Method for creating double function haploid inducer line of brassica napus based on bna knl2 gene and application thereof
By knocking out or overexpressing the BnaKNL2 gene in Brassica napus, a bifunctional haploid induction line was created using the CRISPR/Cas9 system, solving the problem of low haploid induction rate in Brassica napus, realizing an efficient breeding method, and improving breeding efficiency and yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HUAZHONG AGRI UNIV
- Filing Date
- 2026-03-27
- Publication Date
- 2026-06-09
AI Technical Summary
In existing technologies, the haploid induction rate of Brassica napus is low and its function is limited, making it difficult to effectively improve through traditional methods, which affects breeding efficiency and yield.
By knocking out or overexpressing the BnaKNL2 gene in Brassica napus, and using the CRISPR/Cas9 system for gene editing, a bifunctional haploid induction line with maternal or paternal haploid induction ability was created. Combined with the cytoplasmic male sterility system, the CMS-HI line was formed.
It significantly improved the haploid induction rate to 0.45%-2.7%, and short-term high temperature stress can increase the induction efficiency by 3 to 4 times. It created the CMS-HI line that carries both sterile cytoplasm and haploid induction ability, thus broadening the scope of breeding applications.
Smart Images

Figure CN122168669A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant breeding and genetic engineering, specifically relating to a method for creating a bifunctional haploid inducible line of Brassica napus based on the BnaKNL2 gene and its application. Background Technology
[0002] Rapeseed (Brassica napus) is one of the most important oilseed crops globally. Haploid breeding is an effective method to increase yield in a short period of time. Currently, the key genes for haploid induction in Brassica napus are BnaDMP and BnaGig1. Centromere-based haploid induction systems have been reported in various crops. The centromere is a specialized chromosomal region that mediates kinetochore assembly, to which microtubules attach. Loading CENH3 onto the centromere initiates the formation of the kinetochore complex, which remains bound to CENH3 throughout cell division until the cell transitions from metaphase to metaphase. Furthermore, the C-terminus of KNL2 contains a CENH3 nucleosome-binding motif (CENPC-K); mutations or complete deletion of the CENPC-K motif affect the centromere localization of KNL2.
[0003] Because of the crucial role of CENH3 in chromosome segregation, mutations in it can lead to lethality or segregation errors. Similarly, reduced CENH3 content at the centromere was observed in the KNL2 mutant, resulting in decreased growth rate, reduced fertility, and meiotic defects in Arabidopsis. These studies further demonstrate a functional link between CENH3 and KNL2. To overcome the sterility and difficulty in obtaining homozygous CENH3 mutants, researchers attempted to modify the CENH3 assembly factor (KNL2) in Arabidopsis. The results showed that when the knl2 mutant was used as the maternal parent in a cross with the wild type, the haploid induction rate (HIR) exceeded 1%, and short-term high-temperature stress significantly increased its haploid induction rate. However, when the knl2 mutant was used as the paternal parent, haploid formation could not be induced. Currently, research on KNL2 in rapeseed remains lacking. Summary of the Invention
[0004] This invention addresses a gap in existing technologies by providing a method for creating bifunctional haploid inducible lines for Brassica napus based on the KNL2 gene. Research has revealed that the KNL2 gene is a key gene affecting the fertility of Brassica napus. By knocking out the KNL2 gene in Brassica napus, bifunctional haploid inducible lines with maternal or paternal haploid induction capabilities can be created. The haploid induction rate after hybridization with different Brassica napus varieties can reach 0.45%-2.7%. Furthermore, by combining this with a cytoplasmic male sterility system and through hybridization and backcrossing, the CMS-HI line, carrying both sterile cytoplasm and haploid induction capabilities, can be rapidly created. This provides a new approach for haploid breeding and the improvement and creation of CMS lines in Brassica napus, with broad application prospects.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] This invention provides the use of the BnaKNL2 gene or its gene expression inhibitor or its protein expression inhibitor in any of the following:
[0007] A1) Application in the preparation of bifunctional haploid induction lines for Brassica napus;
[0008] A2) Application in the breeding of cabbage-type oilseeds;
[0009] The amino acid sequence encoded by the BnaKNL2 gene is shown in any of SEQ ID NO. 3-4.
[0010] Furthermore, the nucleotide sequence of the BnaKNL2 gene is shown in any one of SEQ ID NO.1-2.
[0011] Furthermore, the gene expression inhibitor includes sgRNA, the sequence of which is shown in any one or two of SEQ ID NO. 5-6.
