Use of mqo gene mutant in preparation of l-lysine

By mutating and overexpressing the mqo gene of Corynebacterium glutamicum, a recombinant strain was constructed, which solved the problem of insufficient L-lysine production capacity of microbial strains, achieved efficient production and cost control, and promoted the industrialization of L-lysine.

CN122168488APending Publication Date: 2026-06-09NINGXIA EPPEN BIOTECH CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NINGXIA EPPEN BIOTECH CO LTD
Filing Date
2024-12-06
Publication Date
2026-06-09

Smart Images

  • Figure BDA0005174270840000112
    Figure BDA0005174270840000112
  • Figure BDA0005174270840000152
    Figure BDA0005174270840000152
  • Figure BDA0005174270840000161
    Figure BDA0005174270840000161
Patent Text Reader

Abstract

The application discloses application of an mqo gene mutant in preparation of L-lysine, and specifically discloses a protein mqo with an amino acid sequence as shown in SEQ ID No. 4 G419D and an encoding gene and application thereof. The application constructs a recombinant bacterium with a point mutation (G1256A) and a recombinant bacterium with overexpression of an mqo G1256A gene, and experimental results show that point mutation of the mqo gene or overexpression of the mqo G1256A gene in corynebacterium glutamicum can significantly improve the yield of L-lysine. The application successfully reengineers an L-lysine production strain through genetic engineering technology, and improves the production capacity of the strain. Preparation of L-lysine by using the genetic engineering strain constructed according to the application can not only improve production efficiency, but also effectively control production cost, provides strong support for sustainable development of the L-lysine industry, and has important significance for promoting the industrialization process of L-lysine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of mqo gene mutants in the preparation of L-lysine. Background Technology

[0002] Lysine, chemically known as 2,6-diaminohexanoic acid, is one of the essential amino acids for humans and mammals. As a basic essential amino acid, it cannot be synthesized by the body and must be obtained from food. Lysine is mainly found in animal-based foods and legumes; cereals contain very little lysine and it is easily destroyed during processing, hence it is considered the first limiting amino acid. Only the L-form of lysine is absorbed by the body. L-lysine has positive nutritional significance in promoting human growth and development, enhancing immunity, antiviral activity, promoting lipid oxidation, and alleviating anxiety. It also promotes the absorption of certain nutrients and can work synergistically with some nutrients to better exert their physiological functions. L-lysine is widely used in food, animal feed, pharmaceuticals, new chemical materials, and agriculture. In the feed industry, L-lysine is in extremely high demand due to its significant role in promoting appetite, growth, and improving feed utilization. L-Lysine plays a vital role in the food industry. Adding L-lysine to food effectively enhances its nutritional value and meets the body's lysine requirements, particularly beneficial for children, the elderly, and malnourished individuals, promoting growth and development and strengthening the body. In the pharmaceutical field, L-lysine is often used as an adjunct therapy for lysine deficiency and malnutrition. It also increases the permeability of the blood-brain barrier, facilitating drug entry into brain cells and offering some support in the treatment of brain diseases. Furthermore, in the cosmetics industry, L-lysine acts as a moisturizer and antioxidant, improving the quality and efficacy of cosmetics. In agriculture, it serves as a plant growth regulator, promoting plant growth and development. Clearly, L-lysine, due to its unique chemical properties and biological activity, demonstrates significant application value across numerous fields.

[0003] Currently, the main method for producing L-lysine is microbial fermentation. Therefore, various studies are underway to develop highly efficient microbial strains for L-lysine production. For example, this involves mutating key rate-limiting enzymes involved in L-lysine synthesis in microbial strains to remove feedback inhibition; overexpressing or mutating key genes involved in L-lysine synthesis to increase gene activity; or deleting unwanted genes (byproducts or toxin-related genes affecting cell growth, etc.) from microbial strains. However, despite some progress, with the increasing demand for L-lysine year by year, extensive research is still needed to increase the L-lysine production capacity of microbial strains. Exploring and identifying genes that can effectively increase L-lysine yield, modifying production bacteria at the molecular level, and continuously developing high-yield strains have long been a need in the industry. This not only improves production efficiency but also effectively controls production costs, providing strong support for the sustainable development of the L-lysine industry and playing a significant role in promoting the industrialization of L-lysine. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to increase the yield of microbial L-lysine through genetic modification. The technical problem to be solved is not limited to the technical subject matter described herein. Other technical subjects not mentioned herein can be clearly understood by those skilled in the art through the following description.

[0005] To address the aforementioned technical problems, the present invention first provides recombinant Corynebacterium glutamicum, which includes Corynebacterium glutamicum obtained by enhancing the protein activity of Corynebacterium glutamicum by including the amino acid sequence shown in SEQ ID No. 4.

[0006] Furthermore, the recombinant Corynebacterium glutamicum includes any one of the following:

[0007] (1) Recombinant Corynebacterium glutamicum obtained by overexpressing a gene encoding a protein with an amino acid sequence as shown in SEQ ID No. 4 in Corynebacterium glutamicum;

[0008] (2) Recombinant Corynebacterium glutamicum obtained by mutating the protein with the amino acid sequence of SEQ ID No.2 in Corynebacterium glutamicum, wherein the mutation includes mutating the amino acid at position 419 of SEQ ID No.2 to aspartic acid;

[0009] (3) Recombinant Corynebacterium glutamicum obtained by mutating the DNA molecule with the nucleotide sequence of SEQ ID No.1 in Corynebacterium glutamicum, wherein the mutation includes mutating guanine at position 1256 of SEQ ID No.1 to adenine.

[0010] This invention also provides a protein, which may be named mqoG419D The protein mqo G419D Including any of the following:

[0011] A1) The amino acid sequence contains the protein shown in SEQ ID No. 4;

[0012] A2) A protein that has more than 98% identity with and has the same function as the protein shown in A1) obtained by substituting, deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 4.

[0013] A3) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0014] The protein mqo G419D A mutation occurred at amino acid position 419 relative to the reference sequence (SEQ ID No. 2, wild-type protein mqo), the mutation being a change from glycine (G) to aspartic acid (D).

[0015] The substitution described in A2) can be a conservative substitution.

[0016] The connection described in A3) can be a direct connection via peptide bond or a connection via a linker.

[0017] The tags described in A3) include, but are not limited to: GST (glutathione thioredoxin) tag protein, Trx (thioredoxin) tag protein, nitrogen utilization substrate A (NusA) tag protein, His tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA (influenza hemagglutinin) tag protein, Myc tag protein, LacZ tag protein, CBD (cellulose-binding domain) tag protein, phage T7 protein kinase (T7PK) tag protein, GFP (green fluorescent protein), CFP (cyan fluorescent protein), YFP (yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein. Those skilled in the art know how to select appropriate tag proteins according to the desired purpose.

