKP; S4, mixing the water-extracted polysaccharide LSWP, the acid-extracted polysaccharide LSAP, and the alkali-extracted polysaccharide LSKP to obtain the lily polysaccharide composition. In addition, this invention also proposes an application of the above-mentioned polysaccharide composition in the preparation of immunomodulatory drugs and / or anti-inflammatory drugs, functional foods, or health products. This polysaccharide composition exhibits excellent immunomodulatory and anti-inflammatory activities.

Description

Technical Field

[0001] This invention relates to the fields of biomedicine and functional food technology, specifically to a lily polysaccharide composition, its preparation method, and its application. Background Technology

[0002] Polysaccharides are a class of natural high-molecular-weight polymers composed of aldoses or ketoses linked by glycosidic bonds, widely found in animals, plants, and microorganisms. They possess complex structures, diverse biological activities, and are characterized by non-toxicity, biodegradability, and good biocompatibility, making them a focus of attention in functional foods and pharmaceuticals. Studies have shown that natural polysaccharides possess various biological functions, including anti-inflammatory, antitumor, antiviral, and immunomodulatory effects.

[0003] Lily is a traditional food and medicinal ingredient, its dried bulbs rich in polysaccharides, possessing high nutritional and medicinal value. Modern research shows that lily polysaccharides are one of its main bioactive components, exerting significant immunomodulatory effects through pathways such as activating immune cells and promoting cytokine release. It shows outstanding potential in improving immune function and assisting in anti-inflammation, making it an ideal natural raw material for developing functional foods and immunomodulators. Currently, research and development of lily polysaccharides mainly focus on common varieties such as *Lilium lancifolium* and *Lilium lancifolium*. However, there are significant species-specific differences in the active ingredients and functions of different lily species. *Lilium tigrinum* (Lilium tigrinum) is another example. Lilium lancifolium Thunb. is a unique resource, primarily produced in the Longshan area of ​​western Hunan Province, China. Its unique growing environment may have resulted in a distinctive polysaccharide composition that differentiates it from varieties such as Longya lily, suggesting its potential for immune regulation. However, systematic research on this unique resource is still relatively lacking, limiting its development and application in related high-value-added products.

[0004] In terms of extraction technology, existing methods mainly rely on hot water extraction alone, which makes it difficult to fully destroy the plant cell wall structure, resulting in the inability to simultaneously and efficiently extract water-soluble, acid-soluble, and alkali-soluble polysaccharides. In particular, the insufficient extraction of acid-soluble and alkali-soluble polysaccharide components not only wastes resources but also prevents the full acquisition and study of their complete immunomodulatory and anti-inflammatory functions. Summary of the Invention

[0005] Therefore, this invention targets Longshan lily, which has clear authentic characteristics and potential high activity, and aims to establish an innovative preparation process that can simultaneously and efficiently extract its water-soluble, acid-soluble, and alkali-soluble polysaccharides, so as to maximize the preservation and enhancement of its immunomodulatory and anti-inflammatory activities, and provide key technical support for the development of new functional products based on distinctive lily resources.

[0006] The purpose of this invention is to overcome the above-mentioned technical deficiencies and provide a lily polysaccharide composition, its preparation method and application, thereby solving the technical problem of how to obtain a lily polysaccharide composition with excellent immunomodulatory and / or anti-inflammatory activities in the prior art.

[0007] To achieve the above-mentioned technical objectives, the present invention provides a lily polysaccharide composition, comprising water-extracted polysaccharides, acid-extracted polysaccharides, and alkali-extracted polysaccharides extracted from lilies.

[0008] In any embodiment, the mass ratio of the water-extracted polysaccharide, the acid-extracted polysaccharide, and the alkali-extracted polysaccharide is (0.5-2):(0.5-2):(0.5-2).

[0009] In any embodiment, the mass ratio of the water-extracted polysaccharide, the acid-extracted polysaccharide, and the alkali-extracted polysaccharide is 1:1:1.

