Use of bckdk gene as a target in preparation of a drug for preventing or treating obesity-related cardiomyopathy

By using an adeno-associated virus vector to specifically express the BCKDK gene in cardiomyocytes, the problem of lacking an effective therapeutic target for obesity-related cardiomyopathy was solved, and a significant improvement effect on obesity-related cardiomyopathy was achieved.

CN122163839APending Publication Date: 2026-06-09SOUTHEAST UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SOUTHEAST UNIV
Filing Date
2026-04-27
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Current technologies lack effective gene therapy targets to improve obesity-related cardiomyopathy, resulting in a lack of targeted treatment options.

Method used

Using adeno-associated virus (AAV) as a vector, the expression of the BCKDK gene in cardiomyocytes is mediated by a cardiomyocyte-specific promoter, including BCKDK, the nucleic acid molecule encoding BCKDK and its functional variants, truncated forms or functional fragments, for the preparation of drugs to prevent or treat obesity-related cardiomyopathy.

Benefits of technology

It significantly improves myocardial hypertrophy, fibrosis, myocardial metabolic abnormalities, and cardiac dysfunction in a mouse model of obesity-related cardiomyopathy, providing a new treatment strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122163839A_ABST
    Figure CN122163839A_ABST
Patent Text Reader

Abstract

The application discloses application of BCKDK gene as a target point in preparation of a medicine for preventing or treating obesity-related cardiomyopathy. The application firstly determines an important function of BCKDK in obesity-related cardiomyopathy, and overexpression of the BCKDK gene can protect the heart. The application also provides application of a nucleic acid molecule coding BCKDK, an expression vector or a delivery system containing the same, and application of BCKDK or the nucleic acid molecule coding BCKDK as a drug target. Preferably, the drug adopts an adeno-associated virus vector driven by a myocardium-specific promoter, carries a coding sequence of BCKDK or a functional variant, a truncated body or a functional fragment of BCKDK, and realizes myocardium-specific expression. Experiments prove that overexpression of BCKDK can significantly improve myocardial hypertrophy, fibrosis and diastolic dysfunction.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of BCKDK, nucleic acid molecules encoding BCKDK and their functional variants, truncated forms or functional fragments in the preparation of drugs for the prevention or treatment of obesity-related cardiomyopathy. Background Technology

[0002] Since 1975, the global prevalence of obesity has almost tripled. Cohort studies have shown that obesity increases the risk of cardiomyopathy, especially in severely obese patients (BMI ≥35 kg / m²). 2 Obese individuals have an approximately 5-fold increased risk of developing cardiomyopathy; their risk of heart failure increases by 30%-100%, with each unit increase in BMI increasing the risk of heart failure by 7% in women and 5% in men. Increasing epidemiological evidence suggests that cardiomyopathy in obese patients can occur independently of diabetes, coronary artery disease, hypertension, and other comorbidities. Structurally, it primarily manifests as ventricular hypertrophy and myocardial fibrosis, leading to diastolic dysfunction and gradually progressing to obesity-related heart failure with preserved ejection fraction. The pathogenic factors and mechanisms of obesity-related cardiomyopathy are complex, and current treatments mainly focus on managing obesity itself, lacking specific therapeutic targets for the disease. Therefore, identifying precise therapeutic targets suitable for obesity-related cardiomyopathy is crucial.

[0003] In recent years, gene therapy has gained increasing attention. Adeno-associated virus (AAV) has been widely used in in vivo gene therapy research due to its low immunogenicity, non-integrative expression, and good tissue affinity. In the field of cardiovascular disease, AAV9 serotype virus has shown excellent cardiac-targeted delivery efficiency in multiple small and large animal models due to its natural affinity for cardiomyocytes. Furthermore, it can achieve precise myocardial-directed expression through myocardial-specific promoters (such as cTnT), improving the safety and accuracy of treatment. AAV vectors are gradually moving towards clinical application. In the cardiovascular field, AAV1 and AAV9 have been used in Phase I or II clinical trials to evaluate their safety and preliminary efficacy in chronic heart failure, showing good tolerability and biological activity. However, there is currently a lack of AAV9-mediated targets available for improving obesity-related cardiomyopathy through gene therapy. Therefore, how to provide AAV9-mediated targets for improving obesity-related cardiomyopathy through gene therapy is a pressing technical problem that needs to be solved.

