Bacteria or medicaments and uses thereof

Abstract

This invention provides the use of bacteria or their drugs in the preparation of remedies for treating, preventing, or improving diseases, and provides clear in vivo evidence of tumor suppression, confirming that bacteria such as *Isobacterium fecalithoniella* inhibit tumor growth in at least two subcutaneous solid tumor models. This invention also reveals a significant sensitization advantage when combined with immunotherapy, with even stronger inhibition when combined with anti-PD-1, indicating high potential for industrialization.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to bacteria or their pharmaceutical uses. Background Technology

[0002] While immune checkpoint inhibitors (such as PD-1 / PD-L1 antibodies) have shown breakthrough efficacy in cancer treatment, their objective response rate as monotherapy is generally below 40%, especially in solid tumors such as colorectal cancer, where severe primary and secondary resistance issues exist. Although combination chemotherapy and other strategies can improve efficacy to some extent, they are often accompanied by increased toxicity, and there is an urgent clinical need to develop highly effective and low-toxicity sensitization regimens.

[0003] In recent years, utilizing gut microbiota to modulate the efficacy of immunotherapy has been considered an important direction, and studies have shown that certain probiotics (such as Lactobacillus rhamnosus and Bifidobacterium) have certain immunomodulatory potential. However, existing technologies have significant shortcomings: First, the mechanisms of action of these probiotics are not clearly understood, mostly focusing on enhancing innate immunity or regulating intestinal barrier functions, lacking evidence of specific activation of CD8+ T cells; second, most existing studies remain at the preclinical animal model stage, lacking direct verification of the microbiota-immunity correlation in patients, leading to doubts about their clinical translational value; finally, the synergistic effect of current probiotics combined with PD-1 antibodies is not ideal, making it difficult to effectively address the problem of immunotherapy resistance. Summary of the Invention

[0004] In order to solve one of the above-mentioned technical problems in the prior art, embodiments of the present invention provide the use of bacteria or their drugs in the preparation of medicaments for treating and / or preventing diseases.

[0005] In one aspect, in some embodiments, bacteria are used in the preparation of medicaments for treating, preventing, or improving diseases.

[0006] In some embodiments, the bacteria include rod-shaped bacteria.

[0007] In some embodiments, the bacteria include Firmicutes.

[0008] In some embodiments, the bacteria include Clostridium.

[0009] In some embodiments, the bacteria include Clostridium orders.

[0010] In some embodiments, the bacteria include those belonging to the Erysipelothrix family.

[0011] In some embodiments, the bacteria include the genus *Isobacterium fecalith*.

[0012] In some embodiments, the bacteria include Allobaculum stercoricanis.

[0013] In some embodiments, the disease includes a tumor.

[0014] In some embodiments, the tumor includes at least one of solid tumors and non-solid tumors.

[0015] In some embodiments, the tumor includes, but is not limited to, at least one of the following: colorectal cancer, melanoma, malignant tumor, glioma, mesothelioma, lymphoma, leukemia, adenocarcinoma, breast cancer, ovarian cancer, cervical cancer, glioblastoma, prostate cancer, Burkitt lymphoma, head and neck cancer, colon cancer, non-small cell lung cancer, small cell lung cancer, esophageal cancer, gastric cancer, pancreatic cancer, hepatobiliary cancer, gallbladder cancer, small bowel cancer, rectal cancer, kidney cancer, bladder cancer, prostate cancer, penile cancer, urethral cancer, testicular cancer, vaginal cancer, uterine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, pancreatic endocrine carcinoma, carcinoid tumor, bone cancer, skin cancer, retinoblastoma, Hodgkin lymphoma, non-Hodgkin lymphoma, Kaposi's sarcoma, multicentric Kastelman's disease, AIDS-related primary exudative lymphoma, neuroectodermal tumor, rhabdomyosarcoma, and osteosarcoma.

[0016] In some embodiments, the non-solid tumor includes tumors originating from the blood, lymphatic system, or bone marrow.

[0017] In some embodiments, the non-solid tumor includes at least one of lymphoma, leukemia, and multiple myeloma.

[0018] In some embodiments, the bacteria are used to inhibit tumor growth.

[0019] In some embodiments, the bacteria are used to reduce tumor burden.

[0020] In some embodiments, the bacteria are used to improve response rates and / or survival benefits in cancer patients.

[0021] In some embodiments, the drug may further include a therapeutic agent.

[0022] In some embodiments, the bacteria and the therapeutic agent are administered as a combination or separately.

[0023] In some embodiments, the therapeutic agent includes an anticancer agent.

[0024] In some embodiments, the therapeutic agent includes at least one of an immunotherapy agent, a chemotherapy agent, and a targeted therapy agent.

[0025] In some embodiments, the immunotherapeutic agent includes an immune checkpoint inhibitor.

[0026] In some embodiments, the form of the drug includes, but is not limited to, at least one of live bacteria, inactivated bacteria, bacterial components, fermentation supernatant, metabolites, crude extracts, lyophilized powder, capsules, and granules.

[0027] Secondly, in some embodiments, a composition is provided comprising bacteria and a therapeutic agent.

[0028] In some embodiments, the bacteria include rod-shaped bacteria.

[0029] In some embodiments, the bacteria include Firmicutes.

[0030] In some embodiments, the bacteria include Clostridium.

[0031] In some embodiments, the bacteria include Clostridium orders.

[0032] In some embodiments, the bacteria include those belonging to the Erysipelothrix family.

[0033] In some embodiments, the bacteria include the genus *Isobacterium fecalith*.

[0034] In some embodiments, the bacteria include Allobaculum stercoricanis.

[0035] In some embodiments, the therapeutic agent includes an anticancer agent.

[0036] In some embodiments, the therapeutic agent includes at least one of an immunotherapy agent, a chemotherapy agent, and a targeted therapy agent.

[0037] In some embodiments, the immunotherapeutic agent includes an immune checkpoint inhibitor.

[0038] In some embodiments, the immune checkpoint inhibitor includes at least one of PD-1 inhibitors, PD-L-1 inhibitors, and CTLA-4 inhibitors.

[0039] In some embodiments, the immune checkpoint inhibitor includes at least one of an anti-PD-1 antibody or a variant or functional fragment thereof, an anti-PD-L-1 antibody or a variant or functional fragment thereof, and an anti-CTLA-4 antibody or a variant or functional fragment thereof.

[0040] In some embodiments, the chemotherapeutic agent includes, but is not limited to, at least one of angiogenesis inhibitors, microtubule assembly inhibitors, DNA cross-linking agents, local isomerase inhibitors, DNA intercalating agents, DNA synthesis inhibitors, tyrosine kinase inhibitors, and mitosis inhibitors.

[0041] In some embodiments, the chemotherapeutic agent includes, but is not limited to, at least one of alkylating agents, metabolic antagonists, DNA demethylating agents, substituted nucleotides, substituted nucleosides, antitumor antibiotics, plant-derived antitumor agents, or nitrosoureas.