[0010] Furthermore, the present invention also provides a method for preparing the above-mentioned lily polysaccharide composition, comprising the following steps: S1. Preparation of water-extracted polysaccharide LSWP: Lily powder was mixed with water and extracted at 75-80℃. The extraction was repeated 2-3 times. The extracts were combined, concentrated, and then ethanol was added. The mixture was allowed to stand and precipitate. The precipitate was collected by centrifugation, washed and dried, and then dissolved in water. Proteins were removed by the Sevag method, and then the mixture was dialyzed and dried to obtain water-extracted polysaccharide LSWP. S2. Preparation of acid-extracted polysaccharide LSAP: The residue after water extraction in step S1 is mixed with citric acid solution and extracted at 75-80℃. The extraction is repeated 2-3 times. The extracts are combined, concentrated, dialyzed to remove small molecule salts, dried, dissolved in water, and proteins are removed 6-10 times using the Sevag method. After dialyzing and drying again, acid-extracted polysaccharide LSAP is obtained. S3. Preparation of alkaline-extracted polysaccharide LSKP: The residue after acid extraction in step S2 is mixed with sodium hydroxide solution and extracted at 75-80℃. The extraction is repeated 2-3 times. The extracts are combined, concentrated, dialyzed to remove small molecule salts, dried, dissolved in water, and proteins are removed 6-10 times using the Sevag method. The mixture is then dialyzed and dried again to obtain alkaline-extracted polysaccharide LSKP. S4. The water-extracted polysaccharide LSWP, the acid-extracted polysaccharide LSAP, and the alkali-extracted polysaccharide LSKP are mixed to obtain the lily polysaccharide composition.

[0011] In any embodiment, in step S1, the lily powder is mixed with water at a material-to-liquid ratio of 1:(20-25); and / or, in step S2, the residue after water extraction in step S1 is mixed with citric acid solution at a material-to-liquid ratio of 1:(20-25); and / or, in step S3, the residue after acid extraction in step S2 is mixed with sodium hydroxide solution at a material-to-liquid ratio of 1:(20-25).

[0012] In any embodiment, in step S1, the extraction is carried out at 75-80°C for 1-1.5 hours; and / or, in step S2, the extraction is carried out at 75-80°C for 1-1.5 hours; and / or, in step S3, the extraction is carried out at 75-80°C for 1-1.5 hours.

[0013] In any embodiment, in step S1, the lily powder is obtained by removing the fibrous roots, washing, freeze-drying, pulverizing, and passing through a 50-80 mesh sieve from fresh Longshan lily bulbs.

[0014] In any embodiment, in step S2 or S3, the small molecule salts are removed by dialysis for 2-3 days.

[0015] Furthermore, the present invention also proposes the application of the above-mentioned polysaccharide composition or the polysaccharide composition prepared by the above-mentioned preparation method in the preparation of immunomodulatory drugs, functional foods or health products and / or in the preparation of anti-inflammatory drugs, functional foods or health products.

[0016] In any embodiment, the immunomodulatory drug, functional food, or health product promotes the proliferation of immune cells and / or the secretion of cytokines; the anti-inflammatory drug, functional food, or health product inhibits the excessive inflammatory response of macrophages induced by bacterial lipopolysaccharide and the secretion of inflammatory factors.

[0017] Compared with existing technologies, the beneficial effects of this invention include: the lily polysaccharide composition proposed in this invention comprises water-extracted polysaccharides, acid-extracted polysaccharides, and alkali-extracted polysaccharides extracted from lilies. This polysaccharide composition exhibits excellent immunomodulatory and anti-inflammatory activities, promoting immune cell proliferation and / or cytokine secretion; it also inhibits excessive inflammatory responses and inflammatory factor secretion induced by bacterial lipopolysaccharide in macrophages. The method of this invention is mild, highly operable, and does not use toxic or harmful reagents, making it suitable for large-scale production and providing a reliable technical path for the high-value development and industrial application of Longshan lily. Attached Figure Description

[0018] Figure 1 This is a SEM image of the polysaccharide composition of *Lilium yunnanensis* prepared in Example 1.

