An optimized poly(a) tail sequence element and uses thereof

Abstract

This invention discloses an optimized Poly(A) tail sequence element and its applications, belonging to the field of biomedical technology. The element incorporates at least one non-A base selected from C, U, or G at a specific predetermined position at the 5' or 3' end of the Poly(A) tail sequence, constituting a set of well-defined sequence optimization design criteria. This strategy effectively interferes with the degradation of mRNA by deadenylate enzymes, significantly enhancing the intracellular stability of mRNA molecules and protein translation levels. This invention further provides preferred schemes involving incorporation position, incorporation quantity, distribution pattern, and base type preference. Experiments show that this optimization strategy is particularly effective in immune cells, effectively enhancing humoral and cellular immune responses to mRNA vaccines in vivo. This invention provides a general key technical solution for developing efficient and stable next-generation mRNA vaccines and drugs.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to an optimized Poly(A) tail sequence element and its application. Background Technology

[0002] Messenger RNA (mRNA) vaccines, as an emerging platform technology, have shown great application potential in fields such as infectious disease prevention, tumor immunotherapy, protein replacement therapy, and regenerative medicine due to their advantages of flexible design, rapid production, efficient expression of target proteins, and high safety. However, their single-chain linear structure is susceptible to degradation by nucleases intracellularly, resulting in insufficient in vivo stability and protein expression persistence, which is currently one of the key bottlenecks restricting their efficacy and application.

[0003] As a core regulatory structural element of mRNA molecules, the Poly(A) tail plays a crucial role in maintaining mRNA stability and promoting efficient translation (Passmore and Coller, 2022). Its function is primarily achieved through the following mechanisms: Firstly, the Poly(A) tail, by binding to polyadenylate-binding protein (PABP) and a 5' cap structure, synergistically mediates the formation of the translation initiation complex, thereby driving protein translation. Secondly, the Poly(A) tail-PABP complex physically hinders the recognition and degradation of mRNA ends by deadenylate enzymes through a steric protective barrier, thus delaying mRNA degradation. Based on the core regulatory function of the Poly(A) tail, its rational design and engineering modification have become key technical directions for improving the efficacy of mRNA vaccines / drugs. Current modification strategies include: introducing branched tail structures (Chen et al., 2025), chemical modification (Alom et al., 2024), and inserting specific secondary structures (Oh et al., 2025). However, these methods often suffer from complex synthetic processes, high costs, or potential immunogenicity, limiting their large-scale production and application.

[0004] Recent studies have revealed that the natural Poly(A) tail is not entirely composed of adenine (A), but also contains a certain proportion of non-A bases (such as guanine G, cytosine C, and uracil U) (Liu et al., 2019). These non-A bases can effectively interfere with the deadenylation process, thereby enhancing the stability of mRNA molecules (Lim et al., 2018). Although previous studies have confirmed that incorporating non-A bases into the 3' end or spacers of the Poly(A) tail can improve mRNA translation levels (Li et al., 2022; Liu et al., 2025; Spiewla et al., 2026), these works have mainly focused on verifying the feasibility of this strategy, but have not provided a clear, efficient, and engineerable incorporation scheme. Specifically, there is still a lack of fully experimentally validated optimization methods for key engineering parameters such as the optimal incorporation position (5' end, middle or 3' end), base type (G, C, U), incorporation quantity and distribution pattern of non-A bases in the Poly(A) tail, which makes it impossible to establish a systematic structure-activity relationship between these parameters and mRNA stability and translation level.

[0005] Therefore, developing Poly(A) tail sequence modification schemes based on clear design principles that can systematically improve mRNA stability and translation levels and are suitable for large-scale production has become a crucial and urgent technical problem in this field. Summary of the Invention

[0006] The purpose of this invention is to provide an optimized Poly(A) tail sequence element and its application to enhance the stability and translation level of mRNA molecules.

[0007] The present invention adopts the following technical solution: In a first aspect, the present invention provides an optimized Poly(A) tail sequence element, wherein the structural element contains at least one non-adenine (A) base at a specific position in the Poly(A) tail sequence, the non-A base being selected from cytosine (C), uracil (U), or guanine (G); the specific position is the 2nd, 4th, 6th, 8th, 10th, 12th, 14th, or 16th base counted from the 5' end to the 3' end or from the 3' end to the 5' end of the Poly(A) sequence.

[0008] As a preferred embodiment of the present invention, the total length of the Poly(A) tail element is approximately 110 nucleotides. In this element, the insertion position of the non-A base is selected from the even-numbered positions from the 2nd to the 16th position counting from the 5' end to the 3' end in a continuous A sequence, or symmetrically, selected from the even-numbered positions from the 2nd to the 16th position counting from the 3' end to the 5' end. Preferably, incorporating a non-A base into the 5' end region of the element has a better overall effect on improving the translation level than incorporating it into the 3' end region.

