Application of TaRNS4 gene in wheat resistance to stripe rust
By overexpressing the TaRNS4 gene to activate the wheat MAPK signaling pathway, wheat resistance to stripe rust was improved, solving the problem of wheat yield loss and achieving effective control of stripe rust.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHENZHEN RESEARCH INSTITUTE OF NORTHWEST A & F UNIVERSITY
- Filing Date
- 2026-02-02
- Publication Date
- 2026-06-19
AI Technical Summary
Existing technologies are insufficient to effectively improve wheat's resistance to stripe rust, resulting in severe yield losses.
Overexpression of the TaRNS4 gene activates the wheat MAPK signaling pathway, increases the expression of disease resistance-related genes, and enhances wheat's resistance to stripe rust.
It significantly improves wheat's resistance to stripe rust, reduces yield loss, and enhances its adaptability to adverse conditions.
Smart Images

Figure CN121610504B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology and relates to... TaRNS4 Application of genes in wheat resistance to stripe rust. Background Technology
[0002] Wheat, an annual or biennial herbaceous plant belonging to the genus *Triticum* of the family Poaceae, is one of the major food crops. However, wheat production is often threatened by various diseases, among which wheat stripe rust (also known as wheat yellow rust or jaundice) is a fungal disease that harms wheat production. It is caused by *Triticum aestivum*, a fungus belonging to the genus *Triticum* of the order *Ruscidea* in the subphylum Basidiomycota. This fungus produces five different spore types throughout its complete life cycle: urediniospores, teliospores, basidiospores, sex spores, and aerospores. After infecting wheat, it exhibits typical symptoms: in the early stages, chlorotic spots appear on wheat leaves, followed by rust-colored, dotted powdery pustules, i.e., uredinia; later, black pustules, i.e., telia, further develop. The disease can persist from the seedling stage to the grain-filling stage, and in severe cases, it can lead to leaf withering, stunted plant growth, decreased thousand-grain weight, and reduced number of grains per ear, significantly impacting yield. Therefore, conducting research on wheat stripe rust resistance is of great significance for ensuring the safety of wheat production.
[0003] Ribonucleases (RNases) are a class of RNA hydrolases widely found in plants and animals. Besides their core RNA degradation function, they also participate in various biological functions such as RNA processing and splicing. Based on structure, substrate preference, and pH adaptability, RNases are generally classified into two main categories: basic (A and T1 families) and acidic (T2 family). The T2 family of RNases is older and more widely distributed. In plants, the T2 family of RNases can be further divided into two subfamilies: S-RNases and S-like RNases, which have significantly different functions. S-RNases are mainly involved in plant self-incompatibility processes, while the enzymes encoded by S-like RNase genes are primarily involved in stress response regulation, mediating plant resistance mechanisms to biotic and abiotic stresses. This makes them important targets for research on plant stress resistance.
[0004] Existing research has confirmed that S-like RNases play a crucial role in stress resistance in gramineous crops, especially in abiotic stress responses, where their functions are clearly defined. In rice, OsRNS4 interacts with the receptor-like kinase OsASLRK, positively regulating rice's tolerance to abscisic acid and drought resistance. Overexpression of this gene also significantly enhances rice's adaptability to high-salt environments. Preliminary progress has also been made in biotic stress responses: for example, OsRNS4 gene expression is significantly induced after rice infection with rice black-streaked dwarf virus, suggesting its potential involvement in plant antiviral defense processes. Given the important role of S-like RNases in stress resistance of gramineous crops and the destructive nature of wheat stripe rust, identifying and studying S-like RNases that regulate wheat resistance to stripe rust can provide new ideas and targets for breeding rust-resistant wheat varieties, possessing significant theoretical and applied value. Summary of the Invention
[0005] To solve the above-mentioned technical problems, the present invention provides TaRNS4 Application of genes in wheat resistance to stripe rust. TaRNS4 The nucleotide sequence of the gene is shown in SEQ. ID. NO:1. This gene is involved in wheat resistance to stripe rust and plays a positive regulatory role in wheat resistance to stripe rust. Overexpression of the gene... TaRNS4 Genes enhance wheat's resistance to stripe rust. Overexpression TaRNS4 The gene can activate the wheat MAPK signaling pathway, increase the expression of disease resistance-related genes in wheat, thereby improving wheat's resistance to stripe rust. Overexpression TaRNS4 The gene can also reduce yield loss in wheat caused by stripe rust. This invention provides a germplasm resource for the green control of wheat stripe rust and offers new ideas for breeding rust-resistant wheat varieties.