[0012] Furthermore, by silencing or inhibiting the expression and / or activity of the BnaKNL2 gene, or knocking out the BnaKNL2 gene, transgenic plants can be obtained, thus preparing a bifunctional haploid inducible line of Brassica napus; or by further hybridizing the transgenic plants or their offspring as male or female parents with other Brassica napus lines to obtain hybrid offspring, thus obtaining an unploid Brassica napus.
[0013] Furthermore, the BnaKNL2 gene was edited using CRISPR / Cas9 system-mediated gene editing technology, with the sgRNA sequence shown as any one or two of SEQ ID NO. 5-6.
[0014] This invention also provides a method for preparing a bifunctional haploid inducible line of Brassica napus, comprising the following steps: obtaining transgenic plants by silencing or inhibiting the expression and / or activity of the BnaKNL2 gene, or by knocking out the BnaKNL2 gene, thereby obtaining a bifunctional haploid inducible line of Brassica napus; wherein the amino acid sequence encoded by the BnaKNL2 gene is as shown in any one of SEQ ID NO. 3-4.
[0015] Furthermore, the BnaKNL2 gene was edited using CRISPR / Cas9 system-mediated gene editing technology, with the sgRNA sequence shown as any one or two of SEQ ID NO. 5-6.
[0016] Furthermore, primers as shown in SEQ ID NO.7-10 were designed based on sgRNA, and the BnaKNL2 gene knockout vector was constructed using the PKSE401 vector as the backbone vector.
[0017] Furthermore, the BnaKNL2 gene knockout vector was transformed into the Brassica napus variety Westar using Agrobacterium GV3101-mediated hypocotyl genetic transformation, and mutant materials with single or double mutations of BnaKNL2.A02 and BnaKNL2.C02 were screened.
[0018] The present invention also provides a method for preparing a haploid oleifera of the Brassica napus type, the method comprising: using the haploid induction line or its offspring prepared by the above method as the male or female parent, and hybridizing it with other rapeseed lines to obtain hybrid offspring, thereby obtaining a haploid oleifera of the Brassica napus type.
[0019] Furthermore, the hybrid offspring can be identified as haploids of the Brassica napus type after haploid identification. The haploid identification steps are as follows: first, preliminary identification is performed using GFP fluorescence and Indel molecular markers, then further identification is performed by flow cytometry, and finally, the genetic background of the haploid is confirmed by the rapeseed 50K chip.
[0020] The present invention also provides a method for preparing a cytoplasmic male sterility-haploid inducible line (CMS-HI), the method comprising: using the haploid inducible line (i.e., the bnaknl2 mutant) prepared by the above method as the male parent, crossing it with the cytoplasmic male sterility line to obtain the F1 generation; using the F1 generation as the female parent to backcross with the haploid inducible line prepared by the above method again, and screening for plants carrying sterile cytoplasm and with a mutation in the BnaKNL2 gene (i.e., plants carrying both sterile cytoplasm and the bnaknl2 genetic background) in the offspring, thereby obtaining the cytoplasmic male sterility-haploid inducible line.
[0021] The present invention also provides a method for preparing a BnaKNL2 gene expression inhibitor for a bifunctional haploid inducible line of Brassica napus, wherein the gene expression inhibitor comprises sgRNA, and the sequence of the sgRNA is shown in any one or two of SEQ ID NO. 5-6.
[0022] Beneficial Effects: This invention verifies that the KNL2 gene is a key gene affecting the fertility of Brassica napus by knocking out or overexpressing the KNL2 gene in Brassica napus, combined with pollen viability, in vitro pollen germination, and seed setting rate analysis. By knocking out the KNL2 gene in Brassica napus, a bifunctional haploid induction line with maternal or paternal haploid induction ability can be created, overcoming the limitation of traditional single-function induction lines and significantly expanding its application flexibility and scope. Hybridization with materials from different backgrounds can stably produce haploids, with haploid induction rates between 0.45% and 2.7%, and short-term high-temperature stress can increase its induction efficiency by 3 to 4 times. Furthermore, it can be combined with a cytoplasmic male sterility system to successfully create the CMS-HI line, which simultaneously carries sterile cytoplasm and haploid induction ability, accelerating the improvement and creation of CMS and providing a new approach for haploid breeding and CMS improvement and creation in Brassica napus, with broad application prospects. Attached Figure Description
[0023] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 This is an analysis of the KNL2 gene phylogenetic tree in Example 1 of the present invention.