[0009] Furthermore, when the total length of the Poly(A) tail element is 110 nucleotides, a non-A base, selected from cytosine or uracil, is incorporated at position 12, starting from the 5' end. Experiments have shown that at this length, position 12 is the preferred position among all 5' incorporation sites that achieves the optimal level of translation.

[0010] Furthermore, from the 5' end to the 3' end of the element, the closer the non-A base is to the middle of the sequence, the stronger its effect on improving translation. The fourth position, counting from the 3' end, has been proven to be a particularly effective preferred incorporation site. The translation enhancement effects of non-A base incorporation strategies from the 5' end to the 3' end and from the 3' end to the 5' end cannot be simply superimposed.

[0011] As another preferred embodiment of the present invention, when non-A bases are incorporated into the Poly(A) tail of approximately 110 nucleotides in a nearly uniformly spaced distribution, the number of incorporated bases is preferably 4 to 12. Within this range, the translation level of mRNA can be significantly improved; too few or too many incorporated bases will not significantly improve the translation effect. The effects of non-A bases on improving mRNA translation levels are, in descending order: cytosine (C) > uracil (U) > guanine (G); The effect of non-A base pairs on enhancing mRNA translation is particularly significant in immune cells, but not obvious in non-immune cell lines.

[0012] In a second aspect, the present invention provides an mRNA molecule comprising a Poly(A) tail sequence element obtained by any of the incorporation methods and incorporation sites described in the first aspect.

[0013] Thirdly, the present invention provides an mRNA vaccine comprising the mRNA molecule described in the second aspect.

[0014] Furthermore, animal experiments of the present invention show that the preferred Poly(A) tail element can significantly increase the titer of mRNA vaccine antigen-specific antibodies, while effectively promoting the maturation of dendritic cells in lymph nodes and strongly activating the spleen antigen-specific T cell immune response.

[0015] Fourthly, the present invention provides the use of the Poly(A) tail sequence element described in the first aspect in the preparation of an mRNA vaccine for enhancing humoral and cellular immune responses.

[0016] The beneficial effects of this invention are as follows: This invention provides a set of well-defined and engineerable Poly(A) tail sequence optimization design guidelines. By incorporating specific types of non-A bases at specific positions, the deadenylation process is effectively interfered with, thereby enhancing the intracellular stability of mRNA and the level of protein translation. Furthermore, this engineered sequence modification strategy shows particularly significant enhancement effects in immune cell lines. Mechanism studies have revealed that this translation enhancement effect depends on the core function of the intracellular CCR4-NOT deadenylate enzyme complex. This invention provides a general and key technical solution for developing efficient and stable next-generation mRNA vaccines and drugs. Attached Figure Description

[0017] Figure 1 This is a map of the in vitro transcription template plasmid T7-Nano Luciferase.

[0018] Figure 2 This is a map of the in vitro transcription template plasmid T7-Firefly Luciferase.

[0019] Figure 3 This is a map of the in vitro transcription template plasmid T7-SP-SARS-CoV-2 SRBD.

[0020] Figure 4 The effects of incorporating different non-A monobases (C, G, U) at the 4th position of the 3' end of Poly(A) tails of different lengths on mRNA translation levels.

[0021] Figure 5 To investigate the effect of non-A base incorporation at the 3' end of the Poly(A) tail on mRNA translation levels in immune and non-immune cell lines.

[0022] Figure 6 The effects of incorporating non-A bases at specific positions at the 5' end of the Poly(A) tail on mRNA translation levels are shown in Figure A, which is a schematic diagram of incorporating non-A bases at specific positions at the 5' end, and Figure B is the effect of incorporating C or U at specific positions at the 5' end on translation levels.

[0023] Figure 7 The effects of incorporating non-A bases at specific positions at the 3' end of the Poly(A) tail on mRNA translation levels are shown in Figure A, which is a schematic diagram of incorporating non-A bases at specific positions in the 3' end region of the Poly(A) tail, and Figure B is the effect of incorporating C or U at specific positions at the 3' end on translation levels.

[0024] Figure 8 The effect of incorporating C at the optimal combination of the 5' and 3' ends of the Poly(A) tail on translation quality.

[0025] Figure 9The effects of incorporating different amounts of non-A bases into the Poly(A) tail at approximately uniform intervals on mRNA translation levels are shown in Figure A, where different amounts of C incorporated at uniform intervals affect translation levels, and different amounts of U incorporated at uniform intervals affect translation levels.