[0018] The present invention also provides biomaterials, said biomaterials comprising any of the following:

[0019] B1) encodes the protein mqo G419D Nucleic acid molecules;

[0020] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0021] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0022] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0023] B5) A recombinant host cell containing the nucleic acid molecule described in B1), or a recombinant host cell containing the expression cassette described in B2), or a recombinant host cell containing the recombinant vector described in B3).

[0024] Furthermore, all of the biological materials can express the nucleic acid molecules described in B1).

[0025] In the aforementioned biological materials, the nucleic acid molecule described in B1) includes any of the following:

[0026] C1) The coding sequence contains a DNA molecule as shown in SEQ ID No. 3;

[0027] C2) The nucleotide sequence contains a DNA molecule as shown in SEQ ID No. 3.

[0028] The DNA molecule shown in SEQ ID No. 3 is the mutant gene mqo. G1256A The coding sequence (CDS) of the protein MQO, whose amino acid sequence is SEQ ID No. 4, is given. G419D .

[0029] The nucleic acid molecules described in this article may also include nucleic acid molecules obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID No. 3.

[0030] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as mRNA or hnRNA.

[0031] The protein mqo is encoded G419D The sequence of the nucleic acid molecule can be either the one encoding the protein mqo or... G419D The CDS sequence can also be the sequence encoding the protein mqo. G419D The cDNA sequence may also be the one encoding the protein mqo. G419D The genomic DNA sequence.

[0032] The recombinant vectors described herein can be constructed using expression vectors. The structure of expression vectors is well known to those skilled in the art. Expression vectors typically contain elements required for target gene expression, such as promoters, multiple cloning sites, terminators, and ribosome binding sites. They may also contain selection marker genes (such as kanamycin resistance gene kanr, neomycin resistance gene neo, hygromycin resistance gene hyg, chloramphenicol resistance gene cat, streptomycin resistance gene str, bleomycin resistance gene ble, etc.). Expression vectors can be constructed using any method known in the art (such as recombination technology, synthesis technology, etc.) or can be commercially available. For example, in one or more embodiments of the present invention, the expression vector is pK18mobsacB or pXMJ19.

[0033] The recombinant vector described in this article may be the mqo gene or mqo G1256A Gene expression or overexpression vectors (including homologous recombination vectors). Further, the recombinant vectors described herein may be recombinant vectors containing the DNA molecule shown in SEQ ID No. 3.

[0034] The recombinant microorganisms mentioned in this article may be those that express or overexpress the mgo gene or mgo G1256A Recombinant microorganisms containing genes. Further, the recombinant microorganisms described herein may be recombinant microorganisms containing the DNA molecule shown in SEQ ID No. 3.

[0035] In one or more embodiments of the present invention, the recombinant microorganisms include L-mqo-1 to L-mqo-5 and Y-mqo-1 to Y-mqo-5. L-mqo-1 may be a recombinant bacterium obtained by point mutation of the wild-type mqo gene (SEQ ID No. 1) using *Corynebacterium glutamicum* YPLys01 as the starting bacterium; Y-mqo-1 may be a recombinant bacterium obtained by point mutation of the wild-type mqo gene (SEQ ID No. 1) using *Corynebacterium glutamicum* ATCC13032 as the starting bacterium; L-mqo-2 and L-mqo-3 may be recombinant bacteriums that overexpress the mqo gene and mqo gene in their genomes, respectively, using *Corynebacterium glutamicum* YPLys01 as the starting bacterium. G1256A The recombinant bacteria obtained from the gene; Y-mqo-2 and Y-mqo-3 can be derived from wild-type Corynebacterium glutamicum ATCC13032, by overexpressing the mqo gene and mqo gene in their genomes, respectively. G1256A The recombinant bacteria obtained from the gene; L-mqo-4 and L-mqo-5 can be derived from Corynebacterium glutamicum YPLys01 as the starting strain, by overexpressing the mqo gene and mqo gene on the plasmid, respectively. G1256ARecombinant bacteria obtained from genes are those in which foreign genes are overexpressed extrachromosomally via plasmids; Y-mqo-4 and Y-mqo-5 can be derived from wild-type Corynebacterium glutamicum ATCC13032, with the mqo gene and mqo gene overexpressed on plasmids, respectively. G1256A Recombinant bacteria obtained from genes are those in which foreign genes are overexpressed outside the chromosome by plasmids carrying foreign genes.

[0036] The present invention also provides the use of the recombinant Corynebacterium glutamicum, the protein mqoG419D, or the biomaterial in any of the following:

[0037] Application of E1 in regulating the production of microbial L-lysine;

[0038] Application of E2 in the preparation of L-lysine;

[0039] Application of E3 in the construction of genetically engineered bacteria that produce L-lysine.

[0040] The regulation can be increased (upward adjustment) or decreased (downward adjustment).

[0041] Furthermore, the regulation of microbial L-lysine production can be achieved by increasing (upregulating) or decreasing (downregulating) the accumulation of L-lysine in microorganisms (i.e., promoting or inhibiting the biosynthesis of L-lysine).

[0042] This invention also provides a method for increasing the yield of L-lysine in a target microorganism or for preparing L-lysine, the method comprising increasing the protein mqo in the target microorganism. G419D The content and / or activity of L-lysine were obtained from microorganisms that produced a higher yield of L-lysine than the target microorganism.

[0043] In the above method, the step of increasing the protein mqo in the target microorganism G419D The content and / or activity of the protein mqo in the target microorganism includes increasing the content of the protein mqo in the target microorganism. G419D This is achieved by controlling the expression level of the coding gene.

[0044] Furthermore, the method of increasing the protein mqo in the target microorganism G419D The expression level of the coding gene can be achieved through at least one of the following methods:

[0045] (1) Increase the protein mqo G419D The copy number of the coding gene (e.g., introducing a single or multiple copy of the coding gene into the target microorganism);

[0046] (2) The protein mqo G419D The encoding gene is expressed under the drive of a strong promoter;

[0047] (3) Increase the protein mqo G419D The regulatory elements of the encoding gene are used to cause overexpression, including enhancer elements, elements that improve mRNA stability, elements that improve translation efficiency, and / or elements that improve protein secretion.

[0048] (4) Increase the protein mqo G419D The ribosome binding site of the gene encoding it;

[0049] (5) The protein mqo G419D Codon optimization is performed on the encoding genes;

[0050] (6) By altering epigenetic modifications such as DNA methylation or histone acetylation, genes (the protein mqo) are upregulated. G419D The expression of the encoding gene.

[0051] In the above method, the step of increasing the protein mqo in the target microorganism G419D The expression level of the encoding gene includes the expression level of the protein mqo G419D The encoding gene is introduced into the target microorganism to achieve this.