[0006] On the one hand, this invention seeks protection TaRNS4 The application of genes in wheat resistance to stripe rust, the aforementioned TaRNS4 The nucleotide sequence of the gene open reading frame is shown in SEQ. ID. NO:1.
[0007] The TaRNS4 Genes play a positive regulatory role in wheat resistance to stripe rust;
[0008] The pathogen causing the stripe rust is physiological race CYR32.
[0009] Overexpression TaRNS4 Genes enhance wheat's resistance to stripe rust.
[0010] Specifically, the present invention addresses... TaRNS4 overexpression of genes in wheat materials and TaRNS4 Disease resistance identification of mutant wheat materials revealed... TaRNS4The number of rust spores in the overexpressing wheat material was significantly lower than in the Fielder variety, while tarns4 The mutant exhibited significantly weakened disease resistance, produced more rust spore masses on its leaves, and showed a significant increase in fungal biomass in infected leaves 14 days after infection. (Inoculation...) Pst back, TaRNS4 -OE plants showed the worst mycelial colonization, followed by the Fielder variety, and lastly... tarns4 Mutant. It is evident that... TaRNS4 Genes can positively regulate wheat's response to Pst Resistance, and to Pst resistance and TaRNS4 Gene expression levels are positively correlated.
[0011] Furthermore, overexpression TaRNS4 Genes activate the wheat MAPK signaling pathway, thereby increasing the expression of disease resistance-related genes in wheat;
[0012] The disease resistance-related genes include PR1 Gene, NPR1 Genes and MAPK4 Gene.
[0013] Specifically, the present invention addresses... TaRNS4 Gene analysis of overexpressing wheat materials revealed that, compared to Fielder wheat, overexpression... TaRNS4 Subsequently, plant-pathogen interactions and the MAPK signaling pathway were significantly enriched. Annotation of genes involved in the pathway revealed genes associated with disease resistance. PR1 , NPR1 and MAPK4 A significant upward adjustment. This indicates that... TaRNS4 The resistance of wheat to stripe rust can be positively regulated through the MAPK signaling cascade reaction.
[0014] Furthermore, this invention claims protection for a method of breeding a wheat variety resistant to stripe rust, involving overexpression of [a specific herb] in wheat. TaRNS4 Gene;
[0015] The TaRNS4 The nucleotide sequence of the gene open reading frame is shown in SEQ. ID. NO:1.
[0016] Furthermore, the breeding method includes: constructing an overexpression vector, transferring the overexpression vector into Agrobacterium, infecting wheat embryos with Agrobacterium carrying the overexpression vector, and obtaining the wheat variety resistant to stripe rust.
[0017] Furthermore, the overexpression vector includes TaRNS4 Genes and empty vectors;
[0018] The unloaded carrier is a Ubi-C1300GTW;
[0019] The Agrobacterium is Agrobacterium EHA105.
[0020] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:
[0021] (1) This invention TaRNS4 The nucleotide sequence of the gene's open reading frame is shown in SEQ. ID. NO:1. TaRNS4 Genes can positively regulate wheat's response to Pst Resistance, and to Pst resistance and TaRNS4 Gene expression levels are positively correlated. This invention addresses... TaRNS4 overexpression of genes in wheat materials and TaRNS4 Disease resistance identification of mutant wheat materials revealed... TaRNS4 The number of rust spores in the overexpressing wheat material was significantly lower than in the Fielder variety, while tarns4 The mutant exhibited significantly weakened disease resistance, produced more rust spore masses on its leaves, and showed a significant increase in fungal biomass in infected leaves 14 days after infection. (Inoculation...) Pst back, TaRNS4 -OE plants showed the worst mycelial colonization, followed by the Fielder variety, and lastly... tarns4 Mutant. This invention. TaRNS4 Genes can also respond to hormonal treatment and abiotic stress, and can alleviate stress through different regulatory mechanisms.