[0026] Figure 10 The effects of incorporating different amounts of non-A bases into the Poly(A) tail at approximately uniform intervals on mRNA stability are shown in Figure A, which shows the effect of incorporating different amounts of C at uniform intervals on stability, and Figure B shows the effect of incorporating different amounts of U at uniform intervals on stability.

[0027] Figure 11 To reduce the influence of CNOT-1 or CNOT-7 on the translation enhancement effect of non-A bases incorporated at the optimal positions of the 5' and 3' ends of Poly(A) tails.

[0028] Figure 12 The dosing timeline and the level of humoral immunity induced in mice are shown for mRNA vaccines with non-A bases incorporated at the optimal positions of the 5' and 3' ends of the Poly(A) tail. Figure A shows the dosing timeline of the mRNA vaccine, and Figure B shows the level of SRBD-specific IgG induced in mice.

[0029] Figure 13 The graph shows the level of cellular immunity induced in mice by mRNA vaccines with non-A bases incorporated at the optimal positions of the 5' and 3' ends of the Poly(A) tail. Figure A represents the central memory CD8. + T cell ratio, Figure B shows effector memory CD8. + T cell percentage, Figure C shows IL4. + CD4 + T cell proportion, Figure D shows IFN-γ + CD4 + T cell proportion, E figure shows IFN-γ + CD8 + T cell ratio.

[0030] Figure 14 The graph shows the levels of dendritic cell maturation and antigen presentation induced in lymph nodes of mice by mRNA vaccines with non-A bases incorporated at the optimal positions of the 5' and 3' ends of the Poly(A) tail. Figure A shows the proportion of dendritic cells in the lymph nodes, and Figure B shows the MCH-II concentration in CD11c. + Expression patterns in cells; Figure C shows CD40 expression in CD11c. + Expression patterns in cells; Figure D shows CD80 expression in CD11c. + Expression status in cells.

[0031] Figure 15To assess the biosafety of mRNA vaccines with non-A bases incorporated at the optimal positions of the 5' and 3' ends of the Poly(A) tail in mice, Figure A shows the pathological findings of major organs (heart, liver, spleen, lung, and kidney) in mice analyzed by HE staining. Figure B shows the key indicators of liver and kidney function in mice analyzed by serum biochemistry. ALT (alanine aminotransferase), AST (aspartate aminotransferase), TBIL (total bilirubin), CR (creatinine), and UA (urea) were also included. Detailed Implementation

[0032] The present invention will be further described below with reference to specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.

[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0034] The "approximately uniform spacing of different numbers of non-A bases" in this invention refers to: based on the total length of the Poly(A) sequence, N non-A bases are uniformly distributed and incorporated into the Poly(A) sequence, and only one identical non-A base is incorporated at each incorporation position, with the number of spacer bases between two adjacent non-A bases being equal or approximately equal; wherein N is 2, 4, 6, 8, 10, 12, 15 or 20.

[0035] Example 1: Construction and preparation of linear templates for in vitro transcription of Nano Luciferase mRNA, Firefly Luciferase mRNA, and SARS-CoV-2 SRBD mRNA Cellular translational levels were detected using a dual-luciferase reporter gene assay. The dual-luciferase reporter gene system used consisted of two reporter gene plasmids encoding nanoluciferase (Nluc) and firefly luciferase (Fluc), respectively. The mRNA vaccine used for in vivo injection in mice encoded the spike protein receptor-binding domain (SRBD) of the novel coronavirus. The linearized templates for the above recombinant plasmids were obtained using conventional molecular biology techniques through the following steps.

[0036] (1) Acquisition of target antigen fragments The nucleotide sequences of Nluc, Flu, and SARS-CoV-2 SRBD were obtained through NCBI. A stop codon TAA was added to the end of the sequence, and the sequences were then synthesized by Beijing Qingke Biotechnology Co., Ltd. The synthesized sequences were 516 bp, 1655 bp, and 672 bp, respectively, and the nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.

[0037] (2) Acquisition of fusion genes For the mRNA encoding the SARS-CoV-2 SRBD antigen for in vivo injection, this invention modifies it by fusing a transmembrane signal peptide. The specific steps are as follows: The nucleotide sequence of the transmembrane signal peptide SP was obtained through NCBI and synthesized by Beijing Qingke Biotechnology Co., Ltd., as shown in SEQ ID NO.4. The signal peptide SP and the target antigen SARS-CoV-2 SRBD were subjected to a chain extension reaction via homologous arms to obtain the fusion gene SP-SARS-CoV-2 SRBD. The fusion gene is 714 bp in length, and its nucleotide sequence is shown in SEQ ID NO.5.