[0052] Furthermore, the protein mqo G419D The encoding gene can be any of the following:

[0053] F1) The coding sequence contains a DNA molecule as shown in SEQ ID No. 3;

[0054] The F2 nucleotide sequence contains a DNA molecule as shown in SEQ ID No. 3.

[0055] Furthermore, the method for increasing the yield of L-lysine from the target microorganism or for preparing L-lysine may include the following steps:

[0056] (1) Construct a structure containing the protein mqo encoded by the protein. G419D Recombinant expression vectors of nucleic acid molecules (e.g., SEQ ID No. 3);

[0057] (2) Introduce the recombinant expression vector constructed in step (1) into the target microorganism;

[0058] (3) Recombinant microorganisms with higher L-lysine production than the target microorganism were obtained through screening and identification.

[0059] Furthermore, the method may also include: culturing the recombinant microorganism in a culture medium and collecting the L-lysine from the culture.

[0060] The culture can be carried out according to conventional methods in the art, including but not limited to plate culture, shake flask culture, batch culture, continuous culture and fed-batch culture, and various culture conditions such as temperature, time and pH of the culture medium can be appropriately adjusted according to the actual situation.

[0061] Furthermore, the methods of introduction include, but are not limited to: chemical conversion methods (such as Ca ion-induced conversion, polyethylene glycol-mediated conversion, or metal cation-mediated conversion) or physical conversion methods (such as electroporation conversion).

[0062] The present invention also provides a method for increasing the yield of L-lysine in a target microorganism or for preparing L-lysine, the method comprising mutating a protein in the target microorganism with the amino acid sequence SEQ ID No. 2 to obtain a microorganism with a higher yield of L-lysine than the target microorganism, wherein the mutation comprises mutating the amino acid at position 419 of SEQ ID No. 2 to aspartic acid.

[0063] The present invention also provides a method for increasing the yield of L-lysine in a target microorganism or for preparing L-lysine, the method comprising mutating the DNA molecule of the nucleotide sequence SEQ ID No.1 in the target microorganism to obtain a microorganism with a higher yield of L-lysine than the target microorganism, wherein the mutation comprises mutating guanine at position 1256 of SEQ ID No.1 to adenine.

[0064] Although homologous recombination technology is used to mutate the DNA molecule with the nucleotide sequence SEQ ID No. 1 in the target microorganism in one or more embodiments provided in this invention, the invention is not limited to this specific method. Those skilled in the art can use other known methods such as gene editing technology or site-directed mutagenesis technology (including oligonucleotide primer-mediated site-directed mutagenesis, PCR-mediated site-directed mutagenesis, and cassette mutagenesis, etc.) to mutate DNA molecules, and these methods can also be used in this invention. These alternative methods do not depart from the scope of this invention, and this invention should include these alternative methods.

[0065] The present invention also provides a method for preparing L-lysine, the method comprising using the recombinant Corynebacterium glutamicum described herein to prepare L-lysine.

[0066] Furthermore, the method can be used to prepare L-lysine by fermentation.

[0067] In this article, the microorganisms mentioned include Corynebacterium glutamicum.

[0068] The present invention also provides the protein mqo G419DThe application of the biological material or the recombinant Corynebacterium glutamicum in the preparation of food, cosmetics, pharmaceuticals or feed containing L-lysine.

[0069] Using the mqo described in this invention G1256A Genetically constructed recombinant microorganisms or recombinant cells can be used to produce a variety of products, including but not limited to lysine, valine, glutamic acid, glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutarate, citric acid, ornithine, and / or citrulline.

[0070] Microbial strains are the core of the fermentation industry, and there has long been a demand for high-yield strains in the industry. After years of continuous research and practice, the inventors of this invention first screened and identified the modified gene—the mqo gene—and then randomly mutated the mqo gene, finally identifying mutation sites that could enhance gene expression activity. This invention uses *Corynebacterium glutamicum* YPLYS01 and *Corynebacterium glutamicum* ATCC13032 as starting strains, performs point mutations on the mqo gene, constructs a recombinant strain with a point mutation (G1256A), and constructs a strain that overexpresses the mutant gene mqo. G1256A The recombinant bacteria were constructed and fermented. The results showed that point mutation (G1256A) in the coding region of the mqo gene and overexpression of mqo or mqo[…]. G1256A Both gene mutations significantly increased L-lysine production (P<0.01). Point mutations (G1256A) in the coding region of the mqo gene and overexpression of mqo or mqo[4] in Corynebacterium glutamicum ATCC13032 significantly increased L-lysine production (P<0.01). G1256A Both genes significantly increased L-lysine production (P<0.05).

[0071] This invention successfully modified L-lysine-producing strains using genetic engineering technology, thereby increasing the strain's production capacity. The genetically engineered strains constructed in this invention can significantly promote the accumulation of L-lysine and increase its yield. This invention cultivates high-yield, high-quality strains suitable for industrial production, which is beneficial to promoting the industrial production of L-lysine.

[0072] Terminology Definition

[0073] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, to better understand this invention, definitions and explanations of relevant terms are provided below.

[0074] The term "expression cassette" generally refers to a nucleic acid construct containing sufficient nucleic acid elements to express a target gene. A typical expression cassette includes a promoter, a multiple cloning site (MCS), and a terminator. Expression cassettes may also include the target gene, marker genes (such as TK, DHFR, CAT, and NEO genes), ribosome recognition and binding sites (SDs), transcription factor binding sites (TFBSs), enhancers, silencers, repressors, introns, poly(A) signal sequences, and / or mRNA splicing signal sequences. Elements within an expression cassette can be directly linked or indirectly linked through adapters.

[0075] The term "vector" generally refers to a vector capable of delivering exogenous DNA or a target gene into host cells for amplification and / or expression. This vector can be a cloning vector or an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material they carry to be amplified and / or expressed within the host cells. Those skilled in the art can select appropriate vectors based on the purpose of genetic engineering and the properties of the recipient cells. The vectors include, but are not limited to: plasmids, phages (such as λ phage or M13 phage), cosmids (i.e., Cosmids), phagemids, shuttle vectors (such as yeast expression vectors), Ti plasmids, artificial chromosomes (such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), P1 artificial chromosomes (PAC), or Ti plasmid artificial chromosomes (TAC)), and viral vectors (such as baculovirus vectors, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, poxviruses, papillomaviruses, papillomaviruses (such as SV40), and herpesviruses (such as herpes simplex virus)). A vector may contain multiple elements controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, the vector may also contain a replication initiation site.