[0042] In some embodiments, the chemotherapeutic agents include, but are not limited to, cisplatin, carboplatin, pemetrexed, vinorelbine, gemcitabine, taxanes (including, for example, paclitaxel, docetaxel, or nab-paclitaxel), etoposide, methotrexate (MTX), trimethobenzoic acid ester (TMTX), temozolomide, dacarbazine (DTIC), and rabesilate. Titraxetine, S-(4-nitrobenzyl)-6-thioinosine (NBMPR), 6-benzylguanidine (6-BG), rabinopyranosyl-N-methyl-N-nitrosourea (Aranose), carmustine (BCNU, BiCNU), chloramphenicol, ethylnitrosourea (ENU), fortimustine, lomustine (CCNU), nimustine, N-nitroso-N-methylurea (NMU), ramustine (MCNU), semustine, streptozotocin (streptozotocin), cytarabine, camptothecin, or at least one of the therapeutic derivatives thereof.

[0043] In some embodiments, the targeted therapeutic agents include, but are not limited to, topotecan, irinotecan, bevacizumab, erlotinib, lapatinib, cetuximab, erlotinib, gefitinib, lapatinib, pazopanib, trastuzumab, fulvestrant, tamoxifen, letrozole, anastrozole, exemestane, everolimus, and abiraterone. terone), bicalutamide, bortezomib, vemurafenib, ipilimumab, pertuzumab, MEDI4276, ONT-380, neratinib, afatinib, duligotuzumab, dacomitinib, sapitinib, poziotinib, ASLAN001, MM-111, MM-121, MM-141, LJM716, U3-1287 (AMG)888), TK-A3 / TK-A4, Lumretuzumab, REGN1400, AV-203, AZD5363, Afuresertib, MK-2206, Ipatasertib, Ridaforolimus, Temsirolimus, Selemetinib, Cobimetinib, GDC-0994, Taselisib, Alpelisib, Buparlisib, AZD8186, AZD8835, Panitumumab, REGN955, MM-151, Osimertinib, Roxitinib etinib), AZD5363, SGX-523, Onartuzumab, Cabozantinib, Volitinib, Tivantinib, Capmatinib, Emibetuzumab, Rilotumumab, Ficlatuzumab, SAR125844, Emibetuzumab, Sym015, AMG337, JNJ-61186372, glesatinib, 1202, LY3023414, Gedatolisib, JI-101, Ponatinib, SunitinibCrizotinib, Ceritinib, Brigatinib, Alectinib, BGJ398, Linsitinib, Quizartinib, R428 (BGB324), Gilteritinib, Vismodegib, Itraconazole, 5E1, LGK974, Semagacestat, Cobimetinib AZD4547, JNJ-42756493, Dalotuzumab, MEDI-573, Ganitumab, Sonidegib, Vantictumab, Ipafricept, Tarextumab, Brontictuzumab, SB431542, EW-7197, RepSox, AZD9291, Rociletinib, Abraxane, Brentutumab-Vidoxine vedoton, ofatumumab, bevacizumab, alemtuzumab, bicalutamide, gemcitabine, imatinib, ixabepilone, romidepsin, cabrazazitaxel, sorafenib, infliximab, lenalidomide, rituximab rituximab, dasatinib, nilotinib, temozolomide, bortezomib, azacitidine, tepotinib, lorlatinib, merestinib, RG6114, tucantinib, pazopanib, crizotinib, vemurafenib, goserelin acetateAcetate), abiraterone, BH3 mimics, navitoclax, anastrozole, letrozole, aromatase inhibitors, ixabepilone, aflibercept, temsirolimus, irbritumomab, abiraterone, custirsen, enzalutamide, nivolumab, palbociclib, regorafenib, entinostat, ARN-509, ARN -810, BIND-014, dabrafenib, daratumumab, lambrolizumab, LDK378, sym004, trastuzumab-mettansine, tivozanib, trametinib, axitinib, LY2835219, MPDL320A, obinutuzumab, Sym004, tositumomab, trametinib, necitumumab, ramucirumab.

[0044] Thirdly, a medicament is provided, comprising bacteria or a composition as described in the second aspect.

[0045] In some embodiments, the bacteria include rod-shaped bacteria.

[0046] In some embodiments, the bacteria include Firmicutes.

[0047] In some embodiments, the bacteria include Clostridium.

[0048] In some embodiments, the bacteria include Clostridium orders.

[0049] In some embodiments, the bacteria include those belonging to the Erysipelothrix family.

[0050] In some embodiments, the bacteria include the genus *Isobacterium fecalith*.

[0051] In some embodiments, the bacteria include Allobaculum stercoricanis.

[0052] Fourthly, in some embodiments, the use of the composition described in the second aspect in the preparation of a medicament for treating, preventing, or improving a disease is provided.

[0053] In some embodiments, the disease includes a tumor.

[0054] In some embodiments, the tumor includes at least one of solid tumors and non-solid tumors.

[0055] In some embodiments, the tumor includes at least one of colorectal cancer, melanoma, malignant tumor, glioma, mesothelioma, lymphoma, leukemia, adenocarcinoma, breast cancer, ovarian cancer, cervical cancer, glioblastoma, prostate cancer, Burkitt lymphoma, head and neck cancer, colon cancer, non-small cell lung cancer, small cell lung cancer, esophageal cancer, gastric cancer, pancreatic cancer, hepatobiliary cancer, gallbladder cancer, small bowel cancer, rectal cancer, kidney cancer, bladder cancer, prostate cancer, penile cancer, urethral cancer, testicular cancer, vaginal cancer, uterine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, pancreatic endocrine carcinoma, carcinoid tumor, bone cancer, skin cancer, retinoblastoma, Hodgkin lymphoma, non-Hodgkin lymphoma, Kaposi's sarcoma, multicentric Kastelman's disease, AIDS-related primary exudative lymphoma, neuroectodermal tumor, rhabdomyosarcoma, and osteosarcoma.

[0056] In some embodiments, the non-solid tumor includes tumors originating from the blood, lymphatic system, or bone marrow.

[0057] In some embodiments, the non-solid tumor includes at least one of lymphoma, leukemia, and multiple myeloma.

[0058] In some embodiments, the composition is used to inhibit tumor growth.

[0059] In some embodiments, the composition is used to reduce tumor burden.

[0060] In some embodiments, the composition is used to improve response rates and / or survival benefits in cancer patients.

[0061] Fifthly, in some embodiments, a method for treating and / or preventing disease is provided, comprising administering to a patient an effective amount of bacteria, or administering an effective amount of a composition containing said bacteria, or administering an effective amount of bacteria and an effective amount of a therapeutic agent, respectively.

[0062] In some embodiments, the bacteria include rod-shaped bacteria.

[0063] In some embodiments, the bacteria include Firmicutes.

[0064] In some embodiments, the bacteria include Clostridium.

[0065] In some embodiments, the bacteria include Clostridium orders.