[0004] BCKDK belongs to the protein kinase family and is an inhibitory kinase of BCKDH, the rate-limiting enzyme in the branched-chain amino acid catabolism pathway. It inhibits the catalytic activity of BCKDH by phosphorylating the E1α subunit (BCKDHA), thereby suppressing the BCAA catabolism pathway. Furthermore, BCKDK dysfunction is closely related to glucose and lipid metabolism disorders: BCKDK is a homolog of pyruvate dehydrogenase kinase (PDK1-4) and functions by phosphorylating the A subunit 1 of the pyruvate dehydrogenase complex (PDHA1). Inhibiting PDHA1 activity inhibits pyruvate entry into the tricarboxylic acid cycle (TCA), playing a crucial role in maintaining embryonic development. BCKDK also regulates the phosphorylation level of ATP-citrate lyase (ACL), a key enzyme in lipogenesis, thereby promoting de novo lipogenesis in the liver. In addition to regulating metabolic pathways, BCKDK also has non-metabolic pathway functions such as regulating ubiquitination modification and cell cycle; for example, it inhibits TALIN1 ubiquitination and degradation by blocking the binding of E3 ubiquitin ligase to TALIN1, thereby promoting breast cancer metastasis.

[0005] A search of domestic and international literature has revealed no studies on the use of the BCKDK gene as a target for the prevention or treatment of obesity-related cardiomyopathy. Summary of the Invention

[0006] One object of the present invention is to provide the use of BCKDK, nucleic acid molecules encoding BCKDK and their functional variants, truncated forms or functional fragments in the preparation of medicaments for the prevention or treatment of obesity-related cardiomyopathy.

[0007] Another object of the present invention is to provide BCKDK or nucleic acid molecules encoding BCKDK as drug targets for screening drugs for the prevention or treatment of obesity-related cardiomyopathy.

[0008] Another object of the present invention is to provide the use of a promoter capable of upregulating BCKDK expression in the preparation of a drug for the prevention or treatment of obesity-related cardiomyopathy.

[0009] Another object of the present invention is to provide a medicament for the prevention or treatment of obesity-related cardiomyopathy.

[0010] To achieve the above objectives, the present invention adopts the following technical solution:

[0011] In a first aspect, the present invention provides the use of BCKDK, a nucleic acid molecule encoding BCKDK, an expression vector or delivery system containing said nucleic acid molecule in the preparation of drugs for the prevention or treatment of obesity-related cardiomyopathy.

[0012] Preferably, the expression vector or delivery system is an adeno-associated virus vector, and the adeno-associated virus vector mediates the specific expression of BCKDK in cardiomyocytes through a cardiomyocyte-specific promoter.

[0013] Preferably, the BCKDK is selected from one of human BCKDK, rat BCKDK, and mouse BCKDK.

[0014] Preferably, the BCKDK also includes its functional variants, truncated versions, or functional fragments.

[0015] Preferably, the obesity-related cardiomyopathy can further progress to obesity-related heart failure with preserved ejection fraction. The technical solution provided by the present invention can also be used for the prevention or treatment of related pathological changes.

[0016] Preferably, the drug exerts its preventive or therapeutic effects by improving myocardial hypertrophy, myocardial fibrosis, mitochondrial dysfunction, oxidative stress, diastolic dysfunction, cardiac remodeling, and / or cardiac dysfunction.

[0017] Secondly, this invention provides the application of BCKDK or nucleic acid molecules encoding BCKDK as drug targets for screening drugs for the prevention or treatment of obesity-related cardiomyopathy.

[0018] Thirdly, the present invention provides the use of a promoter capable of upregulating BCKDK expression in the preparation of drugs for the prevention or treatment of obesity-related cardiomyopathy.

[0019] Preferably, the promoter includes a viral vector, a non-viral vector, a small molecule activator, a nucleic acid drug, a peptide, or a nanodelivery system.

[0020] Preferably, the viral vector comprises adeno-associated virus, which can specifically express BCKDK in cardiomyocytes.