[0076] The term "microorganism" typically includes bacteria, viruses, fungi, actinomycetes, rickettsiae, mycoplasma, chlamydia, spirochetes, algae, etc. For example, the bacteria mentioned can originate from the genera *Corynebacterium* (e.g., *Corynebacterium glutamicum*, *Corynebacterium pekinensis*, *Corynebacterium obliterans*, etc.), *Brevibacterium* (e.g., *Brevibacterium lactis*, *Brevibacterium flavum*, *Brevibacterium phagenum*, etc.), *Escherichia* (e.g., *Escherichia coli*), *Erwinia*, *Agrobacterium* (e.g., *Agrobacterium tumefaciens*), *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, and *Bacillus* (e.g., *Bacillus*). The viruses may include rotaviruses, baculoviruses, retroviruses (such as lentiviruses), adenoviruses, adeno-associated viruses, poxviruses, papillomaviruses, influenza viruses, papillomaviruses (such as SV40), and herpesviruses (such as herpes simplex virus). The fungi may be derived from genera such as *Saccharomyces* sp. (e.g., *Saccharomyces cerevisiae*, *Candida*, *Methanol*, *Pichia pastoris*), *Fusarium* sp., *Rhizoctonia* sp., *Verticillium* sp., *Penicillium* sp., *Aspergillus* sp., and *Cephalosporium* sp. The actinomycetes may be derived from genera such as *Streptomyces* sp. (e.g., *Streptomyces*). The algae mentioned can be from the phylum Cyanophyta (such as cyanobacteria), genera such as *Fucus* sp., *Achnanthes* sp., *Amphiprora* sp., *Amphora* sp., *Ankistrodesmus* sp., *Asteromonas* sp., and *Boekelovia* sp., etc. The microorganisms mentioned in this article can be any microorganism capable of synthesizing the target amino acid.

[0077] The term "host cell," also known as the recipient cell, generally refers to any type of cell that can be used to introduce a vector, such as plant and animal cells. The term "host cell" can be understood not only to the specific recipient cell but also to its offspring, which, due to natural, accidental, or intentional mutations and / or alterations, may not necessarily be identical to the original parent cell but are still included within the scope of the host cell. Suitable host cells are those known in the art, including: plant cells such as Arabidopsis thaliana, tobacco (Nicotiana tabacum), maize (Zea mays), rice (Oryza sativa), wheat (Triticum aestivum), etc., but not limited to these; animal cells such as mammalian cells (e.g., Chinese hamster ovary cells (CHO cells), Chinese hamster ovary cell subline (CHO-K1 cells), African green monkey kidney cells (Vero cells), SV40-transformed African green monkey kidney cells (COS cells), young hamster kidney cells (BHK cells), mouse breast cancer cells (C127 cells), human embryonic kidney cells (HEK293 cells), human HeLa cells, fibroblasts, bone marrow cell lines, T cells or NK cells, etc.), avian cells (e.g., chicken or duck cells), and amphibian cells (e.g., Xenopus laevis cells or Andrias davidianus cells). The host cells described herein can be any biological cell capable of synthesizing the target amino acid, including but not limited to davidianus cells, fish cells (e.g., grass carp, carp, rainbow trout, or catfish cells), insect cells (e.g., Sf21 cells, Sf-9 cells, or Hi-5 cells).

[0078] The term "recombinant vector" generally refers to a recombinant DNA molecule constructed by linking a foreign target gene to a vector in vitro. It can be constructed in any suitable way, as long as the constructed recombinant vector can carry the foreign target gene into the recipient cell and provide the foreign target gene with the ability to replicate, integrate, amplify and / or express in the recipient cell.

[0079] The term "recombinant microorganism" generally refers to a recombinant microorganism whose genes have been manipulated and modified to obtain a functionally altered microorganism. This can be achieved by introducing a foreign target gene or recombinant vector into the target microorganism, or by directly editing the endogenous genes of the target microorganism.

[0080] The term "recombinant host cell" generally refers to a recombinant host cell whose genes have been manipulated and modified to obtain a recombinant host cell with altered function. This can include introducing a foreign target gene or recombinant vector into the host cell, or directly editing the host cell's endogenous genes.

[0081] The term "linkage" generally refers to the association of two or more molecules. Linkages can be covalent or non-covalent. The linkages described herein can be direct peptide bonds or linkages via linkers (connectors).

[0082] The term "conservative substitution" generally refers to the replacement of one amino acid residue with another amino acid residue in a side chain that has similar physicochemical properties. For example, conservative substitutions can occur between hydrophobic side chain amino acid residues (e.g., Met, Ala, Val, Leu, and Ile), between neutral hydrophilic side chain residues (e.g., Cys, Ser, Thr, Asn, and Gln), between acidic side chain residues (e.g., Asp, Glu), between basic side chain amino acids (e.g., His, Lys, and Arg), or between aromatic side chain residues (e.g., Trp, Tyr, and Phe). It is known in the art that conserved substitutions generally do not cause significant changes in protein conformation and structure, and essentially do not alter the protein's biological activity. Conservative substitutions in the protein sequence that are expected to have only a minimal or no effect on protein structure or function can be readily designed by those skilled in the art.

[0083] The term "identity" generally refers to the degree to which two (nucleotide or amino acid) sequences have identical residues at the same position in an alignment, and is usually expressed as a percentage. The identity described herein can refer to the identity of an amino acid sequence or a nucleotide sequence. Two copies having completely identical sequences have 100% identity. Those skilled in the art will recognize that the identity of an amino acid or nucleotide sequence can be determined using identity search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, the identity of an amino acid sequence can be calculated by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Perresidue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and then performing a search to obtain the identity value (%). Alternatively, it can be determined using sequence analysis software such as CLC Main Workbench and MegAlign™, for example, using the computer program BLAST with default parameters, especially BLASTP or TBLASTN. The 98% or higher identity mentioned in this article can mean at least 98% or 99% or higher identity.

[0084] The term "promoter" typically refers to the site where RNA polymerase specifically recognizes and binds to the transcription start site of a structural gene. It is located upstream of the transcription start site, has strict directionality, and initiates transcription. Because the strength of the promoter determines the efficiency of transcription, different types of promoters can be used in genetic engineering to regulate the expression of key genes. Those skilled in the art know that constitutive strong promoters can be used to overexpress the target gene. To further enhance the expression of the target gene, multiple promoters can be used in tandem.

[0085] The term "enhancer" generally refers to a DNA sequence that enhances gene transcription activity, either upstream or downstream of the structural gene or located within an intron.

[0086] The term "codon optimization" generally refers to a technique that improves protein expression levels in an organism by increasing the translation efficiency of target genes. Codon optimization typically involves redesigning genes by avoiding rare codons, utilizing preferred codons, simplifying mRNA secondary structure, optimizing repetitive sequences, eliminating restriction enzyme sites, and adjusting GC content, in order to improve translation efficiency and thus increase protein expression levels.

[0087] The term "regulatory element" usually refers to a DNA molecule that has gene regulatory activity.