[0038] (3) Construction of recombinant plasmids Nluc, Fluc, and SP-SARS-CoV-2 SRBD were ligated to the linearized template vector Cloning Kit formRNA Template (Takara, Cat:6143) via homologous recombination and transformed into DH5α competent cells. Correctly selected single colonies yielded the in vitro transcription template plasmids T7-Nluc, T7-Fluc, and T7-SP-SARS-CoV-2 SRBD. The plasmid maps are shown below. Figure 1 , Figure 2 , Figure 3 As shown, the sequence was verified to be correct by sequencing. The encoded amino acid sequences are shown in SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO. 8, respectively.

[0039] (4) Obtaining linearized template The obtained recombinant plasmid was digested overnight at 37°C with the restriction endonuclease HindIII. Subsequently, the linear fragment was separated by 1.5% gel electrophoresis, and the digestion products were recovered using a DNA recovery kit. Finally, the DNA concentration was determined by Nanodrop, yielding the linearized template for subsequent in vitro mRNA transcription.

[0040] Example 2: Construction and preparation of linear templates for in vitro transcription of Nluc mRNA with non-A bases incorporated into the Poly(A) tail and SP-SARS-CoV-2 SRBD mRNA (1) Optimized sequence acquisition of Poly(A) tail with non-A base incorporation Non-A bases are incorporated into the poly(A) tail of the linearized template vector Cloning Kit for mRNA Template (Takara, Cat:6143) at specific positions at the 5' and 3' ends or at uniform intervals along the entire length. Specific incorporation positions are detailed in [link to documentation]. Figure 6 A, Figure 7 A and Figure 9 As shown, the mutant sequence with the Poly(A) tail was obtained and primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. F1 / R1 primers were designed for the linear template vector, and polymerase chain reaction (PCR) amplification was performed using different optimized sequences as templates to infuse the vector with homologous sequences.

[0041] F1 (SEQ ID NO.9):GGATTCTGCCTAATAAAAAACATTTATTTTCATTGC R1 (SEQ ID NO.10):AGAAGGGATCCTAGGTCGACTCGAGAAGC The PCR reaction system is shown in Table 1: Table 1. PCR reaction system for Poly(A) fragment The PCR reaction procedure is shown in Table 2: Table 2 Poly(A) fragment PCR reaction procedure (2) Construction of recombinant plasmids with non-A bases incorporated into the Poly(A) tail F2 / R2 primers were designed before and after the Poly(A) tail of the linearized template vector Cloning Kit for mRNA Template (Takara, Cat:6143). Polymerase chain amplification was performed using the above recombinant plasmids T7-Nluc and T7-SP-SARS-CoV-2 SRBD as templates to obtain the target vector fragments T7-Nluc Vector and T7-SP-SARS-CoV-2 SRBD Vector.

[0042] F2 (SEQ ID NO.11): GCTTCTCGAGTCGACCTAGGATCCCTTCTACTG R2 (SEQ ID NO.12): GCAATGAAAATAAATGTTTTTTATTAGGCAGAATCCAG The PCR reaction system is shown in Table 3: Table 3 Linear vector PCR reaction system The PCR reaction procedure is shown in Table 4: Table 4 Linear vector PCR reaction procedure The obtained Poly(A) tail sequence fragments containing non-A incorporation (including Poly(A) sequences with a single non-A base incorporated at positions 2, 4, 6, 8, 10, 12, 14, or 16 at the 5' end; Poly(A) sequences with a single non-A base incorporated at positions 2, 4, 6, 8, 10, 12, 14, or 16 at the 3' end; and Poly(A) sequences with 2, 4, 6, 8, 10, 12, 15, or 20 identical non-A bases incorporated at uniform intervals; the non-A bases being cytosine or uracil) were ligated with T7-Nluc Vector and T7-SP-SARS-CoV-2SRBD Vector via homologous recombination and transformed into DH5α competent cells. Correct single-clone colonies were picked and sequenced to obtain all in vitro transcription template plasmids T7-Nluc-MuPA and T7-SP-SARS-CoV-2SRBD-MuPA.

[0043] (3) Obtaining linearized template The obtained recombinant plasmid was treated with restriction endonuclease. HindIII Digestion was performed overnight at 37°C. Subsequently, linear fragments were separated by 1.5% gel electrophoresis, and the digestion products were recovered using a DNA recovery kit. Finally, the DNA concentration was determined using Nanodrop, yielding a linearized template for subsequent in vitro mRNA transcription.