[0021] Preferably, the adeno-associated virus mediates the specific expression of BCKDK in cardiomyocytes via a cardiomyocyte-specific promoter.

[0022] Preferably, the cardiomyocyte-specific promoter is selected from: cTnT, α-MHC, MLC-2v, and Desmin.

[0023] Preferably, the method for preparing the adeno-associated virus includes the following steps:

[0024] (1) The BCKDK gene was cloned into a viral empty vector to obtain the BCKDK gene expression vector, whose element sequence is: cTnT-BCKDK-3×FLAG-P2A-GdGreen-tWPA;

[0025] (2) The BCKDK gene expression vector and helper packaging plasmid were co-transfected into AAV-293 cells by calcium phosphate transfection and cultured. Then, the cells were concentrated, purified and desalted by ultrafiltration to obtain adeno-associated virus overexpressing the BCKDK gene.

[0026] Fourthly, the present invention provides a medicament for the prevention or treatment of obesity-related cardiomyopathy, the medicament comprising an adeno-associated virus vector that specifically overexpresses the BCKDK gene in cardiomyocytes.

[0027] Preferably, the drug may further include pharmaceutically acceptable excipients.

[0028] Beneficial effects: Compared with the prior art, the beneficial effects of the present invention are as follows:

[0029] (1) This invention uses adeno-associated virus (AAV) as a vector to carry the BCKDK gene. AAV has low immunogenicity, non-integrative expression and good tissue affinity, and is widely used in in vivo gene therapy research. In the field of cardiovascular disease, AAV9 serotype virus has shown excellent cardiac targeted delivery efficiency in multiple small and large animal models due to its natural affinity for cardiomyocytes.

[0030] (2) This invention achieves precise myocardial targeted expression through myocardial specific promoters (such as cTnT). When AAV is successfully transfected into myocardial tissue, only myocardial cells can initiate the expression of exogenous BCKDK gene, thereby achieving cell-specific therapy.

[0031] (3) The experiment showed that BCKDK overexpression in cardiomyocytes can significantly improve myocardial hypertrophy, myocardial fibrosis, myocardial metabolic abnormalities and cardiac dysfunction in mice with obesity-related cardiomyopathy, thereby achieving good relief and treatment effects and providing a new strategy for the prevention and treatment of obesity-related cardiomyopathy.

[0032] (4) Since the pathogenesis of obesity-related cardiomyopathy is not fully understood, the determination of the function of BCKDK in obesity-related cardiomyopathy will provide a new direction for further research on the etiology, pathogenesis and corresponding prevention and treatment strategies of obesity-related cardiomyopathy. Attached Figure Description

[0033] Figure 1 This is a complete map of adeno-associated virus vectors expressing the BCKDK gene provided in embodiments of the present invention;

[0034] Figure 2 The graph shows the successful establishment of obesity-related cardiomyopathy induced by a high-fat diet and the changes in BCKDK protein levels. Among them, A shows the results of mouse cardiac function measurement, indicating the successful establishment of the obesity-related cardiomyopathy animal model; B shows the changes in BCKDK protein levels in the cardiac tissue of mice with obesity-related cardiomyopathy; and C shows the changes in BCKDK protein levels in primary cardiomyocytes cultured in a high-fat diet.

[0035] Figure 3This is a Western blot plot showing the expression level of BCKDK protein in mouse hearts; where A is the BCKDK protein expression band plot and B is the statistical plot of the relative expression level of BCKDK protein.

[0036] Figure 4 The graphs show the cardiac function measurements of mice in different groups; where A represents the cardiac function measurement results; B represents the cardiac ejection fraction measurement results; and C represents the E / E' measurement results.

[0037] Figure 5 Images show the cardiac structure and pathological staining of mice in different groups; where A is a gross cardiac image; B is a cardiac weight measurement image; C is a cardiac diameter ratio measurement image; D is a WGA staining image of cardiac tissue; E is a cardiomyocyte size measurement image; F is a Sirius red staining image of cardiac tissue; and G is a collagen area ratio measurement image.