[0066] In some embodiments, the bacteria include those belonging to the Erysipelothrix family.

[0067] In some embodiments, the bacteria include the genus *Isobacterium fecalith*.

[0068] In some embodiments, the bacteria include Allobaculum stercoricanis.

[0069] In some embodiments, the composition includes bacteria and a therapeutic agent.

[0070] In some embodiments, the therapeutic agent includes an anticancer agent.

[0071] In some embodiments, the therapeutic agent includes at least one of immunotherapeutic agents, chemotherapeutic agents, targeted therapeutic agents, vaccines, and immune cells.

[0072] In some embodiments, the immunotherapeutic agent includes an immune checkpoint inhibitor.

[0073] In some embodiments, the immune checkpoint inhibitor includes at least one of PD-1 inhibitors, PD-L-1 inhibitors, and CTLA-4 inhibitors.

[0074] In some embodiments, the immune checkpoint inhibitor includes at least one of an anti-PD-1 antibody or a variant or functional fragment thereof, an anti-PD-L-1 antibody or a variant or functional fragment thereof, and an anti-CTLA-4 antibody or a variant or functional fragment thereof.

[0075] In some embodiments, the chemotherapeutic agent includes at least one of angiogenesis inhibitors, microtubule assembly inhibitors, DNA cross-linking agents, local isomerase inhibitors, DNA intercalating agents, DNA synthesis inhibitors, tyrosine kinase inhibitors, and mitosis inhibitors.

[0076] In some embodiments, the chemotherapeutic agent includes at least one of alkylating agents, metabolic antagonists, DNA demethylating agents, substituted nucleotides, substituted nucleosides, antitumor antibiotics, plant-derived antitumor agents, or nitrosoureas.

[0077] In some embodiments, the chemotherapeutic agents include cisplatin, carboplatin, pemetrexed, vinorelbine, gemcitabine, taxanes (including, for example, paclitaxel, docetaxel, or nab-paclitaxel), etoposide, methotrexate (MTX), trimethobenzoic acid ester (TMTX), temozolomide, dacarbazine (DTIC), and raltitrexate. The following are listed: thiamethoxam, S-(4-nitrobenzyl)-6-thioinosine (NBMPR), 6-benzylguanidine (6-BG), rabinopyranosyl-N-methyl-N-nitrosourea (Aranose), carmustine (BCNU, BiCNU), chloramphenicol, ethylnitrosourea (ENU), fortimustine, lomustine (CCNU), nimustine, N-nitroso-N-methylurea (NMU), ramustine (MCNU), semustine, streptozotocin (streptozotocin), cytarabine, camptothecin, or at least one of the therapeutic derivatives thereof.

[0078] In some embodiments, the targeted therapeutic agents include topotecan, irinotecan, bevacizumab, erlotinib, lapatinib, cetuximab, erlotinib, gefitinib, lapatinib, pazopanib, trastuzumab, fulvestrant, tamoxifen, letrozole, anastrozole, exemestane, everolimus, and abiraterone. rone), bicalutamide, bortezomib, vemurafenib, ipilimumab, pertuzumab), MEDI4276, ONT-380, neratinib, afatinib, duligotuzumab, dacomitinib, sapitinib, poziotinib, ASLAN001, MM-111, MM-121, MM-141, LJM716, U3-1287 (AMG) 888), TK-A3 / TK-A4, Lumretuzumab, REGN1400, AV-203, AZD5363, Afuresertib, MK-2206, Ipatasertib, Ridaforolimus, Temsirolimus, Selemetinib, Cobimetinib, GDC-0994, Taselisib, Alpelisib, Buparlisib, AZD8186, AZD8835, Panitumumab, REGN955, MM-151 Osimertinib, Rociletinib, AZD5363, SGX-523, Onartuzumab, Cabozantinib, Volitinib, Tivantinib, Capmatinib, Emibetuzumab, Rilotumumab, Ficlatuzumab, SAR125844, Sym015, AMG337, JNJ-61186372, glesatinib1202, LY3023414, Gedatolisib, JI-101, Ponatinib, Sunitinib, Crizotinib, Ceritinib, Brigatinib, Alectinib, BGJ398, Linsitinib, Quizartinib, R428 (BGB324), Gilteritinib, Vismodegib, Itraconazole, 5E1, LGK974, Semagacestat, Cobimetinib AZD4547, JNJ-42756493, Dalotuzumab, MEDI-573, Ganitumab, Sonidegib, Vantictumab, Ipafricept, Tarextumab, Brontictuzumab, SB431542, EW-7197, RepSox, AZD9291, Rociletinib, Abraxane, Brentutumab-Vidoxine vedoton, ofatumumab, bevacizumab, alemtuzumab, bicalutamide, gemcitabine, imatinib, ixabepilone, romidepsin, cabrazaxetel, sorafenib, infliximab, lenalidomide, rituximab imab), dasatinib, nilotinib, temozolomide, bortezomib, azacitidine, tepotinib, lorlatinib, meretinib, RG6114, tucantinib, pazopanib, crizotinib, vemurafenib, goserelinacetateAbiraterone, BH3 mimics, navitoclax, anastrozole, letrozole, aromatase inhibitors, ixabepilone, aflibercept, temsirolimus, irbritumomab, abiraterone, custirsen, enzalutamide, nivolumab, palbociclib, regorafenib, entinostat, ARN-509, ARN-810 At least one of the following: BIND-014, dabrafenib, daratumumab, lambrolizumab, LDK378, sym004, trastuzumab-metatansine, tivozanib, trametinib, axitinib, LY2835219, MPDL320A, obinutuzumab, Sym004, tositumomab, trametinib, necitumumab, and ramucirumab.

[0079] In some embodiments, the disease includes a tumor.

[0080] In some embodiments, the tumor includes at least one of solid tumors and non-solid tumors.

[0081] In some embodiments, the tumor includes at least one of colorectal cancer, melanoma, malignant tumor, glioma, mesothelioma, lymphoma, leukemia, adenocarcinoma, breast cancer, ovarian cancer, cervical cancer, glioblastoma, prostate cancer, Burkitt lymphoma, head and neck cancer, colon cancer, non-small cell lung cancer, small cell lung cancer, esophageal cancer, gastric cancer, pancreatic cancer, hepatobiliary cancer, gallbladder cancer, small bowel cancer, rectal cancer, kidney cancer, bladder cancer, prostate cancer, penile cancer, urethral cancer, testicular cancer, vaginal cancer, uterine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, pancreatic endocrine carcinoma, carcinoid tumor, bone cancer, skin cancer, retinoblastoma, Hodgkin lymphoma, non-Hodgkin lymphoma, Kaposi's sarcoma, multicentric Kastelman's disease, AIDS-related primary exudative lymphoma, neuroectodermal tumor, rhabdomyosarcoma, and osteosarcoma.

[0082] In some embodiments, the non-solid tumor includes tumors originating from the blood, lymphatic system, or bone marrow.