[0044] Example 3: mRNA in vitro transcription, capping, and purification Using the EasyCap T7 Co-transcription Kit with CAG Trimer (Vazyme, Cat:DD4203-01), wild-type Poly(A) mRNA and mutant Poly(A) mRNA encoding Nluc, Flux, and SP-SARS-CoV-2 SRBD were generated through the following steps. EasyPure was used. ® The RNA Purification Kit (TransGenBiotech, Cat:ER701-01) purifies the above-mentioned mRNA products transcribed in vitro using the following steps.

[0045] (1) On ice, add the reagents listed in Table 5 below into 200 µL microcentrifuge tubes respectively.

[0046] Table 5. Components and dosage of in vitro transcription reagents After thorough mixing and centrifugation, the reaction tubes were incubated at 37°C for 4-6 hours. Subsequently, 1 µL of DNase I was added to the reaction tubes, and the mixture was incubated at 37°C for 15 minutes to remove the DNA template.

[0047] (2) mRNA purification Take the in vitro transcription product, add nuclease-free water to a final volume of 100 µL, and transfer to a 1.5 mL centrifuge tube. Add 350 µL of BB12 (containing 1% β-mercaptoethanol) and vortex to mix. Add 900 µL of anhydrous ethanol and vortex again. Add the mixture to a centrifuge column in two portions, centrifuge at 12000×g for 1 minute, and discard the eluent. Add 500 µL of WB12 and centrifuge at 12000×g for 1 minute, discarding the eluent. Repeat the above steps. Centrifuge at 12000×g for 2 minutes to completely remove residual ethanol. Transfer the centrifuge column to a new 1.5 mL nuclease-free centrifuge tube, add 30 µL of nuclease-free water to the column, incubate at room temperature for 2 minutes, and centrifuge at 12000×g for 1 minute. Determine the concentration and purity of the purified in vitro transcribed mRNA product using Nanodrop, and assess its quality by 1.5% agarose gel electrophoresis.

[0048] Example 3: Preparation of lipid nanoparticles loaded with antigen mRNA (1) Preparation of lipid ethanol solution. SM102 (Cat:O02010), distearate phosphatidylcholine DSPC (Cat:S01005), high-purity cholesterol CHO-HP (Cat:57-88-5), and DMG-PEG2000 (Cat:O02005) purchased from Aivit (Shanghai) Pharmaceutical Technology Co., Ltd. were dissolved in anhydrous ethanol and prepared into lipid ethanol solution according to the molar percentages in Table 6 for later use.

[0049] Table 6 Composition of LNP lipid ethanol solution (2) Take 10 µg of mRNA and dilute it to 90 µL with citrate-sodium citrate buffer (pH=4.5). Take 30 µL of the above LNP mixture and mix it thoroughly with 90 µL of mRNA solution. Use a pipette to repeatedly pipette 70-80 times until the solution is light blue and transparent.

[0050] (3) Place 120 µL of the above mixture in Slide-A-Lyzer TMIn a mini dialysis flask (10 kWh / mL, 0.1 mL), a centrifuge tube was filled with PBS solution and incubated overnight on a shaker at 4°C. This yielded lipid nanoparticles loaded with mRNA.

[0051] Example 4: Evaluation of the effect of non-A base incorporation at specific positions at the 5' / 3' end of the Poly(A) tail on mRNA translation level and stability in a cell model. (1) Experimental cells: Mouse mononuclear macrophage leukemia cell line Raw264.7, human embryonic kidney cell line 293T, human hepatocellular carcinoma cell line HepG2, and human cervical carcinoma cell line HeLa were cultured in DMEM medium containing 10% fetal bovine serum and 1% penicillin-dextrose antibody. Mouse bone marrow-derived dendritic cell line DC2.4 was cultured in RPMI-1640 medium containing 10% fetal bovine serum and 1% penicillin-dextrose antibody. The culture conditions were 37°C and 5% CO2.

[0052] (2) Translation proficiency test: In a 48-well plate, Raw264.7, 293T, DC2.4, HepG2, and HeLa were mixed overnight at a ratio of 1×10⁻⁶. 5 Cells were seeded per well. After 12 hours, each well was transfected with 0.4 µg of Fluc mRNA-LNP and 0.2 µg of Nluc mRNA-LNP carrying different Poly(A) tails. The control group contained wild-type Poly(A), while the experimental group had a cytosine incorporated at the 4th position of the 3' end of the Poly(A) tail. After 16 hours of culture, adherent cells were pipetted off, mixed, and 30 µL was placed in a 96-well white microplate. 30 µL of ONE-Glo™ EX Luciferase Assay Reagent was added first, and the fluorescence intensity excited by Firefly Luciferase was detected in a microplate reader. Then, 30 µL of NanoDLR™ Stop & Glo was added. ® Reagent and Furimazine quenched the luciferase signal of fireflies, and the fluorescence intensity excited by Nluc was detected in a microplate reader. The ratio of fluorescence intensity excited by Nluc to that excited by Fluc was calculated as an indicator for evaluating the translation level.