[0019] Figure 2 This is a diagram illustrating the concentration-dependent regulatory effect of *Lilium lancifolium* polysaccharide on immune cell activity in Example 2.

[0020] Figure 3 This is a diagram illustrating the concentration-dependent regulatory effect of Lanzhou lily polysaccharide on immune cell activity in Example 2.

[0021] Figure 4 This is a diagram illustrating the concentration-dependent regulatory effect of the Longshan lily polysaccharide composition prepared in Example 1 on the activity of immune cells.

[0022] Figure 5 The graph shows the inhibitory effect of three lily polysaccharides on LPS-induced excessive production of TNF-α in Example 3.

[0023] Figure 6 This is a diagram illustrating the regulatory effect of three types of lily polysaccharides on the secretion level of immune cytokines in Example 4.

[0024] Figure 7 This is a graph showing the inhibitory effect of different Longshan lily polysaccharides on LPS-induced TNF-α gene expression in immune cells in Example 5.

[0025] Figure 8 This is a diagram illustrating the effect of different Longshan lily polysaccharides on the upregulation of TNF-α gene expression in normal immune cells in Example 5. Detailed Implementation

[0026] The "range" disclosed in this application is defined by a lower limit and an upper limit. A given range is defined by selecting a lower limit and an upper limit, which define the boundaries of a particular range. Ranges defined in this way can include or exclude endpoints and can be arbitrarily combined; that is, any lower limit can be combined with any upper limit to form a range. For example, if ranges of 60~120 and 80~110 are listed for a specific parameter, it is also expected that ranges of 60~110 and 80~120 are also included. Furthermore, if minimum range values ​​of 1 and 2 are listed, and if maximum range values ​​of 3, 4, and 5 are listed, then the following ranges are all expected: 1~3, 1~4, 1~5, 2~3, 2~4, and 2~5. In this application, unless otherwise stated, the numerical range "a~b" represents a shortened representation of any combination of real numbers between a and b, where a and b are real numbers. For example, the numerical range "0~5" indicates that all real numbers between "0~5" have been listed in this article; "0~5" is simply a shortened representation of these numerical combinations. Furthermore, when a parameter is stated as an integer ≥2, it is equivalent to disclosing that the parameter is, for example, an integer such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.

[0027] Unless otherwise specified, the terms "comprising" and "including" as used in this application can be open-ended or closed-ended. For example, "comprising" and "including" can mean that other components not listed may also be included, or that only the listed components may be included.

[0028] Unless otherwise specified, the term "or" is inclusive in this application. For example, the phrase "A or B" means "A, B, or both A and B". More specifically, the condition "A or B" is satisfied by any of the following conditions: A is true (or exists) and B is false (or does not exist); A is false (or does not exist) and B is true (or exists); or both A and B are true (or exist).

[0029] This specific embodiment provides a lily polysaccharide composition, including water-extracted polysaccharide, acid-extracted polysaccharide and alkali-extracted polysaccharide extracted from lily; the mass ratio of the water-extracted polysaccharide, the acid-extracted polysaccharide and the alkali-extracted polysaccharide is (0.5-2):(0.5-2):(0.5-2).

[0030] In some embodiments, the mass ratio of the water-extracted polysaccharide, the acid-extracted polysaccharide, and the alkali-extracted polysaccharide is 1:1:1.