[0022] (2) Overexpression TaRNS4 Genes can enhance the expression of disease resistance-related genes in wheat and activate the wheat MAPK signaling pathway. This invention addresses... TaRNS4 Gene analysis of overexpressing wheat materials revealed that, compared to Fielder wheat, overexpression... TaRNS4 Subsequently, plant-pathogen interactions and the MAPK signaling pathway were significantly enriched. Annotation of genes involved in the pathway revealed genes associated with disease resistance. PR1 , NPR1 and MAPK4 A significant upward adjustment. This indicates that... TaRNS4 The resistance of wheat to stripe rust can be positively regulated through the MAPK signaling cascade reaction.
[0023] (3) Overexpression TaRNS4 Genes can reduce yield losses in wheat caused by stripe rust. This invention, through research... TaRNS4 Agronomic traits of wheat materials with overexpressed genes were discovered. TaRNS4-OE plants exhibited almost identical yield traits, such as plant height, ear length, and number of tillers, compared to the control plants. TaRNS4 -OE plants have larger grain length, grain width, and thousand-grain weight than Fielder plants. Attached Figure Description
[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0025] Figure 1 for TaRNS4 Phylogenetic tree of genes.
[0026] Figure 2 This is a diagram showing the domain structure of the TaRNS4 protein.
[0027] Figure 3 for TaRNS4 A diagram illustrating gene expression patterns in the interaction between stripe rust fungus and wheat.
[0028] Figure 4 for TaRNS4 A diagram illustrating gene expression patterns in response to hormone treatment and abiotic stress. Figure 4 A in the text is TaRNS4 Graph illustrating gene expression patterns in response to hormone treatment; Figure 4 B in TaRNS4 A diagram illustrating gene expression patterns in response to abiotic stress.
[0029] Figure 5 for TaRNS4 The image shows the RT-qPCR detection results of the gene-overexpressing plants. TaRNS4 -OE#L1、 TaRNS4 -OE#L3 and TaRNS4 -OE#L5 are respectively TaRNS4 Gene overexpression lines Line 1, Line 3 and Line 5.
[0030] Figure 6 for TaRNS4 The image shows the results of Western blotting analysis on the gene-overexpressing plants.
[0031] Figure 7 for TaRNS4 A diagram illustrating gene editing in mutant wheat plants. (The diagram shows the gene editing process in the mutant wheat plants.) tarns4 -KO#3 and tarns4 -KO#12 are respectively TaRNS4 Mutant lines Line 3 and Line 12; A, B, and D are three wheat genomes, respectively.
[0032] Figure 8 For Fielder plants, TaRNS4 Gene overexpression plants and TaRNS4 Inoculation of gene-mutated plants Pst Phenotypic diagram of CYR32 strain 14 days later.
[0033] Figure 9 For Fielder plants, TaRNS4 Gene overexpression plants and TaRNS4 Inoculation of gene-mutated plants Pst The relative biomass of fungi of species CYR32 after 14 days is shown in the figure.
[0034] Figure 10 For Fielder plants, TaRNS4 Gene overexpression plants and TaRNS4 Inoculation of gene-mutated plants Pst Figure showing the colonization of mycelia of race CYR32 after 4 days. In the figure, SV represents hypostomatal vesicles, HMC represents haustoria mother cells, SH represents secondary hyphae, and H represents haustoria. The scale bar is 50 μm.
[0035] Figure 11 For Fielder plants, TaRNS4 Gene overexpression plants and TaRNS4 Inoculation of gene-mutated plants Pst The statistical results of mycelial length and total infection area in plants after CYR32 race are shown in the figure. Figure 11 In this context, A represents the Fielder plant. TaRNS4 Gene overexpression plants and TaRNS4 Inoculation of gene-mutated plants Pst Statistical results of hyphal length in plants after CYR32 race; Figure 11 B in the text represents the Fielder plant. TaRNS4 Gene overexpression plants and TaRNS4 Inoculation of gene-mutated plants Pst The statistical results of the total infected area in plants after CYR32 race are shown in the figure.
[0036] Figure 12 for TaRNS4 Figure showing the results of KEGG pathway enrichment analysis in plants with gene overexpression.
[0037] Figure 13 for TaRNS4 Heatmap of differentially regulated genes in plant-pathogen interaction pathways in overexpressing plants.