[0053] (3) Stability testing: Raw264.7 was prepared in a 12-well plate overnight according to a 5×10⁻⁶ ratio. 5Cells were seeded per well. After 12 hours, each well was transfected with 1 µg of Nluc mRNA-LNP carrying different Poly(A) tails. After 2 hours of culture, the medium was changed and marked as 0. Cells were collected at 0, 1, 2 and 4 hours. Total RNA was extracted from the cells using FastPure Cell / Tissue Total RNA Isolation KitV2 (Vazyme, Cat:RC112-01) and the concentration and purity of the RNA product were determined using Nanodrop.

[0054] Take 1 µg of extracted total RNA and place it in a 200 µL microcentrifuge tube, then bring the volume to 12 µL with ddH2O. Add 4 µL of 4×g DNA Wiper Mix and mix well by pipetting. Incubate in a PCR instrument at 42°C for 2 minutes to remove genomic DNA. Then add 4 µL of 5×HiScript II qRT SuperMix IIa and mix well by pipetting. Incubate in a PCR instrument at 50°C for 15 minutes to complete reverse transcription, and then inactivate the enzyme by incubating at 85°C for 5 seconds.

[0055] Based on the Nluc mRNA sequence and the mouse ACTB gene, F / R primers were designed respectively. Real-time quantitative polymerase chain reaction (qPCR) was performed using the cDNA obtained from the reverse transcription as a template, and the Ct value was measured. The formula ΔCt = Ct Nano Luciferase - Ct ACTB , △△Ct=Ct Nano Luciferase -Average(△Ct)、Percentage of remaining mRNA=2 △△Ct Calculate the 2 for 0 hours, 1 hour, 2 hours, and 4 hours respectively. △△Ct A stability fitting line was plotted, and the half-life of Nluc mRNAs carrying different Poly(A) tails was calculated based on the fitting line.

[0056] F-Nluc (SEQ ID NO.13): CTGTTCCGAGTAACCATCAACGGAG R-Nluc (SEQ ID NO. 14): GGCCCTTCATAATATCCCCCAGTTTAG F-ACTB (SEQ ID NO.15): GGCTGTATTCCCCTCCATCG R-ACTB (SEQ ID NO.16): CCAGTTGGTAACAATGCCATGT The PCR reaction system is shown in Table 7: Table 7. qPCR reaction system for detecting mRNA stability The PCR reaction procedure is shown in Table 8: Table 8. qPCR reaction procedures for detecting mRNA stability. (4) SiRNA knockdown of CNOT1 and CNOT7 Raw264.7 cells were seeded at 6 × 10⁴ cells / well in 48-well plates overnight. Transfection was performed 24 hours later when the cell density reached 30%-50%. The transfection complex was prepared in advance using the following solutions: Solution A = 7.5 pmol siRNA + 15 µL Opti-MEM (Thermo Fisher, Cat: 31985070); Solution B = 0.9 µL Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher, Cat: 13778030) + 15 µL Opti-MEM. Each solution was thoroughly mixed beforehand. Solution A and Solution B were then mixed and incubated at room temperature for 5-10 min to prepare the transfection complex. During the incubation of the transfection complex, the medium in the 48-well plates was replaced with 270 µL of antibiotic-free complete medium. 30 µL of the transfection complex was added dropwise to each well, bringing the final volume to 300 µL. Thirty-six hours after transfection, the knockdown level was detected by qPCR. After confirming successful knockdown, the translation level was then tested.

[0057] (5) Results Analysis: Dual-luciferin reporter gene assays showed that incorporating a non-A base at position 4 of the 3' end of Poly(A) tail sequences of different lengths, including 100A and 30A, improved mRNA translation levels in the following order: cytosine (C) > uracil (U) > guanine (G). Figure 4 ); The translation enhancement effect of this optimization strategy was validated in multiple cell lines. The results showed that the translation enhancement effect was particularly significant in immune cells such as Raw264.7 and DC2.4, while it was relatively insignificant in non-immune cell lines. Figure 5 ); Incorporation of non-A bases into the 5' region of the Poly(A) tail has a greater overall effect on improving translation than incorporation into the 3' region. From the 5' to the 3' end, the closer the incorporation site of the non-A base is to the middle of the sequence, the stronger its effect on improving translation; this trend remains consistent with the incorporation of C and U bases. Figure 6AB). Notably, the fourth position counting from the 3' end was confirmed to be an incorporation site with a particularly significant translation-enhancing effect (AB). Figure 7 (AB); The translation-enhancing effects of non-A base incorporation strategies from the 5' end to the 3' end and from the 3' end to the 5' end cannot be simply superimposed. Figure 8 ); In addition, incorporating a suitable amount of non-A bases in a nearly uniformly spaced distribution can also effectively improve mRNA translation levels, with 4-12 non-A bases being the optimal amount. Figure 9 AB). Excessive incorporation of non-A bases (taking single bases C and U as an example) not only reduces the translation level of mRNA ( ) Figure 9 AB), and also reduces the stability of mRNA ( Figure 10 AB); Under conditions where CNOT1 or CNOT7 is knocked down, the translation enhancement effect brought about by the incorporation of non-A bases at the Poly(A) tail is significantly weakened, which confirms that CNOT1 and CNOT7 play a central role in this effect. Figure 11 ).