[0083] In some embodiments, the non-solid tumor includes at least one of lymphoma, leukemia, and multiple myeloma.

[0084] In some embodiments, the method further includes use in combination with other treatment methods.

[0085] In some embodiments, the other methods include at least one of immune checkpoint inhibitor therapy, cancer vaccine therapy, adoptive cell therapy, chemotherapy, and radiotherapy.

[0086] Sixthly, in some embodiments, an assessment method is provided, comprising: assessing the therapeutic effect of a drug or the risk of disease based on bacterial detection results in a subject's sample.

[0087] In some embodiments, the detection results include the relative abundance of bacteria.

[0088] In some embodiments, the bacteria include rod-shaped bacteria.

[0089] In some embodiments, the bacteria include Firmicutes.

[0090] In some embodiments, the bacteria include Clostridium.

[0091] In some embodiments, the bacteria include Clostridium orders.

[0092] In some embodiments, the bacteria include those belonging to the Erysipelothrix family.

[0093] In some embodiments, the bacteria include the genus *Isobacterium fecalith*.

[0094] In some embodiments, the bacteria include Allobaculum stercoricanis.

[0095] In some embodiments, the assessment includes evaluating the subject’s potential for treatment response.

[0096] In some embodiments, the treatment includes immunotherapy.

[0097] In some embodiments, the subjects include cancer patients.

[0098] In some embodiments, the tumor includes at least one of solid tumors and non-solid tumors.

[0099] In some embodiments, compared with the prior art, the present invention provides clear in vivo evidence of tumor suppression, and the provided bacteria have a significant inhibitory effect on tumor growth. Attached Figure Description

[0100] Figure 1 The abundance of Allobaculum stercoricanis in stool samples from colorectal cancer patients, and its correlation with tumor-invasive interferon-gamma-producing CD8+. + Results of correlation analysis of T cell percentage (sample size n=20).

[0101] Figure 2 Tumor growth in MC38 colon cancer mice (sample size n=10).

[0102] Figure 3 right Figure 2 Flow cytometry analysis results of mice with MC38 tumors from the Netherlands and China.

[0103] Figure 4 Tumor growth in B16-F10 melanoma mice after gavage with Ibacillus fecalis, injection of anti-PD-1 antibody (α-PD-1) or control antibody (IgG) (sample size n=10). Detailed Implementation

[0104] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention in any way. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concepts of this disclosure. Such structures and techniques have also been described in many publications.

[0105] definition

[0106] In this article, "solid tumor" refers to a tumor that can be detected as a tangible mass through X-ray, CT scan, ultrasound, or palpation. It is distinguished from non-solid tumors such as leukemia and is divided into malignant and benign types. Malignant solid tumors include, but are not limited to, subtypes such as Hodgkin's lymphoma, neuroblastoma, and nephroblastoma, while benign tumors encompass types such as lymphangioma and hemangioma.

[0107] In this article, "non-solid tumors" refer to tumors originating from non-solid tissues such as blood, lymphatic system, or bone marrow. Unlike solid tumors (such as lung cancer and breast cancer), their cells are usually dispersed throughout the body, making it difficult to directly observe the mass through imaging. These mainly include types such as leukemia, lymphoma, and multiple myeloma, which require blood, bone marrow, or tissue biopsies for diagnosis.

[0108] Example

[0109] Unless otherwise stated, the present invention will be carried out using conventional techniques of cell biology, cell culture, molecular biology, and laboratory animal science, techniques described in the literature or performed in accordance with product instructions. For example, see J. Sambrook's *Molecular Cloning: A Laboratory Manual* (4th edition, Science Press). Unless otherwise specified, the materials, reagents, or instruments used in the examples are all commercially available conventional products, and other equivalents may be used.

[0110] The function of *Allobaculum stercoricanis*, a gut commensal bacterium, in tumor immune regulation remains completely unknown, and related research is currently lacking. However, the embodiments of this application are based on a key clinical finding: in a cohort of colorectal cancer patients, the relative abundance of *Allobaculum stercoricanis* in fecal samples showed a significant positive correlation with the level of IFN-γ produced by tumor-infiltrating CD8+ T cells. This finding not only fills the gap in functional research on this strain but also provides a novel approach to addressing the aforementioned technical deficiencies.

[0111] Based on this, the purpose of this application is to overcome the shortcomings of the prior art, specifically including: (1) providing a novel microbial preparation with a clear mechanism that can specifically activate CD8+ T cells; (2) establishing an immunotherapy sensitization regimen based on Ischemicum fecalis to effectively improve the efficacy of PD-1 antibody; (3) developing a microbial immune adjuvant supported by clinically relevant evidence to provide a new solution to the problem of immunotherapy resistance.

[0112] This application's embodiments reveal for the first time that the relative abundance of *Allobaculum stercoricanis* in the gut of clinical colorectal cancer patients is significantly positively correlated with the activity status of CD8+ T cells in the tumor microenvironment (marked by IFN-γ expression). This crucial clinical finding directly suggests the potential of this strain to activate anti-tumor immunity in humans. Based on this, the core concept of this invention is to develop *Allobaculum stercoricanis* or its culture and active ingredients into a microbial preparation capable of specifically activating CD8+ T cells, used alone or in combination with immune checkpoint inhibitors (such as PD-1 / PD-L1 antibodies) for the prevention and / or treatment of tumors, thereby addressing the problem of low response rates in existing immunotherapies.

[0113] The embodiments of this application demonstrate the anti-tumor application potential of Ibacillus faecalis through the following experimental data:

[0114] Clinical relevance findings: We collected tumor tissue and stool samples from colorectal cancer patients. The content of *Allobaculum stercoricanis* in the stool samples was detected by qPCR, and the level of IFN-γ production in tumor-infiltrating CD8+ T cells was detected by flow cytometry. Analysis showed a significant positive correlation between the relative abundance of *Allobaculum stercoricanis* in patients and the IFN-γ expression level of CD8+ T cells within the tumor. This data strongly demonstrates that the colonization level of *Allobaculum stercoricanis* in the human body is closely related to the intensity of local anti-tumor immunity, providing direct clinical evidence for its role as an immunomodulator.

[0115] Preclinical Functional Validation: Based on the above clinical findings, we conducted functional validation in a mouse MC38 colorectal cancer model. Tumor-bearing mice were administered live *Isobacterium faecalis* solution (1 × 10^9 CFU / mouse) daily by gavage, with a PBS control group provided. After the tumors reached their growth endpoint, the mice were sacrificed to analyze the tumor immune microenvironment. Flow cytometry results showed that, compared with the control group, the expression levels of IFN-γ and Ki67 infiltrating CD8+ T cells in the tumor tissue of mice in the *Isobacterium faecalis* gavage group were significantly upregulated. This indicates that supplementation with *Isobacterium faecalis* can effectively promote the activation and proliferation of CD8+ T cells.