[0088] The term "overexpression" generally refers to increasing or upregulating the level and / or activity of a target protein or gene. Overexpression can be achieved through regulation at the gene level (such as gene replication, transcription, translation, post-transcriptional modification, and / or post-translational modification) or by promoting or increasing the content, activity, and / or function of the target protein at the protein level. There are no particular limitations on the means of overexpression, and many methods for achieving overexpression are well known to those skilled in the art. For example, the nucleic acid molecule to be overexpressed or the nucleic acid molecule encoding the protein to be overexpressed can be placed under the control of a strong promoter; the copy number of one or more genes encoding the protein described in this invention can be increased; or the strength of the ribosome binding site or Kozak sequence can be increased, mRNA stability can be improved, codon usage can be altered, or repressive elements can be knocked out, etc.

[0089] The term "introduction" generally refers to the transfer of a foreign gene into a recipient cell, such as a eukaryotic or prokaryotic recipient cell. There are no particular limitations on the method of introduction; any known transformation method that can transfer the target gene (such as the DNA molecule of this invention) into the recipient cell is acceptable. The introduced DNA molecule can be a single copy or multiple copies. Introduction can involve integrating the foreign gene into the host chromosome or expressing it extrachromosomally using a plasmid. The methods of introduction may include any of the following: (1) introducing the target gene or a recombinant vector containing the target gene into the host bacteria through chemical transformation (such as Ca ion-induced transformation, polyethylene glycol-mediated transformation, or metal cation-mediated transformation) or physical transformation (such as electroporation transformation). (2) transducing the target gene into the host bacteria through bacteriophage transduction. (3) Transferring the target gene into plant recipient cells through physical or chemical methods, such as gene gun method (also known as microparticle bombardment method or biological missile method), chemical stimulation method, electric shock method, liposome-mediated method, microinjection method, laser microbeam method, pollen tube channel method, ultrasound method, air gun method and eddy current method, etc. (4) Transferring the target gene into plant recipient cells using vectors, such as Agrobacterium Ti plasmid vector (including Ti plasmid-derived vectors such as co-integration vector system and binary vector system) mediated method (Agrobacterium-mediated method), plant virus vector-mediated transformation method, etc.

[0090] The term "mutation" generally refers to a change in the amino acid sequence or nucleotide sequence. It can include changes in the composition or arrangement of base pairs in the structure of a gene, such as point mutations caused by a single base change, or deletions, duplications, and insertions of multiple bases. It can also include substitutions, deletions, and insertions (additions) of one or more amino acid residues in a protein.

[0091] The term "site-directed mutagenesis" generally refers to altering one or more bases in a gene through site-directed mutation, resulting in a change in the amino acid composition of the corresponding protein. Site-directed mutagenesis methods include oligonucleotide primer-mediated site-directed mutagenesis, PCR-mediated site-directed mutagenesis, and cassette mutagenesis.

[0092] The term "gene editing technology" generally refers to the ability to alter specific gene sequences within any cell, including somatic cells, causing base deletions, duplications, insertions, frameshift mutations, and replacements or knockouts of target genes. This allows for the substitution, deletion, splicing, and single-base alterations of the genome sequence—essentially, the technology to arbitrarily "edit" the genome or the sequence of a specific gene. Gene editing includes zinc finger ribozyme knockout technology, TALEN gene editing technology, and CRISPR gene editing technology.

[0093] The term "culture" generally refers to a liquid or solid product (all substances within the culture container) that has grown a microbial community after artificial inoculation and cultivation. It is a product obtained by growing and / or amplifying microorganisms; it can be a biologically pure culture of microorganisms, or it can contain a certain amount of culture medium, metabolites, or other components produced during the cultivation process.

[0094] The term "comprising" is not intended to be restrictive, but rather inclusive and implies the presence of other elements besides those listed, and can be interpreted as "including but not limited to". The term "comprising" also encompasses the terms "consisting of" and "substantially consisting of". In this document, the terms "comprising" and "including" are used interchangeably.

[0095] Preservation Instructions

[0096] Bacterial strain name: Corynebacterium glutamicum

[0097] Latin name: Corynebacterium glutamicum

[0098] Classification and nomenclature: Corynebacterium glutamicum

[0099] Strain number: YPLys01

[0100] Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee

[0101] Abbreviation of depositary institution: CGMCC

[0102] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing

[0103] Date of preservation: November 26, 2021

[0104] Registration number at the Preservation Center: CGMCC No. 23982. Detailed Implementation

[0105] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0106] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0107] The Corynebacterium glutamicum ATCC13032 used in the following examples is referred to as Corynebacterium glutamicum ATCC13032. It was purchased from the American Type Culture Collection (ATCC) and its strain number is ATCC13032.

[0108] The Corynebacterium glutamicum YPLys01 in the following examples is referred to as Corynebacterium glutamicum YPLys01. It is deposited at the China General Microbiological Culture Collection Center (CGMCC) on November 26, 2021, with the collection registration number CGMCC No. 23982.

[0109] The primers used in the following examples were all synthesized by Invitrogen Shanghai.

[0110] The pK18mobsacB plasmid used in the following examples was purchased from Biovector, catalog number BiovectorpK18mobSacB, and is also referred to as vector pK18 in this document.

[0111] The carrier pXMJ19 used in the following embodiments was purchased from Biovector, product number Biovector pXMJ19.

[0112] Example 1: Constructing an mqo containing point mutations G1256A Recombinant vectors of gene coding regions

[0113] Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were designed and synthesized to amplify the coding region of the mqo gene. A point mutation was introduced into the coding region (SEQ ID No. 1) of the mqo gene in Corynebacterium glutamicum YPLys01 via allelic substitution. The point mutation involved replacing guanine (G) with adenine (A) at position 1256 of the mqo gene nucleotide sequence (SEQ ID No. 1), resulting in the DNA molecule shown in SEQ ID No. 3 (the mutated mqo gene, named mqo). G1256A ).

[0114] The DNA molecule shown in SEQ ID No. 1 encodes a protein with the amino acid sequence of SEQ ID No. 2 (the protein name is mqo). The DNA molecule shown in SEQ ID No. 3 encodes a mutant protein with the amino acid sequence of SEQ ID No. 4 (the mutant protein name is mqo). G419D The mutant protein mqoG419D The aspartic acid (D) at position 419 in the amino acid sequence (SEQ ID No. 4) is derived from glycine (G) by mutation.

[0115] The recombinant vector was constructed using NEBuilder assembly technology, and the primers were designed as follows:

[0116] (The underlined nucleotide sequence is the sequence on vector pK18);

[0117] (The bases in bold indicate the mutation positions);

[0118] (The bases in bold indicate the mutation positions);

[0119] (The underlined nucleotide sequence is the sequence on vector pK18).