[0025] Figure 2 This is the expression profile of the BnaKNL2 gene in wild-type tissues in Example 1 of the present invention, where A is the expression level downloaded from the BNIR database and plotted as a heatmap using TBtools, and B is the result of expression level detection based on qRT-PCR.
[0026] Figure 3 This is the subcellular localization result of BnaKNL2 in Example 1 of the present invention.
[0027] Figure 4 This is the construction of the KNL2 gene knockout vector in Example 2 of the present invention, where A is the vector PKSE401-GFP map and B is a schematic diagram of the KNL2 gene knockout target site in Brassica napus.
[0028] Figure 5The results of the editing type detection of the KNL2 gene in Brassica napus in Example 2 of the present invention are shown. A represents the base display of the Bnaknl2-1 and Bnaknl2-2 single-plant mutations, and B represents the protein display of the Bnaknl2-1 and Bnaknl2-2 single-plant mutations.
[0029] Figure 6 This is an example of BnaKNL2 gene overexpression in Example 3 of the present invention, where A is the overexpression vector construction map, B is the positive detection result of a single overexpressing plant, and C is the expression level determination of the overexpressing plant.
[0030] Figure 7 The results of pollen viability determination in Example 4 of this invention are shown, where AD represents pollen viability staining of wild type (WT), Bnaknl2-1, OE-BnaKNL2-3 and OE-BnaKNL2-18 in sequence, and E represents pollen viability statistics.
[0031] Figure 8 The results of pollen in vitro germination measurement in Example 4 of the present invention are shown, where AD represents the in vitro germination of pollen of wild type (WT), Bnaknl2-1, OE-BnaKNL2-3 and OE-BnaKNL2-18 in sequence, and E represents the pollen in vitro germination rate statistics.
[0032] Figure 9 The results of the anther semi-thin section determination in Example 4 of this invention are shown.
[0033] Figure 10 The results of the seed setting rate in Example 4 of this invention are as follows: AC represents the seed siliques of wild type (WT), Bnaknl2-1 mutant, and OE-BnaKNL2-3 overexpression line, respectively, and D represents the number of seeds per silique.
[0034] Figure 11 This is a haploid screening diagram in Example 5 of the present invention, where AD represents GFP fluorescence screening, Indel molecular marker screening, flow cytometry identification, and rapeseed 50K chip identification in sequence.
[0035] Figure 12 This is a phenotypic diagram of the haploid in Embodiment 5 of the present invention.
[0036] Figure 13 This is the phenotype of the cytoplasmic male sterility induction line (CMS-HI) in Example 5 of the present invention.
[0037] Figure 14 This is the experimental procedure for the effect of temperature treatment on HIR in Embodiment 5 of the present invention. Detailed Implementation
[0038] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.
[0039] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, such as those described in Sambrook et al.'s Molecular Cloning: A Laboratory Manual (Sambrook J & Russell DW, 2001), or according to the instructions of the biochemical reagent manufacturers. Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0040] The plant materials used in this invention include: Brassica napus Westar, and the hybrid parent materials are variegated material HY, yellow-seeded material NO2127 (HZ), glossy-leaved material W2, cytoplasmic male sterile materials hau-ganA, and pol-6330A. All materials used in the experiments were subjected to an ambient temperature of 22 ℃ and a light intensity of 100 µmol / m². -2 s -1 They were grown in a plant culture room with a photoperiod of 16 h light / 8 h darkness.
[0041] Example 1: KNL2 gene analysis in Brassica napus
[0042] 1. KNL2 gene phylogenetic analysis
[0043] This invention has discovered two KNL2 genes in Brassica napus: BnaKNL2.A02 and BnaKNL2.C02, whose nucleotide sequences are shown in SEQ ID NO.1-2 and whose encoded protein sequences are shown in SEQ ID NO.3-4.
[0044] This embodiment investigated the evolutionary relationships of the KNL2 gene among different crop species (including Arabidopsis thaliana, turnip, rapeseed, broccoli, sunflower, cotton, tobacco, maize, sorghum, rice, and wheat). KNL2 homologs from these crops were selected, and phylogenetic trees were constructed. Figure 1As shown, the results indicate that cruciferous crops (including Arabidopsis thaliana, turnip, rapeseed, and broccoli) clustered into one branch. Similarly, grasses clustered into another branch. These results suggest that KNL2 is conserved within the same family but varies between different families. The above results further show that the KNL2 gene is highly conserved in the three Brassica species, consistent with the hybrid origin of rapeseed.