[0031] Furthermore, this specific embodiment also proposes a method for preparing the above-mentioned lily polysaccharide composition, comprising the following steps: S1. Preparation of water-extracted polysaccharide LSWP: Lily powder and water were mixed at a material-to-liquid ratio of 1:(20-25) and extracted at 75-80℃ for 1-1.5 hours. The extraction was repeated 2-3 times. The extracts were combined, concentrated, and then ethanol was added. The mixture was allowed to stand to precipitate, and the precipitate was collected by centrifugation. The precipitate was then washed and dried, dissolved in water, and the protein was removed by the Sevag method. The precipitate was then dialyzed and dried to obtain water-extracted polysaccharide LSWP. The lily powder was obtained by removing the fibrous roots, washing, freeze-drying, pulverizing, and passing through a 50-80 mesh sieve from fresh Longshan lily bulbs. S2. Preparation of acid-extracted polysaccharide LSAP: The residue after water extraction in step S1 is mixed with citric acid solution at a material-to-liquid ratio of 1:(20-25), and extracted at 75-80℃ for 1-1.5 hours. The extraction is repeated 2-3 times. The extracts are combined, concentrated, and dialyzed for 2-3 days to remove small molecule salts. After drying, water is added to dissolve the solution. Proteins are removed 6-10 times using the Sevag method. The solution is dialyzed and dried again to obtain acid-extracted polysaccharide LSAP. S3. Preparation of alkaline-extracted polysaccharide LSKP: The residue after acid extraction in step S2 is mixed with sodium hydroxide solution at a material-to-liquid ratio of 1:(20-25), and extracted at 75-80℃ for 1-1.5 hours. The extraction is repeated 2-3 times. The extracts are combined, concentrated, and dialyzed for 2-3 days to remove small molecule salts. After drying, water is added to dissolve the solution. Proteins are removed 6-10 times using the Sevag method. The solution is dialyzed and dried again to obtain alkaline-extracted polysaccharide LSKP. S4. The water-extracted polysaccharide LSWP, the acid-extracted polysaccharide LSAP, and the alkali-extracted polysaccharide LSKP are mixed to obtain the lily polysaccharide composition.

[0032] This specific embodiment also proposes the application of the above-mentioned polysaccharide composition or the polysaccharide composition prepared by the above-mentioned preparation method in the preparation of immunomodulatory drugs, functional foods or health products and / or anti-inflammatory drugs, functional foods or health products. The immunomodulatory drugs, functional foods or health products are characterized by promoting the proliferation of immune cells and / or promoting the secretion of cytokines; the anti-inflammatory drugs, functional foods or health products are characterized by inhibiting the excessive inflammatory response of macrophages induced by bacterial lipopolysaccharide and the secretion of inflammatory factors.

[0033] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0034] In this invention, the terms "some embodiments," "this embodiment," and examples are used to describe a subset of all possible embodiments. However, it is understood that "some embodiments" can be the same subset or different subsets of all possible embodiments and can be combined with each other without conflict.

[0035] If the application documents contain similar descriptions such as "first / second", the following explanation shall be added: In the following description, the terms "first / second / third" are used only to distinguish similar objects and do not represent a specific ordering of objects. It is understood that "first / second / third" may be interchanged in a specific order or sequence where permitted, so that the embodiments described herein can be implemented in an order other than that illustrated or described herein.

[0036] In this embodiment, the term "and / or" is merely a description of the relationship between related objects, indicating that there can be three relationships. For example, object A and / or object B can represent three situations: object A exists alone, object A and object B exist simultaneously, and object B exists alone.

[0037] The following describes embodiments of this application. The embodiments described below are exemplary and are only used to explain this application, and should not be construed as limiting this application. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all conventional products that can be obtained commercially. Example 1