[0120] Construction method: Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P1 / P2 and P3 / P4, respectively, to obtain two DNA fragments (mqoUp and mqoDown) containing mutant bases, with sizes of 852bp and 908bp, respectively, of the mqo gene coding region.

[0121] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0122] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 60℃ annealing for 15 s; 72℃ extension for 30 s; 30 cycles), 72℃ over-extension for 5 min.

[0123] The two DNA fragments (mqoUp and mqoDown) were separated and purified by agarose gel electrophoresis. They were then ligated with the pK18mobsacB plasmid, which had been digested with Xba I / BamHI and purified, using NEBuilder enzyme (purchased from NEB) at 50°C for 30 min. The ligation product was transformed into DH5α competent cells, and the resulting single clones were identified by PCR using primers P1 / P4. The clones that amplified a 1731 bp fragment (SEQ ID No. 5) were considered positive for the recombinant vector pK18-mqo. G1256AThe vector was sent to a sequencing company for sequencing and identification, and the recombinant vector pK18-mqo containing the correct point mutation (G1256A) was then analyzed. G1256A Save for future use.

[0124] Recombinant vector pK18-mqo G1256A The presence of the mutation site (G1256A) will cause the guanine (G) at position 1256 of the coding region of the mqo gene in Corynebacterium glutamicum YPLys01 and wild-type Corynebacterium glutamicum ATCC13032 to be mutated to adenine (A), which will ultimately lead to the glycine (G) at position 419 of the encoded protein being mutated to aspartic acid (D).

[0125] Recombinant vector pK18-mqo G1256A The recombinant vector containing kanamycin resistance marker is obtained by replacing the fragment (AGGATCCCC) between the Xba I and / or BamHI restriction sites in the pK18mobsacB vector with the DNA fragment shown in SEQ ID No. 5, while keeping the other sequences of the pK18mobsacB vector unchanged. The recombinant vector pK18-mqo G1256A Contains the mutant gene mqo shown in SEQ ID No. 3 G1256A The mutation site (G1256A).

[0126] Example 2: Constructing a gene mqo G1256A engineered strains

[0127] The allelic substitution plasmid (pK18-mqo) constructed in Example 1 was used. G1256AThe bacteria were transformed into *Corynebacterium glutamicum* YPLys01 (which, according to sequencing, retains the wild-type mqo gene coding region on its chromosome) and wild-type *Corynebacterium glutamicum* ATCC13032 by electroporation, and then cultured at 30°C for 40 h on solid medium plates containing kanamycin (50 mg / L) (the composition of the medium is shown in Table 1). Single colonies were identified using primers M13F (5'-GTAAAACGACGGCCAGT-3') / P4 from Example 1. Strains that amplified a band of approximately 1731 bp were considered positive strains. Positive strains were streaked on solid medium containing 15% sucrose (this medium was obtained by increasing the sucrose concentration in the medium in Table 1 to 150 g / L) for 40 h to eliminate the PK18 plasmid. Single colonies generated from the culture were screened on solid medium plates containing and without kanamycin. Strains that grew on the kanamycin-free medium but not on the kanamycin-containing medium were further amplified by PCR using primers P1 / P4. The obtained DNA fragment (1731 bp) was sequenced. Through sequence alignment, the strain with a mutation (G1256A) in the mqo gene sequence, originating from Corynebacterium glutamicum YPLys01, was named L-mqo-1; and the strain with a mutation (G1256A) in the mqo gene sequence, originating from wild-type Corynebacterium glutamicum ATCC13032, was named Y-mqo-1.

[0128] Both recombinant bacteria L-mqo-1 and Y-mqo-1 contain the mutant gene mqo shown in SEQ ID No. 3. G1256A It can express the protein mqo shown in SEQ ID No. 4. G419D Specifically, the only difference between recombinant strain L-mqo-1 and Corynebacterium glutamicum YPLys01 is that L-mqo-1 is formed by replacing the mqo gene of Corynebacterium glutamicum YPLys01 with mqo. G1256A The strain was obtained by reproducing the gene while keeping other sequences unchanged. The only difference between the recombinant strain Y-mqo-1 and the wild-type Corynebacterium glutamicum ATCC13032 is that Y-mqo-1 is obtained by replacing the mqo gene of wild-type Corynebacterium glutamicum ATCC13032 with mqo. G1256A The strain was obtained by extracting the gene while keeping other sequences unchanged.

[0129] Table 1. Composition of Corynebacterium glutamicum culture medium (solvent is water)

[0130] Element formula sucrose 10g / L Polypeptone 10g / L Beef extract 10g / L yeast powder 5g / L Urea 2g / L Sodium chloride 2.5g / L Agar powder 18g / L pH 7.0

[0131] Example 3: Constructing a genome overexpressing the mqo gene or mqo G1256A engineered strains of genes

[0132] Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, three pairs of amplified upstream and downstream homologous arm fragments and mqo or mqo were designed and synthesized. G1256A Primers for the gene promoter and coding regions were used to insert mqo or mqo into *Corynebacterium glutamicum* YPLys01 and wild-type *Corynebacterium glutamicum* ATCC13032 via homologous recombination. G1256A Gene copy.

[0133] The primer design is as follows:

[0134] (The underlined nucleotide sequences are the sequences on vector pK18.)

[0135] P6:5'-GCACACCACACCAACAATCGTGCACCGAGAACAGATG-3',

[0136] P7:5'-CATCTGTTCTCGGTGCACGATTGTTGGTGTGGTGTGC-3',

[0137] P8:5'-GATTTAATTGCGCCATCTGTCACACTGGCAAAGAATACG-3',

[0138] P9:5'-CGTATTCTTTGCCAGTGTTGACAGATGGCGCAATTAAATC-3',

[0139] P10: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GCTATGACACCTTCAACGGATC-3' (The underlined nucleotide sequence is the sequence on vector pK18).

[0140] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P5 / P6, P7 / P8, and P9 / P10, respectively, to obtain an upstream homologous arm fragment of 763 bp (corresponding to a partial coding region of NCgl1740 of Corynebacterium glutamicum ATCC13032 and the NCgl1741 gene and its promoter region, the sequence of which is shown in positions 37-799 of SEQ ID No. 6), a 2012 bp fragment of the mqo gene promoter and coding region (the sequence of which is shown in positions 800-2811 of SEQ ID No. 6, where positions 800-1170 are the promoter region and positions 1171-2811 are the coding region) and a downstream homologous arm fragment of 596 bp (corresponding to a partial coding region of the Corynebacterium glutamicum ATCC13032 NCgl1742 gene, the sequence of which is shown in positions 2812-3407 of SEQ ID No. 6). After the PCR reaction, the three amplified fragments were recovered by electrophoresis using a column DNA gel extraction kit. The three recovered fragments were ligated with the pK18mobsacB plasmid, purified after digestion with Xba I and BamHI, using NEBuilder enzyme at 50°C for 30 min. The ligation product was transformed into DH5α competent cells, and the resulting single clones were identified by PCR using primers P5 / P10. A fragment with a size of 3445 bp (sequence shown in SEQ ID No. 6) was identified as a positive integration plasmid (recombinant vector). The resulting recombinant vector was pK18-mqoOE. This positive integration plasmid contained a kanamycin resistance marker, and recombinants integrated into the genome could be obtained through kanamycin screening.