[0038] Figure 6 Images show the ultrastructure of mitochondria in the hearts of mice in different groups and their oxidative stress levels; A shows a transmission electron microscope image of the heart and a statistical graph of mitochondrial scores and swelling percentages; B shows a DHE staining image of the heart and a statistical graph. Detailed Implementation

[0039] The following will provide further explanation in conjunction with embodiments of the present invention.

[0040] Example 1: Construction of a cardiomyocyte-specific adeno-associated virus vector overexpressing the mouse BCKDK gene

[0041] This invention provides an adeno-associated virus that specifically overexpresses the BCKDK gene in cardiomyocytes, and its preparation method includes the following steps:

[0042] 1. Target gene and tool vector information:

[0043] As the target gene of this invention, the Bckdk gene is preferably a mouse-derived Bckdk coding sequence or a human BCKDK coding sequence. The CDS sequences of the mouse Bckdk gene and the human BCKDK gene in this invention are standard reference sequences from recognized databases such as NCBI RefSeq. This embodiment uses the mouse Bckdk gene as an example.

[0044] Gene name: Bckdk(NM_009739.3); Species: Mouse

[0045] Vector name and element order: cTNT-GdGreen-tWPA; Cloning site: EcoRI / BamHI;

[0046] The complete map of the constructed vector is shown below. Figure 1 (Purchased from Shanghai Heyuan Biotechnology Co., Ltd.)

[0047] 2. Obtaining the target gene fragment

[0048] In this embodiment, the Bckdk gene coding sequence was obtained artificially. The target gene fragment was designed and synthesized based on the mouse Bckdk gene sequence in GenBank; homologous arms matching the ends of the linearized vector were introduced at both ends of the target gene fragment to facilitate seamless cloning.

[0049] In other embodiments, the target gene fragment can also be obtained by PCR amplification or by enzyme digestion of a template plasmid containing the target gene.

[0050] 3. Preparation of linearized expression vectors

[0051] The expression vector was preferably digested with EcoRI and BamHI restriction endonucleases. The digestion reaction system consisted of 2 μg plasmid, 5 μL 10x reaction buffer, 1 μL each restriction endonuclease, and water to a final volume of 50 μL. The mixture was incubated in a 37°C water bath for at least 2 hours. The digestion products were analyzed by agarose gel electrophoresis to determine the digestion efficiency. The target vector band was then detached from the agarose gel and recovered.

[0052] 4. Construction and identification of recombinant Bckdk plasmid

[0053] The target gene fragment and linearized vector were added to a centrifuge tube at a molar ratio of 2:1 using a seamless cloning kit for recombination. After mixing, the mixture was incubated at 37°C for 30 minutes, then transferred to ice for 5 minutes to achieve in vitro circularization of the linearized vector and the Bckdk gene fragment, yielding the recombinant product. The recombinant product was then mixed with competent cells for transformation. DH5α competent cells are preferred in this invention. This invention does not impose any special limitations on the transformation method; conventional transformation methods in the field are acceptable. After transformation, single clones were picked from the plate for PCR identification. Positive clones were sequenced and the results analyzed. The correctly cloned bacterial culture was expanded and extracted to obtain a high-purity plasmid, i.e., the Bckdk gene expression vector. Sequencing results of positive clones indicated accurate sequencing pass.

[0054] TACTTAATACGACTCACTATAGG GAATTC GGATCC ATGGCCCAGTCCAAGCACGGCCTGACCAAG

[0055] 5. Adeno-associated virus (AAV) Bckdk release packaging and virus particle titer determination

[0056] The Bckdk gene expression vector and two helper packaging plasmids (pHelper plasmid, carrying adenovirus-derived genes; pAAV-RC plasmid, carrying AAV replication and capsid genes) were co-transfected into AAV-293 cells via calcium phosphate transfection to package adeno-associated virus (AAV) containing the Bckdk gene. After 72 hours of culture, the virus was harvested, followed by routine concentration, purification, and ultrafiltration desalting. Finally, quantitative PCR was used to determine the number of viral particles in the AAV vector by detecting the genome copy number.

[0057] In this invention, there are no special restrictions on the preparation method of adeno-associated virus that specifically overexpresses the BCKDK gene of cardiomyocytes. Any adeno-associated virus (i.e., cTnT-AAV-BCKDK) that overexpresses the BCKDK gene and is prepared by conventional methods in the art can be used.