[0038] This embodiment proposes a method for preparing polysaccharides from Longshan lily, including the following steps: (1) Pretreatment: Remove the fibrous roots from the fresh bulbs of Longshan lily, wash them, freeze-dry them, pulverize them and pass them through a 50-80 mesh sieve to obtain lily powder; (2) Continuous extraction and purification: (2.1) Preparation of water-extracted polysaccharide LSWP: The lily powder obtained in step (1) was mixed with distilled water at a ratio of 1:20 and extracted at 76°C for 1.5 hours. The extraction was repeated 3 times. The extracts were combined and concentrated by rotary evaporation at 45°C. Four times the volume of 95% ethanol was added, and the mixture was allowed to stand for 24 hours to precipitate. The precipitate was collected by centrifugation. The precipitate was washed and dried with anhydrous ether or acetone, dissolved in a small amount of water, and the protein was removed 8 times by the Sevag method. Then, the mixture was dialyzed for 2 days and freeze-dried to obtain water-extracted polysaccharide LSWP. (2.2) Preparation of acid-extracted polysaccharide LSAP: The residue after water extraction in step (2.1) was mixed with a 1% citric acid solution with a pH of 2.0 at a material-to-liquid ratio of 1:20 and extracted at 76℃ for 1.5 hours. The extraction was repeated 3 times. The extracts were combined and concentrated by rotary evaporation at 45℃. Dialysis was performed for 2 days to remove small molecule salts. After freeze-drying, a small amount of water was added to dissolve the solution. Proteins were removed 8 times using the Sevag method. Dialysis was performed again for 2 days. After freeze-drying, acid-extracted polysaccharide LSAP was obtained. (2.3) Preparation of alkaline-extracted polysaccharide LSKP: The residue after acid extraction in step (2.2) was mixed with a 1% sodium hydroxide solution with a pH of 10.0 at a material-to-liquid ratio of 1:20 and extracted at 76°C for 1.5 hours. The extraction was repeated 3 times. The extracts were combined and concentrated by rotary evaporation at 45°C. The solution was dialyzed for 2 days to remove small molecule salts. After freeze-drying, a small amount of water was added to dissolve the solution. Proteins were removed 8 times using the Sevag method. The solution was dialyzed again for 2 days and then freeze-dried to obtain alkaline-extracted polysaccharide LSKP.

[0039] (3) Compounding: The refined LSWP, LSAP, and LSKP are mixed in a mass ratio of 1:1:1 to obtain the Longshan lily polysaccharide composition (i.e., Longshan lily polysaccharide composition LLT). Figure 1 ). Example 2

[0040] Example 1: Effect of the compounded polysaccharide on the viability of immune cells Using mouse macrophage Raw264.7 cells as the research object, to screen suitable polysaccharide concentrations, cells were treated with different concentrations (1-1000 μg / mL) of *Lilium lancifolium* polysaccharide LL, *Lilium lancifolium* polysaccharide LD, and the *Lilium lancifolium* polysaccharide composition from Example 1 of this invention, and their effects on cell viability were examined. It should be noted that *Lilium lancifolium* polysaccharide LL and *Lilium lancifolium* polysaccharide LD were prepared according to the method of Example 1.

[0041] Combination Figure 2-4 The results showed that all three lily polysaccharides significantly promoted the proliferation of immune cells within a concentration range of 1-1000 μg / mL. Compared with the control group: Longya lily polysaccharide increased cell vitality by 13% to 148.8%; Lanzhou lily polysaccharides increased cell vitality by 49% to 129%; The Longshan lily polysaccharide composition of Example 1 increased cell viability by 35.8% to 219%.

[0042] All three polysaccharides showed the most significant promoting effect on cell proliferation in the concentration range of 62.5-125 μg / mL. Subsequent experiments were conducted at concentrations of 1, 10, and 100 μg / mL.

[0043] Example 3: Evaluation of the anti-inflammatory effects of three lily polysaccharides

[0044] To evaluate the anti-inflammatory activity of the three lily polysaccharides, Raw264.7 cells were first treated with 1 μg / mL bacterial lipopolysaccharide (LPS) for 24 hours to establish an inflammatory cell model. Subsequently, based on the results of Example 2, LPS-induced inflammatory cells were treated with 1, 10, and 100 μg / mL of the three lily polysaccharides, respectively, and the TNF-α content in the supernatant was detected after 24 hours.

[0045] Combination Figure 5 The results showed that LPS could significantly induce macrophages to secrete large amounts of TNF-α ( ). p < 0.01). Intervention with the three lily polysaccharides could inhibit LPS-induced TNF-α production, and the inhibitory effect was concentration-dependent.