[0058] Example 4: Evaluation of the effect of non-A base incorporation at the optimal 5' / 3' end of the Poly(A) tail on humoral and cellular immunity to mRNA vaccines in a mouse model.

[0059] The optimal non-A base incorporation position at the 5' end of the Poly(A) tail is specifically the incorporation of a cytosine at position 12 of the 5' end of the sequence; the optimal non-A base incorporation position at the 3' end of the Poly(A) tail is specifically the incorporation of a cytosine at position 4 of the 3' end of the sequence.

[0060] (1) Laboratory animals: Six-week-old female Balb / c mice were purchased from Hangzhou Qizhen Experimental Animal Center. They were purchased one week before the experiment and had free access to water and food.

[0061] (2) mRNA vaccination: Mice were randomly divided into three groups of 10 each. Each group received the following treatments via intramuscular injection: Group 1 received wild-type mRNA-LNP (WT) encoding the SARS-CoV-2 SRBD antigen; Group 2 received a mutant mRNA-LNP (C-Left) with a non-A base incorporated at the optimal 5' end of the Poly(A) tail; and Group 3 received a mutant mRNA-LNP (C-Right) with a non-A base incorporated at the optimal 3' end of the Poly(A) tail. The dosage for all mRNA / LNP formulations was 5 µg per mouse. The first injection was designated Day 0. A booster injection was administered 14 days later, designated Day 14. Mice were euthanized by cervical dislocation 35 days later. Paraffin sections of the major organs (heart, liver, spleen, lung, and kidney) from each group were collected and analyzed using HE staining.

[0062] (3) Detection of antibody levels in mice: The antibody titer in mice was determined using an indirect ELISA method. The total IgG level in serum was detected using a mouse anti-SARS-Cov-2 (2019-nCov) S protein IgG antibody titer assay kit (Solarbio, Cat: SEKPM-2061). After the reagents and samples equilibrated to room temperature, the plates were washed three times with washing buffer. Mouse serum was diluted appropriately and added to the ELISA plates, then incubated at 37°C for 2 hours. After washing four times with washing buffer, the plates were incubated at 37°C for 45 minutes with HRP anti-IgG antibody diluted 1:100 (v / v), washed five more times, and then incubated with 100 μL of chromogenic buffer in the dark for 5–15 minutes. Finally, 50 μL of stop solution was added to stop the reaction. The absorbance was measured at 450 nm using a microplate reader. The IgG titer in each group of serum was calculated based on the absorbance and a standard curve.

[0063] (4) Detection of cellular immune response levels in mice: Spleen cells were extracted from mice in each group and cultured in vitro. 2 × 10⁻⁶ cells were collected. 6One spleen cell per cell was placed in a 24-well plate, and 2 µg of the COVID-19 antigen protein peptide library was added to each well. The cells were incubated at 37 °C for 24 hours. At hour 20, brefeldin A (1:1000) was added, and incubation continued for another 4 hours. Subsequently, mouse surface and intracellular markers were labeled using mouse PB450-anti-CD45, BV510-anti-CD3, PerCP-anti-CD8a, FITC-anti-CD4, Alexa-700-anti-IFN-γ, APC-anti-IL-4, APC-anti-CD44, and BV510-anti-CD62L antibodies, respectively. Flow cytometry was then used to analyze the ratio of central memory T cells CD8 Tcm (CD44+CD62L+) to effector memory T cells CD8 Tem (CD44+CD62L-); and the ratios of CD8+ / IFN-γ+, CD4+ / IFN-γ+, and CD4+ / IL-4+ T cells. Inguinal lymph nodes from each group of mice were collected and ground through a cell filter to obtain single-cell suspensions. Surface markers were applied using mouse PB450-anti-CD45, PerCP-anti-CD11c, PE-anti-CD40, APC / Cy7-anti-MHC-II, and FITC-anti-CD80 antibodies. Flow cytometry was used to analyze the mean fluorescence intensity (MFI) of CD80, CD40, and MHC-II in dendritic cells (CD45+ / CD11c+).