[0045] Synteny analysis was performed among Arabidopsis thaliana, rapeseed, turnip, and broccoli. Two homologous genes in rapeseed were found to originate from a turnip homolog and a broccoli homolog, respectively. These results indicate that the KNL2 gene is conserved across different Brassicaceae species, and that the two homologous genes in rapeseed originated from different Brassica species but remain highly similar. Based on their chromosomal locations in rapeseed, these two homologous genes were named BnaKNL2.A02 and BnaKNL2.C02.
[0046] 2. Expression profile of BnaKNL2 gene in wild-type tissues
[0047] The expression of two homologous genes, BnaKNL2.A02 and BnaKNL2.C02, in roots, stems, leaves, 2 mm flower buds, 4 mm flower buds, and siliques was analyzed, and heatmaps were constructed using TBtools-II.
[0048] Roots, stems, leaves, 2 mm and 4 mm flower buds, sepals, petals, anthers, ovaries, and siliques of Westar rapeseed at full bloom were collected and replicated three times. Promega Eastep... TM Total RNA from rapeseed was isolated and purified using the SuperTotal RNA Extraction Kit (LS1040). The obtained RNA samples were then processed using NanoDrop. TM The concentration and purity were determined using a 2000 / 2000 C spectrophotometer. Approximately 0.5-1 μg of RNA was added to 10 μL of Loading Buffer and spotted onto a 1% agarose gel. Electrophoresis was performed at approximately 90 V (not exceeding 100 V) for 20-30 minutes. The integrity of the RNA was assessed based on the electrophoresis results, and cDNA was obtained through reverse transcription.
[0049] The cDNA obtained from reverse transcription was diluted 20-50 times and used as a template for real-time quantitative PCR. The quantitative reagent for gene expression detection was the Vazyme ChamQ Universal SYBR qPCR Master Mix (Q711-02), and the quantitative instrument was the Bio-Rad CFX96 / 384. The reaction results were analyzed using the instrument's software.
[0050] Reaction system: cDNA Template 4.2 μL, 2 × ChamQ Universal SYBR qPCR MasterMix 5 μL, Primer F 0.4 μL, Primer R 0.4 μL.
[0051] Reaction program: pre-denaturation (1 cycle), 95 °C, 30 s; cyclic reaction (40 cycles), 95 °C, 10 s, 60 °C, 30 s.
[0052] The primer sequences used are shown in SEQ ID NO.11-14, as follows:
[0053] KNL2A-qPCR-F:CGATGGAGTCTGCATCGTC
[0054] KNL2A-qPCR-R:TGACAGTGGTTTTTAACTACT
[0055] KNL2B-qPCR-F: AGCTTCTGACGGAGTCTGCA
[0056] KNL2B-qPCR-R:CAATGGTTTTAACTACTCTTC
[0057] according to Analysis results (Livak and Schmittgen 2001) show the expression profiles of the KNL2 gene in roots, stems, leaves, 2 mm flower buds, 4 mm flower buds, sepals, petals, anthers, ovaries, and siliques of Brassica napus as follows: Figure 2 As shown, the results indicate that both homologous copies are expressed in all tissues, but the expression level is highest in 2 mm flower buds and ovaries, suggesting that the BnaKNL2 gene is highly expressed during gamete development and may regulate cell division and chromosome segregation.
[0058] 3. Subcellular localization of BnaKNL2
[0059] (1) PCR reaction amplification
[0060] Amplification primers were designed based on the CDS sequences of BnaKNL2.A02 and BnaKNL2.C02 and the multiple cloning site on the pMDC83 vector. The primer sequences are shown in SEQ ID NO.15-18, as follows:
[0061] KNL2A-SBL-F: CAGGTCGACTCTAGAGGATCCATGGCTGACAATCCCAATCCCA
[0062] KNL2A-SBL-R: CTCATTTTTCTACCGGTACCCCTCTTCTTGGCTTTCGAGAAACG
[0063] KNL2B-SBL-F: CAGGTCGACTCTAGAGGATCCATGGCTGACAATCCTAATCCCAAT
[0064] KNL2B-SBL-R:TCATTTTTTCTACCGGTACCCCTCTTCTTGGCTTTCGAGAAACG
[0065] Using Westar cDNA as a template, PCR was performed using the primers described above and Phanta Max Super-Fidelity DNA Polymerase (P505-d1) from Vazyme to amplify the CDS sequences of the BnaKNL2.A02 and BnaKNL2.C02 genes as shown in SEQ ID NO.1-2, both with a sequence size of 1314 bp.