[0058] Example 2: Expression of BCKDK in animal and cell models of obesity-related cardiomyopathy

[0059] The specific method is as follows:

[0060] 1. Animal Grouping and Treatment: Male 6-week-old C57BL / 6J mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. (Jiangsu, China). A high-fat diet (HFD, D12492) and a control diet (containing 60% fat) were purchased from Research Diets. Grouping and treatment were as follows: 1) Normal group (ND): fed the control diet; 2) Experimental group (HFD): fed the high-fat diet. All animals were induced for 28 weeks, with mouse weight recorded weekly. Glucose tolerance was tested after modeling. Cardiac function was evaluated by ultrasound at 28 weeks of induction, and samples were taken from the animals for subsequent testing.

[0061] 2. Isolation and Culture of Primary Cardiac Cells: Twenty one-day-old C57BL / 6J newborn mice were disinfected with alcohol, and the ventricles were harvested via thoracotomy along the left midclavicular line. After washing several times with PBS, the cells were minced and digested 6-8 times with trypsin and collagenase digestion solutions until the myocardial tissue was completely flocculent. All cell suspensions were collected. The cell suspensions were filtered, centrifuged, resuspended, and placed in culture dishes for differential adhesion for 1-2 hours to remove fibroblasts. Finally, the cell suspensions in the culture dishes were collected, and cardiomyocytes were isolated using Percoll gradient centrifugation. The cells were cultured at 37 ℃. After the cardiomyocytes adhered (approximately 12 hours), the medium was replaced with 200 μM palmitic acid medium to construct a cell model of obesity-related cardiomyopathy.

[0062] The specific testing indicators and operating methods are as follows:

[0063] (1) Animal cardiac ultrasound: First, remove the hair from the chest of the mouse, then place it in an induction box to maintain an anesthesia concentration of 1%-2% (v / v) isoflurane. After the mouse stops moving and its body is in a lateral recumbent position, and it cannot be immediately turned over after being placed in a supine position, place it on the physiological information monitoring platform, and apply physiological saline to its eyes to prevent dryness. Apply conductive glue to the copper plate to obtain its ECG and respiratory physiological information. Then, operate according to the operating procedures of the small animal ultrasound imaging system (Visual Sonics Vevo3100) to measure cardiac function such as left ventricular ejection fraction, E / E' peak, etc. to assess cardiac function. Cardiac dysfunction is the main feature of obesity-related cardiomyopathy, mainly diastolic dysfunction. Figure 2 The results of the study showed that, compared with the normal group, the ejection fraction of the heart in the experimental group mice was slightly reduced but still within the normal range, and the E / E' ratio was significantly increased. The experimental group mice had diastolic dysfunction, and the animal model of obesity-related cardiomyopathy was successfully established.

[0064] (2) BCKDK protein level detection: Western blotting was used to detect the BCKDK protein level in obesity-related cardiomyopathy cells and animal models. Figure 2 The results from the B group indicated that the expression level of BCKDK protein was significantly reduced in the heart tissue of the experimental group mice. Figure 2 In the middle C, there are neonatal mouse cardiomyocyte models with normal glucose treatment (NG) and high fat treatment (PA). The expression level of BCKDK protein in cardiomyocytes with high fat treatment is significantly reduced.

[0065] Example 3: Investigation into the therapeutic effect of cardiomyocyte-specific overexpression of the BCKDK gene on obesity-related cardiomyopathy mice

[0066] The specific method is as follows:

[0067] 1. Animal Experiment Grouping and Treatment: Male 6-week-old C57BL / 6J mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. (Jiangsu, China). A high-fat diet (HFD, D12492) and a control diet containing 60% fat were purchased from Research Diets. Grouping and treatment were as follows: 1) Normal group (ND+AAV-CON): fed the control diet and injected intravenously with adeno-associated virus cTnT-AAV-Control; 2) Obese control group (HFD+AAV-CON): fed a high-fat diet and injected intravenously with adeno-associated virus cTnT-AAV-Control; 3) Obese overexpression group (HFD+AAV-BCKDK): fed a high-fat diet and injected intravenously with adeno-associated virus cTnT-AAV-BCKDK. Mice in each group received one intravenous injection at week 0 and week 14 of the experiment, with each injection dose being 5 × 10⁻⁶. 11 vg / animal. All animals were induced for 28 weeks, with mouse weight recorded weekly. Glucose tolerance was tested after modeling was completed. Cardiac function was evaluated by ultrasound at 28 weeks of induction, and samples were taken from the animals for subsequent testing. All animals had free access to water and food during the experiment. Light was alternated every 12 hours, the temperature was 21±2℃, and the humidity was 40%-70%. Figure 3 The expression level of BCKDK protein in mouse heart tissue was detected by AB assay after high-fat diet combined with adeno-associated virus intervention, and the results indicated that BCKDK overexpression was successful.

[0068] 2. Terminal Tissue Collection from Mice: Mice were fasted for 4 hours before the end of the experiment, but allowed free access to water. They were then anesthetized with 1%-2% (v / v) isoflurane and euthanized by cervical dislocation. After euthanasia, the mice were fixed supine on a dissecting board and disinfected with 75% alcohol. The abdominal cavity to the thoracic cavity was opened with surgical scissors to expose the heart. The heart was removed, rinsed in PBS until no bloodstains remained, and then weighed. The tibia was removed, and its length was measured.

[0069] 3. Pathological tissue processing: Mouse hearts were taken, rinsed in PBS until no blood stains remained, and fixed in PBS solution containing 4% (w / v) paraformaldehyde for 24 hours; washed 3 times with PBS (30 minutes each time); dehydrated in a gradient of 70% ethanol (2 hours) → 80% ethanol (2 hours) → 90% ethanol (2 hours) → anhydrous ethanol I (45 minutes) → anhydrous ethanol II (45 minutes) → anhydrous ethanol III (45 minutes); cleared twice with xylene I (20 minutes) → xylene II (30 minutes); paraffin I (45 minutes) → paraffin II (45 minutes) → paraffin III (45 minutes) for 3 times; after dehydration, the hearts were embedded in paraffin flat; sections were prepared using a Leica paraffin microtome, with a section thickness of 5 μm, for subsequent experimental investigation.

[0070] The specific testing indicators and operating methods are as follows:

[0071] (1) Animal cardiac ultrasound: First, remove the hair from the chest of the mouse, then place it in an induction box to maintain an anesthesia concentration of 1%-2% (v / v) isoflurane. After the mouse stops moving and its body is in a lateral recumbent position, if it cannot be immediately turned over after being placed in a supine position, place it on the physiological information monitoring platform, and apply physiological saline to its eyes to prevent dryness. Apply conductive glue to the copper plate to obtain its ECG and respiratory physiological information. Then, operate according to the operating procedures of the small animal ultrasound imaging system (Visual Sonics Vevo 3100) to measure cardiac function such as left ventricular ejection fraction and E / E' peak to assess cardiac function. Cardiac dysfunction is the main feature of obesity-related cardiomyopathy, mainly diastolic dysfunction. Figure 4 The results showed that, compared with the obese control group, there was no significant difference in cardiac ejection fraction in the obese overexpression group, but the E / E' ratio was significantly reduced, indicating that myocardial BCKDK overexpression can significantly improve cardiac diastolic dysfunction in mice with obesity-related cardiomyopathy.

[0072] (2) Measurement of mouse heart weight and diameter ratio: After grouping and treating the experimental mice, they were continuously induced for 28 weeks. Then, the mouse hearts were obtained according to the above-mentioned terminal tissue sampling method. The hearts were photographed, and the tibias were cut off to measure the tibia length and calculate the heart-tibia ratio. Cardiac structural remodeling is a typical feature of obesity-related cardiomyopathy, and myocardial hypertrophy is the main manifestation of cardiac structural remodeling. Figure 5 The results from the AC study showed that, compared with the obese control group, the heart weight and heart diameter ratio of the obese overexpression group mice were significantly reduced, indicating that myocardial BCKDK overexpression can improve the occurrence of myocardial hypertrophy phenotype in mice with obesity-related cardiomyopathy.