[0064] (5) Results Analysis The levels of SARS-CoV-2 SRBD-specific antibodies in mouse serum were measured by ELISA. The results showed that, compared with the group vaccinated with wild-type mRNA-LNP vaccine, mice vaccinated with mRNA-LNP vaccines containing non-A bases with Poly(A) tails (C-Left and C-Right) showed significantly increased levels of SRBD-specific antibody IgG after the first immunization (14 days) and booster immunization (35 days). Figure 12 AB); Flow cytometry analysis of vaccine-induced cellular immune responses showed that the ratio of central memory T cells and effector memory T cells in the spleen of mice vaccinated with a non-A base-incorporated Poly(A) tail mRNA-LNP vaccine was significantly upregulated. Figure 13 AB); Intracellular cytokine staining analysis of spleen T cells in mice immunized with the vaccine showed that, compared with the control group, mice vaccinated with the non-A base-incorporated Poly(A) tail mRNA-LNP vaccine had significantly higher CD4 counts. + The proportion of T cells secreting IL-4 and IFN-γ was significantly increased. Figure 13 CD); at the same time, CD8 +The proportion of T cells secreting IFN-γ also increased significantly. Figure 13 E). This indicates that the strategy enhances both Th1 and Th2 cellular immune responses in a balanced manner, while also enhancing the effector function of cytotoxic T lymphocytes; Flow cytometry analysis of the maturation and antigen-presenting capacity of dendritic cells in vaccine-induced draining lymph nodes showed that this strategy effectively increased the proportion of dendritic cells in draining lymph nodes. Figure 14 A), and to varying degrees, promote dendritic cell maturation and antigen presentation (A), and promote dendritic cell maturation and antigen presentation to varying degrees ( Figure 14 BD); HE staining pathological examination of the major organs (heart, liver, spleen, lung, and kidney) of mice revealed no abnormal pathological changes related to the vaccine. Figure 15 A). Meanwhile, serum biochemical analysis showed that key indicators of liver and kidney function in mice in each vaccine group were within the normal range, with no significant difference compared to the blank control group. Figure 15 B). These results collectively indicate that this mRNA optimization strategy has good biocompatibility at the study dose.

[0065] This demonstrates that this optimization strategy of incorporating non-A bases into the Poly(A) tail can effectively enhance the cellular and humoral immune responses of mRNA vaccines in vivo.

[0066] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. An optimized Poly(A) tail sequence element, characterized in that, To enhance the stability and translation level of mRNA molecules, the element comprises a Poly(A) sequence, wherein at least one non-A base is incorporated into the sequence; the incorporation site and incorporation mode of the non-A base are selected from any of the following: (a) A single non-A base is incorporated at position 2, 4, 6, 8, 10, 12, 14 or 16, starting from the 5' end of the Poly(A) tail sequence; (b) A single non-A base is incorporated at position 2, 4, 6, 8, 10, 12, 14 or 16, starting from the 3' end of the Poly(A) tail sequence; (c) Based on the total length of the Poly(A) sequence, N identical non-A bases are incorporated at uniform intervals, with only one non-A base incorporated at each incorporation site, where N is 2, 4, 6, 8, 10, 12, 15 or 20.

2. The Poly(A) tail sequence element according to claim 1, characterized in that, The non-A bases are selected from cytosine, uracil, or guanine.

3. The Poly(A) tail sequence element according to claim 2, characterized in that, The non-A base is preferably cytosine.

4. The Poly(A) tail sequence element according to claim 1, characterized in that, The Poly(A) tail sequence element contains 110 A bases, and a non-A base is incorporated at position 12 starting from the 5' end. The non-A base is selected from cytosine or uracil.

5. The Poly(A) tail sequence element according to claim 1, characterized in that, The Poly(A) tail sequence element contains 110 A bases, and a non-A base is incorporated at the 4th position starting from the 3' end. The non-A base is selected from cytosine or uracil.

6. An mRNA molecule, characterized in that, It includes the Poly(A) tail sequence element as described in any one of claims 1-5.

7. An mRNA vaccine, characterized in that, It comprises the mRNA molecule as described in claim 6.

8. The mRNA vaccine according to claim 7, characterized in that, The vaccine can increase antigen-specific antibody titers, promote the maturation of dendritic cells in lymph nodes, and activate antigen-specific T cell immune responses in the spleen.

9. The use of the Poly(A) tail sequence element according to any one of claims 1-5 in the preparation of an mRNA vaccine for enhancing humoral and cellular immune responses.

Images