[0066] The PCR reaction system is as follows: DNA 50-200 ng, Primer F 2 μL, Primer R 2 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, dNTP Mix 1 μL, 2 × Phanta Max Buffer 25 μL, ddH2O up to 50 μL.
[0067] The PCR reaction procedure was as follows: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 s, 56 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 32 cycles; 72 ℃ further extension for 10 min, 25 ℃ for 1 min. Amplification was checked by 1% gel electrophoresis, and the product was recovered using the Adley Bio Universal Gel Recovery / DNA Cleaning and Purification Kit (DR03).
[0068] (2) Enzyme digestion of vector plasmid
[0069] The pMDC83 vector was digested using the Thermo Scientific Fast Digest restriction endonucleases BamHI (FD0054) and KpnI (FD0524). The digestion system consisted of: pMDC83 Vector 5 (0-200 ng), BamHI (1 μL), KpnI (1 μL), 10 × Fast Digest Buffer (10 μL), and ddH2O up to 50 μL. The reaction was carried out at 37 °C for 2 h, and the digestion was checked by 1% agarose gel electrophoresis. After digestion, the product was recovered using the Adley Biotechnology Universal Gel Recovery / DNA Cleaning and Purification Kit (DR03).
[0070] (3) Homologous recombination of fragments and enzyme digestion vectors
[0071] Homologous recombination of purified and recovered PCR products and enzyme digestion products was performed using the Novizumi ClonExpress II One Step Cloning Kit (C112-01). 5 µL of enzyme and 5 µL of fragment loading were added, and the reaction was carried out at 37 °C for 30 min, followed immediately by cooling on ice.
[0072] (4) Product cloning
[0073] The enzyme digestion and ligation products were transformed into DH5α competent cells for cloning.
[0074] a) Take 20-50 µL of DH 5α competent cells into a sterile centrifuge tube, add 10 µL of ligation product, gently tap the tube wall to mix, and place on ice for 20-30 min.
[0075] b) After incubating the centrifuge tubes in a water bath at 42 °C for 90 s, immediately place them on ice to cool for 2 min, then add 200 µL LLB liquid culture medium (without antibiotics), and shake at low speed (150 g) at 37 °C for 1 h.
[0076] c) Spread 100 µL of bacterial culture evenly on a plate containing 100 mg / mL kanamycin sulfate and incubate at 37 °C for 12 h-16 h.
[0077] d) Positive clones detected by colony PCR, all amplified to a size of 1970 bp.
[0078] e) Select positive clones and send them to Qingke Biotechnology Co., Ltd. for sequencing. The sequencing primers are SBL-ColA-F and SBL-ColB-F.
[0079] (5) After correct sequencing, the recombinant plasmid was transformed into Agrobacterium GV3101 using the heat shock method.
[0080] a) Take 20-50 μL of GV3101 competent cells into a sterile centrifuge tube, add 5 μL of the constructed plasmid DNA, mix gently, and place on ice for 30 min.
[0081] b) Place the above centrifuge tubes in liquid nitrogen for quick freezing for 5 min, then transfer them to a 37 ℃ water bath for heat shock for 5 min, add 800 μL LB liquid culture medium, and place them in a 28 ℃ shaker at 150 r / min for 1.5 h to recover.
[0082] c) Centrifuge at 4000 r / min for 3 min, discard the supernatant, add 100 μL of LB liquid medium, suspend the bacterial cells, and spread them on LB solid medium containing the antibiotic corresponding to the plasmid to be transformed.
[0083] d) Place the plates at 28 ℃ and incubate for 2 days until single colonies grow, for use in subsequent experiments.
[0084] (6) Agrobacterium strain GV3101 carrying the target plasmid was cultured with shaking for 48 h, centrifuged at 5000 r / min for 8 min to collect the bacteria, the supernatant was removed, and the bacteria were resuspended in invasion dye solution (10 mmol / L MgCl2, 150 μmol / L acetylsyl syringone). The bacterial culture was adjusted to OD. 600 =0.3-0.4. After incubating the prepared bacterial suspension in the dark for 2 hours, select 6-8 leaf stage *Nicotiana benthamiana* plants from the culture room and inject them until the entire leaf is saturated. The injected tobacco plants are then bagged and cultured in the dark. After 3 days, the epidermis on the underside of the leaf is peeled off with forceps and placed on a glass slide to prepare a temporary section. The temporary section is placed upside down on the stage of a laser confocal microscope (Leica, Germany) to detect the green fluorescent protein (GFP) fluorescence signal. Before observation, the cells are stained with 2 mg / mL 4′,6-diamino-2-phenylindole (DAPI) for 20 min, using a 385 nm excitation wavelength, and the DAPI fluorescence signal is observed at 488 nm to check the staining of the cell nuclei. GFP is then excited at 488 nm, and the GFP fluorescence signal is observed at 507 nm. The results are as follows. Figure 3 As shown, the results indicate that both homologous copies are located in the cell nucleus, suggesting that they participate in kinetochore localization during cell division.