[0116] Synergistic Effect Validation: To explore its potential for combination with existing immunotherapies, we established four experimental groups: a PBS control group, a PD-1 antibody monotherapy group (dose of 100 μg), a *Isobacterium fecalithii* monotherapy group, and a *Isobacterium fecalithii* and PD-1 antibody combination group. After treatment, the combination therapy group showed the strongest tumor growth inhibition effect, with tumor volume and weight significantly lower than any single-drug therapy group.

[0117] 1. Strain-related information

[0118] (1) Strain name: Allobaculum stercoricanis

[0119] ① Strain source: Purchased from BNCC (Beina Biotechnology) ② Preservation information: The type strain is DSM 13633 (CCUG45212), which is not deposited in ATCC; Genomic data: The 16S rRNA gene sequence (GenBank accession number: AJ417075) and genome are available from public databases.

[0120] (2) Culture conditions of the strain

[0121] ① Culture medium formulation: Modified minced meat carbohydrate broth basal medium (CMC medium) (with added heme chloride and vitamin K1); ② Culture parameters: 37℃, anaerobic.

[0122] 2. Dosing regimen

[0123] (1) Single drug administration (Isobacterium fecalith)

[0124] Administration method: Gavage (oral)

[0125] ① Dosage: Specific concentration (1×10^9 CFU / mouse); ② Dosage frequency: Once every 2 days; ③ Dosage cycle: Dosing until the tumor endpoint; ④ Dosage initiation time: Mice were given antibiotics 7 days before tumor injection, and 7 days after tumor injection, mice were gavaged with fecal isobacillus until the maximum tumor area in the group reached 225 mm. 2 .

[0126] (2) Combined administration (Ibacillus fecalis + PD-1 antibody)

[0127] ① PD-1 antibody administration regimen: dosage (100 μg), route of administration (in this example, intraperitoneal injection), frequency of administration (in this example, once every 2 days), and sequence of administration (starting after gavage administration of Ibacillus faecalis; in this example, the strain is given for 2 days before PD-1 antibody is added).

[0128] 3. Experimental Model and Detection Method

[0129] (1) Tumor model

[0130] ① Experimental animals: mouse strain (C57BL / 6), age (e.g., 6-8 weeks), male; ② Tumor cell line: type of tumor cells inoculated (melanoma B16F10, colorectal cancer MC38); ③ Modeling method: subcutaneous inoculation.

[0131] (2) Clinical sample testing

[0132] Study subjects: 20 patients with pathologically confirmed colorectal cancer (CRC) (fresh tumor tissue + stool sample after surgery). Detection indicators:

[0133] ① Relative abundance of fecal isobacteria: qPCR technology was used.

[0134] The primer sequences are shown in the table below:

[0135] Table 1

[0136] F GGGACACTCTGGACGAGGAT (SEQ ID NO: 1) R TCCGTTGGACAGCTCGGATA (SEQ ID NO: 2)

[0137] Quantitative detection.

[0138] ② IFN-γ level of CD8+ T cells in tumor tissue: The ratio of IFN-γ+ / CD8+ cells in tumor-infiltrating lymphocytes was detected by flow cytometry.

[0139] Analysis method: Pearson correlation analysis was used to assess the association between the abundance of Ischemic fecal bacteria and the IFN-γ+ / CD8+ ratio.

[0140] (3) Detection indicators and methods

[0141] Tumor growth monitoring: The long and short diameters of the tumor are measured every 2 days, the tumor area is calculated (formula: area = length × width), and growth curves of different tumor models are plotted.

[0142] Immune cell activation detection: Flow cytometry was used to detect activation markers of CD8+ T cells in mouse spleen / tumor tissues—Ki-67 (proliferation index) and IFN-γ (cytokine), and the proportions of Ki-67+ / CD8+ cells and IFN-γ+ / CD8+ cells were statistically analyzed.

[0143] Figure 1 The results of a correlation analysis (sample size n=20) between the abundance of Allobaculum stercoricanis in fecal samples from colorectal cancer patients and the proportion of tumor-infiltrating interferon-γ producing CD8⁺ T cells.

[0144] Figure 2 In this study, C57BL / 6 wild-type (WT) mice were treated daily by gavage with antibiotics (ABX: neomycin (1 g / L), ampicillin (1 g / L), metronidazole (1 g / L), and vancomycin (0.5 g / L). On day 7, MC38 colon cancer cells were subcutaneously injected into the mice. Starting from day 3 after tumor cell injection, the mice were administered a 1×10⁻⁶ concentration via gavage. 9 CFU of Allobaculum stercoricanis was administered once every 2 days to observe tumor growth in mice under these conditions (sample size n=10).

[0145] Figure 3 To Figure 2 C57BL / 6 wild-type (WT) mice with MC38 tumors were used to extract CD8+ from tumor tissue on day 16 after tumor cell injection. + Flow cytometry analysis of Ki-67 (n=5) and IFN-γ (n=6) expression levels in T cells.

[0146] Figure 4C57BL / 6 wild-type (WT) mice were administered antibiotics (ABX) via gavage on day 7, followed by subcutaneous injection (sc) of B16-F10 melanoma cells. Starting from day 7 post-injection, the mice were gavage every two days at a concentration of 1×10⁻⁶ cells. 9 The mice were treated with colony-forming units (CFU) of *Ischemic fecal microbes*, and simultaneously injected intraperitoneally every 2 days with 100 μg of anti-PD-1 antibody (α-PD-1) or control antibody (IgG) starting from day 9 after tumor cell injection. The antibody was administered for a total of 4 times. This is the tumor growth of mice under this combined treatment condition (sample size n=10).

[0147] from Figure 1 It can be seen that the relative abundance of fecal isobacillus in patients is related to the intratumoral CD8+. + The expression level of IFN-γ in T cells was significantly positively correlated.

[0148] from Figure 2 It is evident that gavage with Ibacillus fecalith can inhibit the growth of MC38 subcutaneous tumors.

[0149] from Figure 3 As can be seen, compared with the control group, the expression levels of IFN-γ and Ki67 in CD8+ T cells infiltrating tumor tissue of mice in the Ibacillus fecalis gavage group were significantly upregulated. This indicates that supplementation with Ibacillus fecalis can effectively promote the activation and proliferation of CD8+ T cells.

[0150] from Figure 4 It is evident that gavage with Ibacillus fecalis can enhance the antitumor efficacy of PD-1 antibodies.

[0151] The embodiments of this application have at least the following beneficial effects:

[0152] Solid clinical data support: Unlike most microbial anti-tumor studies based on pure animal experiments, the embodiments of this application first discovered a positive correlation between the abundance of Ischemicum faecalis and the intensity of anti-tumor immunity in patients, providing direct and strong human evidence for the clinical application value of this bacterium, and significantly enhancing the credibility and translational potential of the invention.

[0153] The mechanism is clear and the targeting is strong: The embodiments of this application not only demonstrate the anti-tumor effect of the bacterium, but also clarify that its mechanism of action is closely related to the core of specific activation of anti-tumor immunity (CD8+ T cells), and exerts its function by promoting the production of effector molecules such as IFN-γ. The mechanism is clear and the targeting is well-defined.