[0038] Figure 14 for TaRNS4 Inoculation on gene-overexpressing plants and Fielder plants Pst Phenotypic diagram of the CYR32 subtype. Figure 14 A in the text is TaRNS4 Inoculation on gene-overexpressing plants and Fielder plants Pst Phenotypic diagram of plants after CYR32 race; Figure 14 B in TaRNS4 Inoculation on gene-overexpressing plants and Fielder plants Pst Phenotypic diagram of leaves of CYR32 subrace.
[0039] Figure 15 for TaRNS4 Inoculation on gene-overexpressing plants and Fielder plants Pst The statistical results of plant height and spike length after CYR32 are shown in the figure. Figure 15 A in the text is TaRNS4 Inoculation on gene-overexpressing plants and Fielder plants Pst Statistical results of plant height after CYR32; Figure 15 B in TaRNS4 Inoculation on gene-overexpressing plants and Fielder plants Pst The statistical results of spike length of plants after CYR32 are shown in the figure.
[0040] Figure 16 for TaRNS4 Inoculation on gene-overexpressing plants and Fielder plants Pst The statistical results of tiller number and thousand-grain weight of plants after CYR32 are shown in the figure. Figure 16 A in the text is TaRNS4 Inoculation on gene-overexpressing plants and Fielder plants Pst The statistical results of the number of tillers of plants after CYR32 were shown in the figure. Figure 16 B in TaRNS4 Inoculation on gene-overexpressing plants and Fielder plants Pst The statistical results of the thousand-grain weight of plants after CYR32 are shown in the figure.
[0041] Figure 17 for TaRNS4 Inoculation on gene-overexpressing plants and Fielder plants Pst Image showing the grain length and width of seeds from plants grown under the CYR32 subrace. Detailed Implementation
[0042] The technical solution of the present invention will be described below with reference to embodiments. However, the present invention is not limited to the following embodiments. Unless otherwise specified, the experimental methods and detection methods described in each embodiment are conventional methods; unless otherwise specified, the reagents and materials can be purchased commercially. Unless otherwise specified, the percentages in the following embodiments refer to mass percentages.
[0043] The plant overexpression vector Ubi-C1300GTW was published in the literature: Li, R., Tang, Y., Wang, Q., Zhao, B., Su, W., Wang, B., & Li, Q. (2025). Inactivation of a Wheat Ribosomal Silencing Factor Gene TaRsfS Confers Resistance to Both Powdery Mildew and Stripe Rust. Plant, Cell & Environment, 48(1), 711-727.
[0044] The editing vector pBUE411 was published in the literature: Li, J., Zhang, S., Zhang, R., Gao, J., Qi, Y., Song, G., ...&Li, G. (2020). Efficient multiplex genome editing by CRISPR / Cas9 in common wheat. Plant biotechnology journal, 19(3), 427.
[0045] Example 1
[0046] This embodiment provides TaRNS4 Gene sequence analysis.
[0047] By cloning the ORF, TaRNS4 The nucleotide sequence of the gene's open reading frame is shown in SEQ. ID. NO:1. Sequencing alignment analysis revealed... TaRNS4 The full-length gene contains 738 nucleotides. Analysis using the online PANTHER website indicates that it belongs to the S-like RNase gene of the RNase T2 family. Comparison results from the wheat genome URGI website show that TaRNS4 has three copies located on chromosomes 1A, 1B, and 1D. TaRNS4 The sequence identity of the three copies of the gene was 97%, 97%, and 96%, respectively. The genome was constructed using MEGA 7.0 software. TaRNS4 Phylogenetic tree ( Figure 1The results showed that this gene is related to barley. HvRNS4 and rice OsRNS4 They are of the same origin, hence the name TaRNS4 .
[0048] TaRNS4 The gene encodes a ribonuclease protein composed of 245 amino acids. The isoelectric point of the TaRNS4 protein is 6.21, and its amino acid sequence is shown in SEQ. ID. NO:2. Domain analysis of the TaRNS4 protein was performed ( Figure 2 The results showed that the TaRNS4 protein contains a transmembrane domain, a nucleotide-binding domain, and a conserved amino acid motif.
[0049] Example 2
[0050] This embodiment provides TaRNS4 Analysis of gene expression patterns.