[0046] At a concentration of 1 μg / mL, Lanzhou lily polysaccharide and Longshan lily polysaccharide from Example 1 significantly inhibited TNF-α expression. p < 0.05), with inhibition rates of 19.3% and 44.3%, respectively; At a concentration of 10 μg / mL, the combination of Lanzhou lily polysaccharide and Longshan lily polysaccharide from Example 1 significantly inhibited TNF-α expression. p < 0.05), with inhibition rates of 45.4% and 45.1%, respectively; At a concentration of 100 μg / mL, all three polysaccharides showed significant inhibitory effects. p (< 0.05), the inhibition rates of TNF-α expression by Longya lily, Lanzhou lily and Longshan lily polysaccharide of Example 1 were 23.8%, 52.9% and 77.9%, respectively.

[0047] Example 4: Immunostimulating effects of three types of lily polysaccharides

[0048] Based on the results of Example 2, normal Raw264.7 cells were stimulated with three types of lily polysaccharides at concentrations of 1, 10, and 100 μg / mL. The TNF-α content was then measured 24 hours later to evaluate their immune-enhancing activity.

[0049] Combination Figure 6 At a concentration of 1 μg / mL, only Lanzhou lily polysaccharide significantly promoted cytokine secretion. p <0.05); At a concentration of 10 μg / mL, the combination of Lanzhou lily polysaccharide and Longshan lily polysaccharide from Example 1 significantly stimulated cytokine secretion. p < 0.05), representing increases of 348.4% and 368% respectively compared to the control group; At a concentration of 100 μg / mL, all three polysaccharides showed significant promoting effects. p < 0.05), the polysaccharides of Longya lily, Lanzhou lily, and Longshan lily polysaccharide from Example 1 increased cytokine expression by 139%, 405.8%, and 402.5%, respectively.

[0050] Example 5: Synergistic effect of Longshan lily polysaccharide composition compared with single polysaccharide in Example 1 on anti-inflammatory and immunomodulatory effects

[0051] This embodiment compares the anti-inflammatory and immunomodulatory activities of the Longshan lily polysaccharide composition of Example 1 with those of the single water-extracted polysaccharide LSWP, the single acid-extracted polysaccharide LSAP, and the single alkali-extracted polysaccharide LSKP prepared in Example 1, to verify the synergistic effect of the compound polysaccharides. All experiments used mouse macrophages (Raw264.7) as the research object, and the polysaccharide concentration was selected as 10 μg / mL (determined based on the optimal activity concentrations in Examples 2 and 3). (1) Synergistic effect of anti-inflammatory A LPS-induced inflammatory cell model was established according to the method in Example 2: Raw264.7 cells were treated with 1 μg / mL bacterial lipopolysaccharide (LPS) for 24 hours, and untreated cells were set as the blank control group (CK group).

[0052] LPS-induced inflammatory cells were treated with 10 μg / mL of Longshan lily polysaccharide composition, single water-extracted polysaccharide LSWP, single acid-extracted polysaccharide LSAP, and single alkali-extracted polysaccharide LSKP, respectively. After 24 hours, the changes in TNF-α gene expression in the cells were detected by real-time quantitative PCR (qPCR). The primer sequences used were: upstream primer (F): ATCCATCTCTTTGCGGAGGC, downstream primer (R): GGGGGAGAGGTAGGGATGTT.

[0053] Combination Figure 7 The results showed that LPS significantly induced the expression of TNF-α in macrophages, with the expression level being 1.83 times that of the CK group. p< 0.01); Compared with the LPS model group, single LSWP (downgraded to 1.68 times), single LSAP (downgraded to 1.58 times), and single LSKP (downgraded to 1.41 times) were significantly reduced. p < 0.05) and the Longshan lily polysaccharide composition LLT (downgraded to 0.98 times, p All polysaccharides <0.01% could inhibit LPS-induced abnormal expression of TNF-α. This indicates that the inhibitory effect of the LLT-containing polysaccharide composition of Longshan lily was significantly better than that of any single polysaccharide, making it the group with the best anti-inflammatory activity among all experimental groups.