[0154] Broad applicability: Based on the core mechanism of CD8+ T cell activation (which is applicable to various solid tumors such as colorectal cancer and melanoma), combined with relevant evidence from clinical samples, this bacterium can be applied to a variety of solid tumors, breaking through the tumor type limitations of existing strains.

[0155] Significant synergistic effect: When used in combination with PD-1 antibody, this bacterial agent showed a significant synergistic anti-tumor effect in animal models, which was significantly better than monotherapy. This provides a new and safe combination strategy to solve the clinical problem of PD-1 inhibitor resistance or poor response.

[0156] High safety and ease of use: As an intestinal symbiotic, *Isobacterium fecalith* is expected to have a high safety profile when administered orally. Developing it into an oral probiotic preparation would result in good patient compliance, convenient use, and low cost.

[0157] This application's embodiments reveal for the first time the positive correlation between Ibacillus faecalis and anti-tumor immunity (CD8+ T cell activity) in cancer patients, and verify its function of activating CD8+ T cells to exert anti-tumor effects and synergistically enhance the efficacy of PD-1 antibodies.

[0158] In some embodiments, the strains used are not limited to wild-type Isobacillus fecalis, but also include derivative strains that have been genetically engineered to enhance immune activation.

[0159] In some embodiments, the form of administration is not limited to live bacteria, but includes inactivated bacterial cells, bacterial lysates, fermentation supernatants, extracted active ingredients (such as cell wall components, metabolites), etc.

[0160] In some embodiments, the route of administration is not limited to oral gavage, but includes any form that enables the bacteria or its active ingredients to reach the intestine and exert their effects, such as enteric-coated capsules, tablets, powders, etc.

[0161] In some embodiments, the combined treatment may include, but is not limited to, PD-1 / PD-L1 antibodies, and may also extend to other immune checkpoint inhibitors (such as CTLA-4 antibodies), cancer vaccines, adoptive cell therapy, or chemotherapy / radiotherapy.

[0162] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. Use of bacteria in the preparation of medicines for treating, preventing or improving diseases.

2. The use as described in claim 1, characterized in that, The bacteria include rod-shaped bacteria; Optionally, the bacteria include Firmicutes; Optionally, the bacteria include Clostridium; Optionally, the bacteria include Clostridium orders; Optionally, the bacteria include those belonging to the Erysipelothrix family; Optionally, the bacteria include *Isobacterium faecalis*. Optionally, the bacteria include Allobaculum stercoricanis.

3. The use as described in claim 1, characterized in that, The diseases mentioned include tumors; Optionally, the tumor includes at least one of solid tumors and non-solid tumors; Optionally, the tumor includes at least one of the following: colorectal cancer, melanoma, malignant tumor, glioma, mesothelioma, lymphoma, leukemia, adenocarcinoma, breast cancer, ovarian cancer, cervical cancer, glioblastoma, prostate cancer, Burkitt lymphoma, head and neck cancer, colon cancer, non-small cell lung cancer, small cell lung cancer, esophageal cancer, gastric cancer, pancreatic cancer, hepatobiliary cancer, gallbladder cancer, small bowel cancer, rectal cancer, kidney cancer, bladder cancer, prostate cancer, penile cancer, urethral cancer, testicular cancer, vaginal cancer, uterine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, pancreatic endocrine carcinoma, carcinoid tumor, bone cancer, skin cancer, retinoblastoma, Hodgkin lymphoma, non-Hodgkin lymphoma, Kaposi's sarcoma, multicentric Kastelman's disease, AIDS-related primary exudative lymphoma, neuroectodermal tumor, rhabdomyosarcoma, and osteosarcoma. Optionally, the non-solid tumors include tumors originating from the blood, lymphatic system, or bone marrow; Optionally, the non-solid tumor includes at least one of lymphoma, leukemia, and multiple myeloma; Optionally, the bacteria are used to inhibit tumor growth; Optionally, the bacteria are used to reduce tumor burden; Optionally, the bacteria are used to improve response rates and / or survival benefits in cancer patients; Optionally, the drug also includes a therapeutic agent; Optionally, the bacteria and the therapeutic agent are administered in combination or alone; Optionally, the form of the drug includes at least one of live bacteria, inactivated bacteria, bacterial components, fermentation supernatant, metabolites, crude extracts, lyophilized powder, capsules, and granules.