[0051] 1. TaRNS4 Analysis of gene expression patterns in the interaction between stripe rust fungus and wheat
[0052] In order to determine TaRNS4 Did it participate in the wheat's resistance to stripe rust ( Pst To investigate resistance to CYR32 stripe rust, wheat varieties XM318 and Shuiyuan 11 were used as experimental materials. Before the wheat reached the heading stage, CYR32 stripe rust was evenly inoculated onto the upper surface of wheat leaves using a smear method. After inoculation, the mixture was kept in the dark and moist at 8–10°C for 24 h, then transferred to a greenhouse with a temperature of 15–17°C, a light intensity of 10,000–14,000 Lux, a photoperiod of 16 h light / 8 h dark, and a humidity of 90% until disease development and sporulation. RT-qPCR analysis was used to analyze the results. TaRNS4 Expression patterns in affinity and incompatibility combinations of stripe rust fungi and wheat ( Figure 1 ),by TaEF-1α As an internal reference gene, the results of RT-qPCR were analyzed using the 2^-ΔΔCt method.
[0053] The primers used are:
[0054] TaRNS4 -S:AACATCCATTGTCCGCGC;
[0055] TaRNS4 -AS: CCTGAAGTAGTCCACCTCCTT;
[0056] TaEF-1α -S:TGGTGTCATCAAGCCTGGTATGGT;
[0057] TaEF-1α-AS: ACTCATGGTGCATCTCAACGGACT;
[0058] PstEF-1 -S: TTCGCCGTCCGTGATATGAGACAA;
[0059] PstEF-1 -AS: ATGCGTATCATGGTGGTGGAGTGA.
[0060] Depend on Figure 3 It can be seen that, TaRNS4 The transcript of the gene is in XM318- Pst In the incompatible interaction, expression was significantly upregulated at 12, 24, and 48 hpi, but not at water source- Pst The expression levels in the affinity combinations showed minimal changes or even a downregulation trend, indicating that TaRNS4 Genes may be present in wheat- Pst They played an important role in the interaction.
[0061] 2. TaRNS4 Analysis of gene expression patterns in response to hormones and abiotic stress
[0062] To further clarify TaRNS4 Can genes respond to hormones and abiotic stresses? This can be investigated using RT-qPCR. TaRNS4 Gene expression levels under hormone and abiotic stress ( Figure 4 The analysis method is the same as above.
[0063] Depend on Figure 4 It is known that plant hormones jasmonic acid (JA), salicylic acid (SA), abscisic acid (ABA), and ethylene (ETH) can all induce... TaRNS4 Gene expression, TaRNS4 The genes showed a particularly pronounced response to JA treatment. Furthermore, TaRNS4 Genes can also respond to abiotic stresses. TaRNS4 Gene expression was significantly downregulated under heat stress and significantly upregulated under drought and salt stress. TaRNS4 Genes also show some response to cold treatment. This indicates... TaRNS4 Genes may play different roles under different adversity conditions, and these genes alleviate adversity stress through different regulatory mechanisms.
[0064] Example 3
[0065] This embodiment studied TaRNS4 Genes in wheat Pst Its role in resistance.
[0066] 1. TaRNS4 Construction of wheat materials with gene overexpression
[0067] Will TaRNS4 The fusion coding sequence of -HA was cloned into the plant overexpression vector Ubi-C1300GTW to obtain the recombinant overexpression vector. TaRNS4 -HA-OE. The recombinant overexpression vector was introduced into *Agrobacterium tumefaciens* EHA105 strain, and immature Fielder wheat embryos were genetically transformed using an *Agrobacterium*-mediated transformation system to obtain overexpressed (OE) wheat plants. The procedure was described in reference Ishida, Y., Tsunashima, M., Hiei, Y., and Komari, T. (2015). Wheat ( Triticum aestivum L) transformation using immature embryos. Methods Mol. Biol. 1223: 189-198. The generated transgenic wheat lines were subjected to PCR and RT-qPCR. Figure 5 ) and Western blotting ( Figure 6 Positive transgenic lines were detected and screened. The RT-qPCR data are the mean ± standard error of three independent samples (SE).
[0068] Constructing recombinant overexpression vectors TaRNS4 -HA-OE, the primers used are:
[0069] Ubi-C1300GTW- TaRNS4 -HA-S: cgactctagaggatccATGGCCCAGAGGACAATTTCA;
[0070] Ubi-C1300GTW- TaRNS4 -HA-AS: cggtacccggggatccTCAAGCGTAGTCTGGGACGTCGTATGGGTACGCCTCAGTGGGCAACAT.