[0073] (3) WGA staining and cardiomyocyte size determination of mouse heart tissue: Paraffin sections of the heart obtained after the above pathological tissue treatment were subjected to WGA staining. The main steps were: baking at 65℃ for 30 minutes → treatment with xylene (I) for 10 minutes → treatment with xylene (II) for 10 minutes → treatment with anhydrous ethanol (I) for 3 minutes → treatment with anhydrous ethanol (II) for 3 minutes → treatment with 90% ethanol for 1 minute → treatment with 80% ethanol for 1 minute → treatment with 70% ethanol for 1 minute, WGA staining for 30 minutes, washing with PBS for 10 minutes, and image capture using laser confocal microscopy. Cell size was analyzed using ImageJ software. Cardiomyocyte size is direct evidence for evaluating myocardial hypertrophy. Figure 5 The results of the DE study showed that, compared with the obese control group, the size of cardiomyocytes in the obese overexpression group was significantly reduced, demonstrating that myocardial BCKDK overexpression can improve the occurrence of myocardial hypertrophy phenotype in mice with obesity-related cardiomyopathy.

[0074] (4) Sirius Red staining and collagen area ratio determination of mouse heart tissue: The paraffin sections of the heart obtained after the above pathological tissue processing were stained with Sirius Red. The main steps were: baking at 65℃ for 30 minutes → treatment with xylene (I) for 10 minutes → treatment with xylene (II) for 10 minutes → treatment with anhydrous ethanol (I) for 3 minutes → treatment with anhydrous ethanol (II) for 3 minutes → treatment with 90% ethanol for 1 minute → treatment with 80% ethanol for 1 minute → treatment with 70% ethanol for 1 minute → washing with distilled water. The washed sections were immersed in Sirius Red staining solution for 1 hour, and the sections were directly immersed in anhydrous ethanol for differentiation and dehydration. Xylene (I) treatment for 5 minutes → treatment with xylene (II) for 5 minutes, and the sections were mounted with neutral resin for observation. The collagen area was analyzed using ImageJ software. Myocardial fibrosis is a remodeling of the cardiac interstitial tissue characterized by excessive proliferation of cardiac interstitial fibroblasts, excessive collagen deposition and abnormal distribution. It is the main pathological feature of obesity-related cardiomyopathy. Figure 5 The results of the FG study showed that, compared with the obese control group, the proportion of collagen area in the obese overexpression group was significantly reduced, indicating that myocardial BCKDK overexpression can improve the occurrence of myocardial fibrosis phenotype in mice with obesity-related cardiomyopathy.

[0075] (5) Observation of mitochondrial ultrastructure and evaluation of myocardial oxidative stress level by DHE staining: ① Observation of mitochondrial ultrastructure by transmission electron microscopy (TEM): Fresh left ventricular myocardial tissue was taken and cut into pieces of about 1 mm. 3 Small pieces were quickly placed in 2.5% (v / v) glutaraldehyde fixative and fixed overnight at 4°C. After fixation, they were washed with 0.1 mol / L phosphate buffer, fixed with 1% (w / v) osmium tetroxide (using 0.1 mol / L phosphate buffer as solvent), dehydrated with graded ethanol, embedded in resin, ultra-thinly sectioned, and double-stained with uranium acetate and lead citrate. The ultrastructure of cardiomyocyte mitochondria was then observed using transmission electron microscopy. Mitochondrial morphology was assessed using a 5-point scoring system, with the following specific criteria: a score of 4 indicates a cristae content greater than 80%, with clear and intact cristae structure; a score of 3 indicates a cristae content of 60%-80%, with slightly irregular cristae structure; a score of 2 indicates a cristae content of 30%-60%, with obvious structural distortion and interruption of membrane and cristae continuity; a score of 1 indicates a cristae content of 10%-30%, with severely broken or swollen cristae and obvious membrane distortion; and a score of 0 indicates a cristae content less than 10%, with severely damaged membrane structure and almost complete disappearance of cristae. Mitochondrial swelling was also assessed, defined as increased mitochondrial volume accompanied by loss of cristae structural integrity, decreased matrix electron density, and partial rupture of the inner or outer mitochondrial membrane. Figure 6The results showed that in the obese control group, the myocardial mitochondria of mice exhibited significant ultrastructural abnormalities, including obvious swelling, disordered arrangement, and broken or reduced cristae structures. Mitochondrial morphology scores were decreased, and the proportion of swollen mitochondria was increased. In contrast, in the obese overexpression group, the aforementioned mitochondrial damage was significantly reduced; mitochondria were more intact, arranged more regularly, and their cristae structures were better preserved. Mitochondrial morphology scores were increased, and the proportion of swollen mitochondria was decreased, suggesting that cardiomyocyte-specific overexpression of BCKDK can improve mitochondrial ultrastructural damage in mice with obesity-related cardiomyopathy. ② DHE staining to detect oxidative stress levels in myocardial tissue: Freshly frozen heart tissue sections were stained with dihydroethidium (DHE) using standard methods. The simplified procedure was as follows: after the frozen sections were brought to room temperature, they were incubated with DHE working solution under light-protected conditions. After incubation, the sections were gently washed with PBS, and images were acquired under a fluorescence microscope. ImageJ software was used for quantitative analysis of fluorescence intensity. DHE staining can reflect the level of reactive oxygen species in tissues. Figure 6 The results showed that, compared with the obese control group, the fluorescence intensity of DHE in the heart tissue of the obese overexpression group was significantly reduced, suggesting that cardiomyocyte-specific overexpression of BCKDK can reduce the level of oxidative stress in the myocardial tissue of mice with obesity-related cardiomyopathy.