[0141] Using *Corynebacterium glutamicum* L-mqo-1 as a template, PCR amplification was performed using primers P5 / P6, P7 / P8, and P9 / P10, yielding a 763bp upstream homologous arm fragment (corresponding to a partial coding region of *Corynebacterium glutamicum* ATCC13032 NCgl1740 and the NCgl1741 gene and its promoter region, sequence shown as positions 37-799 in SEQ ID No. 6). G1256AThe gene promoter and coding region fragment of 2012 bp (the sequence of this 2012 bp fragment is obtained by mutating guanine G at position 2426 of SEQ ID No. 6 to adenine A, while keeping other nucleotides unchanged, positions 800-2811 of which are the promoter region and positions 1171-2811 are the coding region) and the downstream homologous arm fragment of 596 bp (corresponding to part of the coding region of the Corynebacterium glutamicum ATCC13032NCgl1742 gene, the sequence of which is shown as SEQ ID No. 6, positions 2812-3407) were recovered. After the PCR reaction, the three fragments obtained by amplification were recovered by electrophoresis using a column DNA gel recovery kit. The three recovered fragments were ligated with the pK18mobsacB plasmid purified after digestion with Xba I and BamHI using NEBuilder enzyme (NEB) at 50°C for 30 min. The ligation product was transformed into DH5α competent cells, and the resulting monoclonal clones were identified by PCR using primers P5 / P10. A positive integration plasmid (recombinant vector) was obtained with a fragment size of 3445 bp (the sequence of this 3445 bp fragment was obtained by mutating guanine G to adenine A at position 2426 of SEQ ID No. 6, while keeping other nucleotides unchanged). The resulting recombinant vector was pK18-mqo. G1256A OE, the positive integration plasmid contains a kanamycin resistance marker, and recombinants integrated into the genome can be obtained through kanamycin screening.

[0142] The correctly sequenced integration plasmids (pK18-mqoOE, pK18-mqo) G1256A OE was electroporated into *Corynebacterium glutamicum* YPLys01 and wild-type *Corynebacterium glutamicum* ATCC13032, respectively, and then cultured on solid culture plates for 40 h. Single colonies were identified by PCR using primers P11 / P12. Strains amplifying a 1545 bp fragment (sequence shown in SEQ ID No. 7) were considered positive strains; those not amplified were considered the original strains. Positive strains were streaked onto solid culture plates containing 15% sucrose for 40 h to eliminate the PK18 plasmid. Single colonies were further identified by PCR using primers P13 / P14. Strains amplifying a 1313 bp fragment (sequence shown in SEQ ID No. 8) were identified as *mqo* or *mqo*. G1256A A positive strain was identified by integrating the gene and its promoter into the spacer region of the homologous arm NCgl1741 and the lower homologous arm NCgl1742 of the *Corynebacterium glutamicum* genome. The recombinant strain containing the gene *mqo*, originating from *Corynebacterium glutamicum* YPLys01, was named L-mqo-2. G1256AThe recombinant strain was named L-mqo-3. The recombinant strain containing the mqo gene, originating from wild-type Corynebacterium glutamicum ATCC13032, was named Y-mqo-2. G1256A The recombinant bacteria was named Y-mqo-3.

[0143] The recombinant bacteria L-mqo-2 and Y-mqo-2 contain double copies of the mqo gene shown in SEQ ID No. 1. Specifically, recombinant bacteria L-mqo-2 is obtained by replacing the spacer region between the upstream homologous arm NCgl1741 and the downstream homologous arm NCgl1742 in the genome of Corynebacterium glutamicum YPLys01 with the mqo gene and its promoter (i.e., shown in SEQ ID No. 6, 800-2811), while keeping other nucleotides of the Corynebacterium glutamicum YPLys01 genome unchanged. Recombinant bacteria Y-mqo-2 is obtained by replacing the spacer region between the upstream homologous arm NCgl1741 and the downstream homologous arm NCgl1742 in the genome of wild-type Corynebacterium glutamicum ATCC13032 with the mqo gene and its promoter (i.e., shown in SEQ ID No. 6, 800-2811), while keeping other nucleotides of the wild-type Corynebacterium glutamicum ATCC13032 genome unchanged.

[0144] The recombinant bacteria L-mqo-3 and Y-mqo-3 contain the mutant gene mqo shown in SEQ ID No. 3. G1256A Specifically, the recombinant strain L-mqo-3 is formed by replacing the spacer region between the upper homologous arm NCgl1741 and the lower homologous arm NCgl1742 in the genome of Corynebacterium glutamicum YPLys01 with mqo. G1256A The recombinant strain Y-mqo-3 was obtained by replacing the gene and its promoter (i.e., shown in SEQ ID No. 6, 800-2811, where guanine G at position 2426 is mutated to adenine A) with other nucleotides of the Corynebacterium glutamicum YPLys01 genome unchanged. The recombinant strain Y-mqo-3 is obtained by replacing the spacer region between the upstream homologous arm NCgl1741 and the downstream homologous arm NCgl1742 in the genome of wild-type Corynebacterium glutamicum ATCC13032 with mqo. G1256A The recombinant bacteria were obtained by modifying the gene and its promoter (i.e., shown in SEQ ID No. 6, 800-2811, where guanine G at position 2426 is mutated to adenine A) and keeping other nucleotides of the wild-type Corynebacterium glutamicum ATCC13032 genome unchanged.

[0145] The PCR identification primers are shown below:

[0146] P11: 5'-TCCAAGGAAGATACACGCC-3' (corresponding to the outer side of the upstream homologous arm NCgl1740),

[0147] P12: 5'-CTTCTCGTTGATTCCTACAGC-3' (corresponding to the mqo gene),

[0148] P13: 5'-ACCTGTTCAAGTCCATCCG-3' (corresponding to the mqo gene),

[0149] P14: 5'-TGGTCGTTGGAATCTTGC-3' (corresponding to the outer side of the downstream homologous arm NCgl1742).

[0150] Example 4: Constructing plasmids to overexpress the mqo gene or mqo G1256A engineered strains of genes

[0151] Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, mqo or mqo amplification was designed and synthesized. G1256A Primers for the gene coding region and promoter region were used to overexpress mqo or mqo in Corynebacterium glutamicum YPLys01 and wild-type Corynebacterium glutamicum ATCC13032 using the expression vector pXMJ19. G1256A Gene.