[0071] Depend on Figure 5 and Figure 6 It can be seen that, TaRNS4 Genes in TaRNS4 The expression and protein levels in L1, L3, and L5 of the -OE series were significantly higher than those in the Fielder receptor strain.
[0072] 2. TaRNS4 Construction of mutant wheat materials
[0073] Based on CRISPR-Cas9 gene editing technology, targeting the A, B, and D genomes of wheat... TaRNS4 Two specific sgRNAs, sgRNA1 and sgRNA2, were designed from conserved sequence regions of the target gene to achieve simultaneous multi-genome editing. Using Golden-gate cloning technology, the expression cassettes of these two sgRNAs were inserted into the editing vector pBUE411, and then transformed into the wheat variety Fielder using an Agrobacterium-mediated transformation system. Further, based on the conserved sequence regions of wheat A, B, and D genomes... TaRNS4 By identifying differentially expressed gene sequences, genome-specific amplification primers were designed to perform PCR amplification on transgenic plants. The products were then subjected to first-generation sequencing, and homozygous deletion mutants were finally screened. tarns4 wheat( Figure 7 PAM1 is represented by green letters, PAM2 by yellow letters, and the sequences of sgRNA1 and sgRNA2 are underlined. Insertions are highlighted in red, with "-" indicating deletion and "+" indicating insertion.
[0074] Genome-specific amplification primers:
[0075] sgRNA1-S:ggagtgagtacggtgtgcAGAGTCATTTCTGCTTGCAA;
[0076] sgRNA1-AS:gagttggatgctggatggTTAAGCAAGACAATATACTAAGTAC;
[0077] sgRNA2-S:ggagtgagtacggtgtgcACCGGAGATTGGGCCGGT;
[0078] sgRNA2-AS:gagttggatgctggatggGACAAGTCGAAGGTCGTGAAGC;
[0079] The primers used to construct the gene editing vector TaRNS4-KO were:
[0080] RNS4-gR1-S:GGCGAATCCTTGGCTTACTAGCCG;
[0081] RNS4-gR1-AS: AAACCGGCTAGTAAGCCAAGGATT;
[0082] RNS4-gR2-S: GGCGGGATGTTGCGTGCCCAAGTA;
[0083] RNS4-gR2-AS:AAACTACTTGGGCACGCAACATCC.
[0084] 3. To TaRNS4 overexpression of genes in wheat materials and TaRNS4 Disease resistance identification of mutant wheat materials
[0085] For Fielder, TaRNS4 overexpression wheat materials TaRNS4 -OE#L3 and TaRNS4 -OE#L5 plants, and tarns4 -KO#3 and tarns4 -KO#12 plant inoculation Pst The phenotype of the CYR32 race 14 days after inoculation is as follows: Figure 8 As shown, the plant was tested for... Pst Fungal biomass, using wheat genes TaEF-1α and stripe rust fungus PstEF-1 The fungal biomass ratio was assessed using data that were the mean ± SE of three independent samples. Results are as follows: Figure 9 As shown. Using wheat germ lectin (WGA) for... TaRNS4 -OE plants, tarns4 Mutant and Fielder plants were stained and histologically observed using a fluorescence microscope. The results are as follows: Figure 10 As shown, statistics TaRNS4 -OE plants, tarns4 The hyphal length and total infection area of stripe rust in mutant and Fielder plants are shown in the following results. Figure 11 As shown, the results are from 50 infection sites, and the data are the mean ± SE of three independent samples.
[0086] Depend on Figures 8-11 It can be seen that, TaRNS4 The number of rust spores in the overexpressing wheat material was significantly lower than in the Fielder variety, while tarns4 The mutant exhibited significantly weakened disease resistance, produced more rust spore masses on its leaves, and showed a significant increase in fungal biomass in infected leaves 14 days after infection. (Inoculation...) Pst back, TaRNS4 -OE plants showed the worst mycelial colonization, followed by the Fielder variety, and lastly... tarns4 Mutant. It is evident that... TaRNS4 Genes can positively regulate wheat's response to Pst Resistance, and to Pst resistance and TaRNS4 Gene expression levels are positively correlated.