[0054] (2) Synergistic effect of immune regulation Normal Raw264.7 cells were stimulated with 10 μg / mL of Longshan lily polysaccharide combination, single water-extracted polysaccharide LSWP, single acid-extracted polysaccharide LSAP, and single alkali-extracted polysaccharide LSKP, respectively. Normal cells without polysaccharide treatment were set as the control group. After 24 hours, the changes in TNF-α gene expression in the cells were detected by qPCR to evaluate the immune-enhancing activity of each polysaccharide group.

[0055] Combination Figure 8 The results showed that, compared with the control group, all polysaccharides could upregulate TNF-α expression to varying degrees, among which LSWP upregulated TNF-α expression by 1.62-fold. p < 0.01), TNF-α expression in LSAP was upregulated to 1.11-fold, and TNF-α expression in the single alkali-extracted polysaccharide LSKP was upregulated to 1.70-fold. p < 0.01), the TNF-α expression of the Longshan lily polysaccharide composition LLT was upregulated to 1.87-fold ( p < 0.01), significantly higher than each single polysaccharide group.

[0056] In summary, the polysaccharide composition of *Lilium lancifolium* proposed in this invention is significantly superior to single water-extracted, acid-extracted, and alkali-extracted polysaccharides in terms of anti-inflammatory and immunomodulatory activities, demonstrating a clear synergistic effect of the components. This proves that the technical solution of combining three single polysaccharides in this invention can significantly improve the bioactivity of *Lilium lancifolium* polysaccharides, and is not a simple superposition of single extraction processes, thus possessing significant technical advantages.

[0057] The polysaccharide composition of *Lilium lancifolium* obtained in this invention can significantly promote the proliferation of immune cells and the secretion of cytokines. Under the same conditions, its immunomodulatory activity is superior to that of polysaccharides extracted from *Lilium longiflorum* and *Lilium lancifolium*. The preparation method of this invention is efficient and environmentally friendly, providing a new technological approach for the high-value development of *Lilium lancifolium* resources. The resulting product has broad application prospects in functional foods, health products, and pharmaceuticals.

[0058] Other beneficial effects: 1) Full utilization of resources and high yield: By establishing a continuous extraction process of water extraction-acid extraction-alkali extraction, the simultaneous extraction of water-soluble, acid-soluble and alkali-soluble polysaccharides from the bulbs of Longshan lily was realized for the first time. This maximized the utilization of raw materials, significantly improved the total yield of polysaccharides, and avoided resource waste.

[0059] 2) Significant immunomodulatory activity: The polysaccharide of Longshan lily prepared by this method has been confirmed by in vitro immunomodulatory activity evaluation to effectively promote the proliferation of immune cells and the secretion of key cytokines. Moreover, its immunomodulatory activity is superior to that of polysaccharides extracted from common varieties such as Longya lily and Lanzhou lily, which reflects the unique value of Longshan lily as a local resource.

[0060] 3) Green and efficient process: The method of this invention has mild conditions, is easy to operate, does not use toxic or harmful reagents, and is suitable for large-scale production, providing a reliable technical path for the high-value development and industrial application of Longshan lily.

[0061] 4) Broad application prospects: The obtained Longshan lily polysaccharide has high purity and clear activity. It can be used as a core functional factor and widely applied in the development of functional foods, health products and drugs that enhance immunity and assist in anti-inflammation. The market potential is huge.

[0062] The specific embodiments of the present invention described above do not constitute a limitation on the scope of protection of the present invention. Any other corresponding changes and modifications made in accordance with the technical concept of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A lily polysaccharide composition, characterized in that, This includes water-extracted polysaccharides, acid-extracted polysaccharides, and alkali-extracted polysaccharides extracted from lilies.