[0076] The above results demonstrate that the AAV9-cTNT-BCKDK formulation can improve myocardial hypertrophy, fibrosis, and diastolic dysfunction in mice with obesity-related cardiomyopathy, and reduce mitochondrial damage and oxidative stress levels. This implementation suggests that the AAV9-cTNT-BCKDK formulation can serve as a novel strategy for the prevention and treatment of obesity-related cardiomyopathy.

[0077] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The use of BCKDK, nucleic acid molecules encoding BCKDK, expression vectors or delivery systems containing said nucleic acid molecules in the preparation of drugs for the prevention or treatment of obesity-related cardiomyopathy.

2. The application according to claim 1, characterized in that, The expression vector or delivery system is an adeno-associated virus vector, and the adeno-associated virus vector mediates the specific expression of BCKDK in cardiomyocytes through a cardiomyocyte-specific promoter.

3. The application according to claim 2, characterized in that, The method for preparing the adeno-associated virus vector includes: cloning the BCKDK gene into a viral vector to obtain a BCKDK expression vector; co-transfecting the expression vector and helper packaging plasmid into AAV-293 cells; culturing the cells and then concentrating, purifying, and ultrafiltration desalting to obtain an adeno-associated virus vector overexpressing the BCKDK gene.

4. The application according to claim 2, characterized in that, The element sequence of the expression vector in the adeno-associated virus vector is cTnT-BCKDK-3×FLAG-P2A-GdGreen-tWPA.

5. The application according to claim 1, characterized in that, The BCKDK is selected from one of human BCKDK, rat BCKDK, and mouse BCKDK, or the BCKDK is a functional variant, truncated form, or functional fragment thereof; and the obesity-related cardiomyopathy may further progress to obesity-related heart failure with preserved ejection fraction.

6. Application of BCKDK or nucleic acid molecules encoding BCKDK as drug targets for screening drugs to prevent or treat obesity-related cardiomyopathy.

7. Application of promoters that can upregulate BCKDK expression in the preparation of drugs for the prevention or treatment of obesity-related cardiomyopathy.

8. The application according to claim 7, characterized in that, The promoters include viral vectors, non-viral vectors, small molecule activators, nucleic acid drugs, peptides, or nanodelivery systems.

9. The application according to claim 7, characterized in that, The promoter is an adeno-associated virus vector, and the adeno-associated virus vector mediates the specific expression of BCKDK in cardiomyocytes through a cardiomyocyte-specific promoter.

10. A drug for the prevention or treatment of obesity-related cardiomyopathy, characterized in that, The drug comprises an adeno-associated virus vector that specifically overexpresses the BCKDK gene in cardiomyocytes.