[0152] The recombinant vector was constructed using NEBuilder assembly technology, and the primers were designed as follows:

[0153] P15: 5'- CAGAATAATTAAGCTTTGCATGCCTGCAGGTCGAC GATTGTTGGTGTGGTGTGC-3' (The underlined nucleotide sequence is a homologous sequence of pXMJ19);

[0154] (The underlined nucleotide sequence is a homologous sequence of pXMJ19).

[0155] With plasmid pK18-mqoOE or pK18-mqo G1256A Using OE as a template, PCR amplification was performed using primers P15 / P16 to obtain mqo or mqo G1256A The gene promoter and coding region fragments were purified and ligated with the expression vector pXMJ19 (containing chloramphenicol resistance) recovered by Xba I and BamHI enzyme digestion at 50℃ for 30 min using NEBuilder enzyme. The ligation product was transformed into DH5α competent cells and plated on 2-YT agar plates containing chloramphenicol (34 mg / L) and cultured at 37℃ for 12 h. The single clones that grew were identified by PCR using primers P15 / P16. Those that could amplify a 2080 bp fragment (sequence shown in SEQ ID No. 9) were those containing MQO or MQO. G1256APositive transformants pXMJ19-mqo and pXMJ19-mqo of gene promoter and coding region sequences G1256A .

[0156] The correctly sequenced pXMJ19-mqo and pXMJ19-mqo G1256A The plasmids were electroporated into *Corynebacterium glutamicum* YPLys01 and wild-type *Corynebacterium glutamicum* ATCC13032, respectively. After 40 hours of incubation on solid culture plates, single colonies were identified by PCR using primers P15 / P16. Strains amplifying a 2080 bp fragment (sequence shown in SEQ ID No. 9) were considered positive. The strain containing plasmid pXMJ19-mqo, originating from *Corynebacterium glutamicum* YPLys01, was named L-mqo-4. G1256A The strain was named L-mqo-5. The strain containing plasmid pXMJ19-mqo, originating from wild-type Corynebacterium glutamicum ATCC13032, was named Y-mqo-4. G1256A The strain was named Y-mqo-5.

[0157] Example 5: L-Lysine fermentation experiment

[0158] The strains constructed in Examples 2-4, Corynebacterium glutamicum YPLys01, and wild-type Corynebacterium glutamicum ATCC13032 were fermented in 500 mL baffle shake flasks under the culture medium shown in Table 2 and the control conditions shown in Table 3. After fermentation, the L-lysine production was detected using an SBA-Biosensor Analyzer (Shandong Academy of Sciences Institute of Biology). Each strain was repeated three times, and the results are shown in Table 4.

[0159] Table 2. Shake-flask fermentation medium formulation (solvent is water)

[0160]

[0161]

[0162] Table 3. Fermentation Control Conditions

[0163] Inoculation volume 10% (by volume) pH pH 7.0 Incubation temperature 30℃ Control conditions 220 rpm Fermentation cycle 48h

[0164] Table 4. L-Lysine production and significance analysis

[0165]

[0166] Note: P<0.05 in the table indicates a significant difference compared to the starting strain, and P<0.01 in the table indicates a highly significant difference compared to the starting strain.

[0167] The fermentation results are shown in Table 4. The results indicate that point mutation (G1256A) in the coding region of the mqo gene and overexpression of mqo or mqo in Corynebacterium glutamicum can effectively promote the fermentation of Corynebacterium glutamicum. G1256A Genes that contribute to increased L-lysine production. Point mutations (G1256A) in the coding region of the mqo gene and overexpression of mqo or mqo in Corynebacterium glutamicum YPLys01 were performed. G1256A Both gene mutations significantly increased L-lysine production (P<0.01). Point mutations (G1256A) in the coding region of the mqo gene and overexpression of mqo or mqo[…] in Corynebacterium glutamicum ATCC13032 significantly increased L-lysine production (P<0.01). G1256A All genes can significantly increase L-lysine production (P<0.05).

[0168] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Recombinant Corynebacterium glutamicum, characterized in that, The recombinant Corynebacterium glutamicum includes Corynebacterium glutamicum obtained by enhancing protein activity by including the amino acid sequence shown in SEQ ID No.

4.

2. A protein, characterized in that, The protein includes any of the following: A1) The amino acid sequence contains the protein shown in SEQ ID No. 4; A2) A protein that has more than 98% identity with and has the same function as the protein shown in A1) obtained by substituting, deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No.

4. A3) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

3. A biomaterial, characterized in that, The biomaterial includes any of the following: B1) A nucleic acid molecule encoding the protein of claim 2; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A recombinant host cell containing the nucleic acid molecule described in B1), or a recombinant host cell containing the expression cassette described in B2), or a recombinant host cell containing the recombinant vector described in B3).

4. The biomaterial according to claim 3, characterized in that, B1) The nucleic acid molecule includes any of the following: C1) The coding sequence contains a DNA molecule as shown in SEQ ID No. 3; C2) The nucleotide sequence contains a DNA molecule as shown in SEQ ID No.

3.

5. The use of the recombinant Corynebacterium glutamicum of claim 1, the protein of claim 2, or the biomaterial of claim 3 or 4 in any of the following: Application of E1 in regulating the production of microbial L-lysine; Application of E2 in the preparation of L-lysine; Application of E3 in the construction of genetically engineered bacteria that produce L-lysine.

6. A method for increasing the yield of L-lysine from a target microorganism or for preparing L-lysine, characterized in that, The method includes increasing the content and / or activity of the protein of claim 2 in the target microorganism to obtain a microorganism with a higher L-lysine yield than the target microorganism.

7. A method for increasing the yield of L-lysine from a target microorganism or for preparing L-lysine, characterized in that, The method includes mutating a protein in the target microorganism with the amino acid sequence SEQ ID No. 2 to obtain a microorganism with a higher L-lysine yield than the target microorganism. The mutation includes mutating the amino acid at position 419 of SEQ ID No. 2 to aspartic acid.

8. A method for increasing the yield of L-lysine from a target microorganism or for preparing L-lysine, characterized in that, The method includes mutating the DNA molecule with the nucleotide sequence SEQ ID No. 1 in the target microorganism to obtain a microorganism with a higher L-lysine yield than the target microorganism, wherein the mutation includes mutating guanine at position 1256 of SEQ ID No. 1 to adenine.

9. The application according to claim 5 or the method according to any one of claims 6-8, characterized in that, The microorganisms include Corynebacterium glutamicum.

10. The use of the recombinant Corynebacterium glutamicum of claim 1, the protein of claim 2, or the biomaterial of claim 3 or 4 in the preparation of food, cosmetics, pharmaceuticals, or feed containing L-lysine.