[0087] 4. TaRNS4Gene analysis of wheat materials with overexpressed genes
[0088] The above vaccination Pst RNA-seq sequencing was performed on wheat materials following the CYR32 race, and differentially expressed genes were analyzed using the Kyoto Encyclopedia of Genes and Genomes (KEGG). The results are as follows: Figure 12 and Figure 13 As shown.
[0089] Depend on Figure 12 and Figure 13 It can be seen that, compared with Fielder wheat, overexpression TaRNS4 Subsequently, plant-pathogen interactions and the MAPK signaling pathway were significantly enriched. Annotation of genes involved in the pathway revealed genes associated with disease resistance. PR1 , NPR1 and MAPK4 A significant upward adjustment. This indicates that... TaRNS4 The resistance of wheat to stripe rust can be positively regulated through the MAPK signaling cascade reaction.
[0090] Example 4
[0091] This embodiment is... TaRNS4 The agronomic traits of wheat materials with overexpressed genes were studied.
[0092] Will TaRNS4 Wheat seeds with overexpressed genes were sown in 25×25×25cm pots, 4 seeds per pot, and grown in a greenhouse at 25℃, 10000~14000 Lux light intensity, 16 h / 8 h photoperiod, and 85% humidity. The plants developed into mature plants... TaRNS4 -OE plants showed no difference in growth compared to Fielder plants grown in a greenhouse.
[0093] exist TaRNS4 -OE plants were inoculated with stripe rust race CYR32. The leaf phenotypic results after inoculation are as follows: Figure 14 As shown, the agronomic traits of the plant, such as plant height, ear length, number of tillers, and thousand-grain weight, were further compared with those of the Fielder plant, and the results are as follows. Figures 15-17 As shown.
[0094] Depend on Figure 14 It can be seen that, TaRNS4 -OE leaves showed less disease severity than Fielder plants, and TaRNS4 - The number of basidiospores produced in OE leaves is less than that in Fielder plants, indicating that TaRNS4 -OE plants develop resistance to stripe rust fungus. (From...) Figures 15-17 It can be seen that, TaRNS4-OE plants exhibited almost identical yield traits, such as plant height, ear length, and number of tillers, compared to the control plants. TaRNS4 -OE plants had larger grain length, grain width, and thousand-grain weight than Fielder plants, indicating overexpression. TaRNS4 Genes can reduce yield losses in wheat caused by stripe rust.
[0095] As described above, the basic principles, main features, and advantages of the present invention have been well described. The above embodiments and specifications are merely descriptions of preferred embodiments of the present invention, and the present invention is not limited to the above embodiments. Various changes and improvements made to the technical solutions of the present invention by those skilled in the art without departing from the spirit and scope of the present invention should fall within the protection scope defined by the present invention.
Claims
1. TaRNS4 The application of genes in wheat resistance to stripe rust is characterized by, The TaRNS4 The nucleotide sequence of the gene's open reading frame is shown in SEQ. ID. NO:1; The pathogen causing the stripe rust is physiological race CYR32; The wheat variety is XM318; Overexpression TaRNS4 Genes enhance wheat's resistance to stripe rust.
2. The application according to claim 1, characterized in that, Overexpression TaRNS4 Genes activate the wheat MAPK signaling pathway.
3. The application according to claim 2, characterized in that, Overexpression TaRNS4 Genes enhance the expression of disease resistance-related genes in wheat; The disease resistance-related genes include PR1 Gene, NPR1 Genes and MAPK4 Gene.
4. A method for breeding a wheat variety resistant to stripe rust, characterized in that, Overexpression in wheat TaRNS4 Gene; The TaRNS4 The nucleotide sequence of the gene's open reading frame is shown in SEQ. ID. NO:1; The pathogen causing the stripe rust is physiological race CYR32; The wheat variety is XM318.
5. The method for breeding wheat varieties resistant to stripe rust according to claim 4, characterized in that, The process includes constructing an overexpression vector, transferring the overexpression vector into Agrobacterium, and infecting wheat embryos with Agrobacterium carrying the overexpression vector to obtain the wheat variety resistant to stripe rust.
6. The method for breeding wheat varieties resistant to stripe rust according to claim 5, characterized in that, The overexpression vector includes TaRNS4 Genes and empty vectors; The unloaded carrier is a Ubi-C1300GTW.
7. The method for breeding wheat varieties resistant to stripe rust according to claim 5, characterized in that, The Agrobacterium is Agrobacterium EHA105.