4. A composition, characterized in that, This includes bacteria and treatments.

5. The composition according to claim 4, characterized in that, The bacteria include rod-shaped bacteria; Optionally, the bacteria include Firmicutes; Optionally, the bacteria include Clostridium; Optionally, the bacteria include Clostridium orders; Optionally, the bacteria include those belonging to the Erysipelothrix family; Optionally, the bacteria include *Isobacterium faecalis*. Optionally, the bacteria include Allobaculum stercoricanis. Optionally, the therapeutic agent includes an anticancer agent; Optionally, the therapeutic agent includes at least one of immunotherapeutic agents, chemotherapeutic agents, targeted therapeutic agents, vaccines, and immune cells; Optionally, the immunotherapeutic agent includes an immune checkpoint inhibitor; Optionally, the immune checkpoint inhibitor includes at least one of PD-1 inhibitors, PD-L-1 inhibitors, and CTLA-4 inhibitors; Optionally, the immune checkpoint inhibitor includes at least one of an anti-PD-1 antibody or a variant or functional fragment thereof, an anti-PD-L-1 antibody or a variant or functional fragment thereof, and an anti-CTLA-4 antibody or a variant or functional fragment thereof; Optionally, the chemotherapeutic agent includes at least one of angiogenesis inhibitors, microtubule assembly inhibitors, DNA cross-linking agents, local isomerase inhibitors, DNA intercalating agents, DNA synthesis inhibitors, tyrosine kinase inhibitors, and mitosis inhibitors. Optionally, the chemotherapeutic agent includes, but is not limited to, at least one of alkylating agents, metabolic antagonists, DNA demethylating agents, substituted nucleotides, substituted nucleosides, antitumor antibiotics, plant-derived antitumor agents, or nitrosoureas; Optionally, the chemotherapeutic agents include cisplatin, carboplatin, pemetrexed, vinorelbine, gemcitabine, taxanes (including, for example, paclitaxel, docetaxel, or nab-paclitaxel), etoposide, methotrexate (MTX), trimethobenzoic acid ester (TMTX), temozolomide, dacarbazine (DTIC), raltitrexed, S-(4-nitrobenzyl) 6-Thioinosine (NBMPR), 6-benzylguanidine (6-BG), rabinopyranosyl-N-methyl-N-nitrosourea (Aranose), carmustine (BCNU, BiCNU), chloramphenicol, ethylnitrosourea (ENU), fortimustine, lomustine (CCNU), nimustine, N-nitroso-N-methylurea (NMU), ramustine (MCNU), semustine, streptozotocin (streptozotocin), cytarabine, camptothecin; or at least one of the therapeutic derivatives thereof; Optionally, the targeted therapeutic agents include topotecan, irinotecan, bevacizumab, erlotinib, lapatinib, cetuximab, erlotinib, gefitinib, lapatinib, pazopanib, trastuzumab, fulvestrant, tamoxifen, letrozole, anastrozole, exemestane, everolimus, and abiraterone. ne), bicalutamide, bortezomib, vemurafenib, ipilimumab, pertuzumab), MEDI4276, ONT-380, neratinib, afatinib, duligotuzumab, dacomitinib, sapitinib, poziotinib, ASLAN001, MM-111, MM-121, MM-141, LJM716, U3-1287 (AMG) 888), TK-A3 / TK-A4, Lumretuzumab, REGN1400, AV-203, AZD5363, Afuresertib, MK-2206, Ipatasertib, Ridaforolimus, Temsirolimus, Selemetinib, Cobimetinib, GDC-0994, Taselisib, Alpelisib, Buparlisib, AZD8186, AZD8835, Panitumumab, REGN955, MM-151, Oxygen Osimertinib, Rociletinib, AZD5363, SGX-523, Onartuzumab, Cabozantinib, Volitinib, Tivantinib, Capmatinib, Emibetuzumab, Rilotumumab, Ficlatuzumab, SAR125844, Sym015, AMG337, JNJ-61186372, glesatinib, 1202LY3023414, Gedatolisib, JI-101, Ponatinib, Sunitinib, Crizotinib, Ceritinib, Brigatinib, Alectinib, BGJ398, Linsitinib, Quizartinib, R428 (BGB324), Gilteritinib, Vismodegib, Itraconazole, 5E1, LGK974, Semagacestat, Cobimetinib AZD4547, JNJ-42756493, Dalotuzumab, MEDI-573, Ganitumab, Sonidegib, Vantictumab, Ipafricept, Tarextumab, Brontictuzumab, SB431542, EW-7197, RepSox, AZD9291, Rociletinib, Abraxane, Brentutumab-Vidoxine vedoton, ofatumumab, bevacizumab, alemtuzumab, bicalutamide, gemcitabine, imatinib, ixabepilone, romidepsin, cabrazaxetel, sorafenib, infliximab, lenalidomide, rituximab, dasatinib Nilotinib, temozolomide, bortezomib, azacitidine, tepotinib, lorlatinib, meretinib, RG6114, tucantinib, pazopanib, crizotinib, vemurafenib, goserelinacetate, abirateroneBH3 mimics, navitoclax, anastrozole, letrozole, aromatase inhibitors, ixabepilone, aflibercept, temsirolimus, irbritumomab, abiraterone, custirsen, enzalutamide, nivolumab, palbociclib, regorafenib, entinostat, ARN-509, ARN-810, BIND-014 At least one of the following: dabrafenib, daratumumab, lambrolizumab, LDK378, sym004, trastuzumab-mettansine, tivozanib, trametinib, axitinib, LY2835219, MPDL320A, obinutuzumab, Sym004, tositumomab, trametinib, necitumumab, and ramucirumab.

6. A medicament comprising a therapeutically effective amount of bacteria or an active extract thereof, or the composition as described in claim 4 or 5; Optionally, the bacteria include rod-shaped bacteria; Optionally, the bacteria include Firmicutes; Optionally, the bacteria include Clostridium; Optionally, the bacteria include Clostridium orders; Optionally, the bacteria include those belonging to the Erysipelothrix family; Optionally, the bacteria include *Isobacterium faecalis*. Optionally, the bacteria include Allobaculum stercoricanis.

7. Use of the composition of claim 4 or 5 in the preparation of a medicament for treating, preventing or improving a disease; Optionally, the disease includes tumors; Optionally, the tumor includes at least one of solid tumors and non-solid tumors; Optionally, the tumor includes at least one of the following: colorectal cancer, melanoma, malignant tumor, glioma, mesothelioma, lymphoma, leukemia, adenocarcinoma, breast cancer, ovarian cancer, cervical cancer, glioblastoma, prostate cancer, Burkitt lymphoma, head and neck cancer, colon cancer, non-small cell lung cancer, small cell lung cancer, esophageal cancer, gastric cancer, pancreatic cancer, hepatobiliary cancer, gallbladder cancer, small bowel cancer, rectal cancer, kidney cancer, bladder cancer, prostate cancer, penile cancer, urethral cancer, testicular cancer, vaginal cancer, uterine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, pancreatic endocrine carcinoma, carcinoid tumor, bone cancer, skin cancer, retinoblastoma, Hodgkin lymphoma, non-Hodgkin lymphoma, Kaposi's sarcoma, multicentric Kastelman's disease, AIDS-related primary exudative lymphoma, neuroectodermal tumor, rhabdomyosarcoma, and osteosarcoma. Optionally, the non-solid tumors include tumors originating from the blood, lymphatic system, or bone marrow; Optionally, the non-solid tumor includes at least one of lymphoma, leukemia, and multiple myeloma; Optionally, the composition is used to inhibit tumor growth; Optionally, the composition is used to reduce tumor burden; Optionally, the composition is used to improve response rates and / or survival benefits in cancer patients.

8. The use of bacteria or their active extracts in the preparation of drugs for activating CD8+ T cells and / or promoting the production of IFN-γ by CD8+ T cells; Optionally, the bacteria include rod-shaped bacteria; Optionally, the bacteria include Firmicutes; Optionally, the bacteria include Clostridium; Optionally, the bacteria include Clostridium orders; Optionally, the bacteria include those belonging to the Erysipelothrix family; Optionally, the bacteria include *Isobacterium faecalis*. Optionally, the bacteria include Allobaculum stercoricanis.