2. The lily polysaccharide composition according to claim 1, wherein the mass ratio of the water-extracted polysaccharide, the acid-extracted polysaccharide, and the alkali-extracted polysaccharide is (0.5-2):(0.5-2):(0.5-2).

3. The lily polysaccharide composition according to claim 2, wherein the mass ratio of the water-extracted polysaccharide, the acid-extracted polysaccharide, and the alkali-extracted polysaccharide is 1:1:

1.

4. A method for preparing the lily polysaccharide composition according to any one of claims 1-3, characterized in that, Includes the following steps: S1. Preparation of water-extracted polysaccharide LSWP: Lily powder was mixed with water and extracted at 75-80℃. The extraction was repeated 2-3 times. The extracts were combined, concentrated, and then ethanol was added. The mixture was allowed to stand and precipitate. The precipitate was collected by centrifugation, washed and dried, and then dissolved in water. Proteins were removed by the Sevag method, and then the mixture was dialyzed and dried to obtain water-extracted polysaccharide LSWP. S2. Preparation of acid-extracted polysaccharide LSAP: The residue after water extraction in step S1 is mixed with citric acid solution and extracted at 75-80℃. The extraction is repeated 2-3 times. The extracts are combined, concentrated, dialyzed to remove small molecule salts, dried, dissolved in water, and proteins are removed 6-10 times using the Sevag method. After dialyzing and drying again, acid-extracted polysaccharide LSAP is obtained. S3. Preparation of alkaline-extracted polysaccharide LSKP: The residue after acid extraction in step S2 is mixed with sodium hydroxide solution and extracted at 75-80℃. The extraction is repeated 2-3 times. The extracts are combined, concentrated, dialyzed to remove small molecule salts, dried, dissolved in water, and proteins are removed 6-10 times using the Sevag method. The mixture is then dialyzed and dried again to obtain alkaline-extracted polysaccharide LSKP. S4. The water-extracted polysaccharide LSWP, the acid-extracted polysaccharide LSAP, and the alkali-extracted polysaccharide LSKP are mixed to obtain the lily polysaccharide composition.

5. The method for preparing the lily polysaccharide composition according to claim 4, characterized in that, In step S1, the lily powder is mixed with water at a material-to-liquid ratio of 1:(20-25); and / or, in step S2, the residue after water extraction in step S1 is mixed with citric acid solution at a material-to-liquid ratio of 1:(20-25); and / or, in step S3, the residue after acid extraction in step S2 is mixed with sodium hydroxide solution at a material-to-liquid ratio of 1:(20-25).

6. The method for preparing the lily polysaccharide composition according to claim 4, characterized in that, In step S1, the extraction is carried out at 75-80°C for 1-1.5 hours; and / or, in step S2, the extraction is carried out at 75-80°C for 1-1.5 hours; and / or, in step S3, the extraction is carried out at 75-80°C for 1-1.5 hours.

7. The method for preparing the lily polysaccharide composition according to claim 4, characterized in that, In step S1, the lily powder is obtained by removing the fibrous roots, washing, freeze-drying, pulverizing, and passing the powder through a 50-80 mesh sieve from fresh Longshan lily bulbs.

8. The method for preparing the lily polysaccharide composition according to claim 4, characterized in that, In step S2 or S3, the small molecule salts are removed by dialysis for 2-3 days.

9. The use of a polysaccharide composition according to any one of claims 1-3 or a polysaccharide composition prepared by any one of claims 4-8 in the preparation of immunomodulatory drugs, functional foods or health products and / or in the preparation of anti-inflammatory drugs, functional foods or health products.

10. The application according to claim 9, characterized in that, The immunomodulatory drugs, functional foods, or health products are characterized by promoting the proliferation of immune cells and / or promoting the secretion of cytokines; the anti-inflammatory drugs, functional foods, or health products are characterized by inhibiting the excessive inflammatory response of macrophages induced by bacterial lipopolysaccharide and the secretion of inflammatory factors.

Images