9. A method for treating and / or preventing a disease, characterized in that, This includes administering an effective amount of bacteria to a patient, or administering an effective amount of a composition containing said bacteria, or administering an effective amount of bacteria and an effective amount of a therapeutic agent, respectively. Optionally, the bacteria include rod-shaped bacteria; Optionally, the bacteria include Firmicutes; Optionally, the bacteria include Clostridium; Optionally, the bacteria include Clostridium orders; Optionally, the bacteria include those belonging to the Erysipelothrix family; Optionally, the bacteria include *Isobacterium faecalis*. Optionally, the bacteria include Allobaculum stercoricanis. Optionally, the composition includes bacteria and a therapeutic agent; Optionally, the therapeutic agent includes an anticancer agent; Optionally, the therapeutic agent includes at least one of immunotherapeutic agents, chemotherapeutic agents, and targeted therapeutic agents; Optionally, the immunotherapeutic agent includes an immune checkpoint inhibitor; Optionally, the immune checkpoint inhibitor includes at least one of PD-1 inhibitors, PD-L-1 inhibitors, and CTLA-4 inhibitors; Optionally, the immune checkpoint inhibitor includes at least one of an anti-PD-1 antibody or a variant or functional fragment thereof, an anti-PD-L-1 antibody or a variant or functional fragment thereof, and an anti-CTLA-4 antibody or a variant or functional fragment thereof; Optionally, the chemotherapeutic agent includes at least one of angiogenesis inhibitors, microtubule assembly inhibitors, DNA cross-linking agents, local isomerase inhibitors, DNA intercalating agents, DNA synthesis inhibitors, tyrosine kinase inhibitors, and mitosis inhibitors. Optionally, the chemotherapeutic agent includes at least one of alkylating agents, metabolic antagonists, DNA demethylating agents, substituted nucleotides, substituted nucleosides, antitumor antibiotics, plant-derived antitumor agents, or nitrosoureas. Optionally, the chemotherapeutic agents include cisplatin, carboplatin, pemetrexed, vinorelbine, gemcitabine, taxanes (including, for example, paclitaxel, docetaxel, or nab-paclitaxel), etoposide, methotrexate (MTX), trimethobenzoic acid ester (TMTX), temozolomide, dacarbazine (DTIC), raltitrexed, S-(4-nitrobenzyl) 6-Thioinosine (NBMPR), 6-benzylguanidine (6-BG), rabinopyranosyl-N-methyl-N-nitrosourea (Aranose), carmustine (BCNU, BiCNU), chloramphenicol, ethylnitrosourea (ENU), fortimustine, lomustine (CCNU), nimustine, N-nitroso-N-methylurea (NMU), ramustine (MCNU), semustine, streptozotocin (streptozotocin), cytarabine, camptothecin; or at least one of the therapeutic derivatives thereof; Optionally, the targeted therapeutic agents include topotecan, irinotecan, bevacizumab, erlotinib, lapatinib, cetuximab, erlotinib, gefitinib, lapatinib, pazopanib, trastuzumab, fulvestrant, tamoxifen, letrozole, anastrozole, exemestane, everolimus, and abiraterone. ne), bicalutamide, bortezomib, vemurafenib, ipilimumab, pertuzumab), MEDI4276, ONT-380, neratinib, afatinib, duligotuzumab, dacomitinib, sapitinib, poziotinib, ASLAN001, MM-111, MM-121, MM-141, LJM716, U3-1287 (AMG) 888), TK-A3 / TK-A4, Lumretuzumab, REGN1400, AV-203, AZD5363, Afuresertib, MK-2206, Ipatasertib, Ridaforolimus, Temsirolimus, Selemetinib, Cobimetinib, GDC-0994, Taselisib, Alpelisib, Buparlisib, AZD8186, AZD8835, Panitumumab, REGN955, MM-151, Oxygen Osimertinib, Rociletinib, AZD5363, SGX-523, Onartuzumab, Cabozantinib, Volitinib, Tivantinib, Capmatinib, Emibetuzumab, Rilotumumab, Ficlatuzumab, SAR125844, Sym015, AMG337, JNJ-61186372, glesatinib, 1202LY3023414, Gedatolisib, JI-101, Ponatinib, Sunitinib, Crizotinib, Ceritinib, Brigatinib, Alectinib, BGJ398, Linsitinib, Quizartinib, R428 (BGB324), Gilteritinib, Vismodegib, Itraconazole, 5E1, LGK974, Semagacestat, Cobimetinib AZD4547, JNJ-42756493, Dalotuzumab, MEDI-573, Ganitumab, Sonidegib, Vantictumab, Ipafricept, Tarextumab, Brontictuzumab, SB431542, EW-7197, RepSox, AZD9291, Rociletinib, Abraxane, Brentutumab-Vidoxine vedoton, ofatumumab, bevacizumab, alemtuzumab, bicalutamide, gemcitabine, imatinib, ixabepilone, romidepsin, cabrazaxetel, sorafenib, infliximab, lenalidomide, rituximab, dasatinib Nilotinib, temozolomide, bortezomib, azacitidine, tepotinib, lorlatinib, meretinib, RG6114, tucantinib, pazopanib, crizotinib, vemurafenib, goserelinacetate, abirateroneBH3 mimics, navitoclax, anastrozole, letrozole, aromatase inhibitors, ixabepilone, aflibercept, temsirolimus, irbritumomab, abiraterone, custirsen, enzalutamide, nivolumab, palbociclib, regorafenib, entinostat, ARN-509, ARN-810, BIND-014. At least one of the following: dabrafenib, daratumumab, lambrolizumab, LDK378, sym004, trastuzumab-metatansine, tivozanib, trametinib, axitinib, LY2835219, MPDL320A, obinutuzumab, Sym004, tositumomab, trametinib, necitumumab, and ramucirumab; Optionally, the disease includes tumors; Optionally, the tumor includes at least one of solid tumors and non-solid tumors; Optionally, the solid tumor includes at least one of the following: colorectal cancer, melanoma, malignant tumor, glioma, mesothelioma, lymphoma, leukemia, adenocarcinoma, breast cancer, ovarian cancer, cervical cancer, glioblastoma, prostate cancer, Burkitt lymphoma, head and neck cancer, colon cancer, non-small cell lung cancer, small cell lung cancer, esophageal cancer, gastric cancer, pancreatic cancer, hepatobiliary cancer, gallbladder cancer, small bowel cancer, rectal cancer, kidney cancer, bladder cancer, prostate cancer, penile cancer, urethral cancer, testicular cancer, vaginal cancer, uterine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, pancreatic endocrine carcinoma, carcinoid tumor, bone cancer, skin cancer, retinoblastoma, Hodgkin lymphoma, non-Hodgkin lymphoma, Kaposi's sarcoma, multicentric Kastelman's disease, AIDS-related primary exudative lymphoma, neuroectodermal tumor, rhabdomyosarcoma, and osteosarcoma. Optionally, the non-solid tumors include tumors originating from the blood, lymphatic system, or bone marrow; Optionally, the non-solid tumor includes at least one of lymphoma, leukemia, and multiple myeloma; Optionally, the method may also include use in combination with other treatment methods; Optionally, the other methods include at least one of immune checkpoint inhibitor therapy, cancer vaccine therapy, adoptive cell therapy, chemotherapy, and radiotherapy.

10. An evaluation method, characterized in that, include: The effectiveness of the drug or the risk of disease is assessed based on the bacterial test results in the subject's sample. Optionally, the detection results include the relative abundance of bacteria; Optionally, the bacteria include rod-shaped bacteria; Optionally, the bacteria include Firmicutes; Optionally, the bacteria include Clostridium; Optionally, the bacteria include Clostridium orders; Optionally, the bacteria include those belonging to the Erysipelothrix family; Optionally, the bacteria include *Isobacterium faecalis*. Optionally, the bacteria include Allobaculum stercoricanis. Optionally, the assessment includes evaluating the subject's potential for treatment response; Optionally, the treatment includes immunotherapy; Optionally, the subjects include cancer patients; Optionally, the tumor includes at least one of solid tumors and non-solid tumors.

Images