[0085] Example 2: BnaKNL2 gene knockout based on the CRISPR / Cas9 system
[0086] 1. Construction of KNL2 gene knockout vector
[0087] (1) Primer design
[0088] This embodiment uses the CRISPR / Cas9 operating system to knock out the target gene. The online tool CRISPR-P 2.0 is used to predict the sgRNA sequence of the target gene. Based on factors such as target GC content, potential off-target probability, target mutation location, and whether off-target effects occur, two suitable sgRNA sequences are selected (as shown in SEQ ID NO. 5-6), as detailed below:
[0089] S1: AATGTCCAATTGAATTCCAAGG
[0090] S2: CCTACGTGGCTTTCTCAACAAA
[0091] Vector map and knockout target pattern diagram as follows Figure 4 Primers were designed by adding gene-specific target sequences to the primer template. The primers are shown in SEQ ID NO.7-10, as follows:
[0092] KNL2DT1-BsF: ATATATGGTCTCGATTGAATGTCCAATTGAATTCCAGTT
[0093] KNL2DT1-F0:TGAATGTCCAATTGAATTCCAGTTTTAGAGCTAGAAATAGC
[0094] KNL2DT2-R0:AACACGGTGGCTTTCTCAACAAACAATCTCTTAGTCGACTCTAC
[0095] KNL2DT2-BsR:ATTATTGGTCTCGAAACACGGTGGCTTTCTCAACAAACAA
[0096] (2) PCR amplification
[0097] Using TOYOBO's KOD One TM PCR Master Mix (KMM-101) was used with pCBC vector diluted 100-fold as template, -BsF / -BsR as normal primer concentration, and -F0 / -R0 diluted 20-fold for four-primer PCR amplification.
[0098] The amplification system consisted of: pCBC 2 µL, BsF 1.5 µL, BsR 1.5 µL, F0 1.5 µL, R0 1.5 µL, and KODOne. TMPCR Master Mix 25 µL, ddH2O 17 µL, reaction conditions: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 s, 60 ℃ annealing for 30 s, 68 ℃ extension for 30 s, 32 cycles; 68 ℃ further extension for 10 min, 25 ℃ cooling for 1 min.
[0099] After amplification, electrophoresis was performed using a 1% agarose gel, and the product was recovered using the Adley Bio Universal Gel Recovery / DNA Cleaning and Purification Kit (DR03).
[0100] (3) Enzyme digestion and ligation
[0101] The enzyme digestion and ligation system consisted of: 2 µL of PCR amplification product, 2 µL of PKSE401 vector, 1 µL of BsaI, 1.5 µL of 10 × Cutsmart Buffer, 1 µL of T4 Ligase, 1.5 µL of 10 × T4 Ligase Buffer, and 6 µL of ddH2O. Enzyme digestion and ligation were performed in a PCR instrument (reaction program: 37 ℃ for 5 h, 50 ℃ for 5 min, and 80 ℃ for 10 min). After enzyme digestion and ligation, the reaction system was cooled at 4 ℃ or on ice.
[0102] (4) Product cloning
[0103] The enzyme digestion and ligation products were transformed into DH5α competent cells for cloning, and the experimental steps were the same as in Example 1.
[0104] 2. Genetic transformation of hypocotyls in Brassica napus
[0105] After successful vector sequencing, the plasmid was extracted and transferred into Agrobacterium tumefaciens strain GV3101 (Video Biotechnology CAT#: AC1001) for further genetic transformation experiments. The Agrobacterium tumefaciens strain GV3101-mediated genetic transformation method was used to transform Brassica napus Westar to obtain gene-edited material. The specific transformation method is as follows:
[0106] (1) Soak rapeseed seeds in 75% alcohol for 1 min, pour the soaked seeds into a sterile culture box, rinse with sterile water, add an appropriate amount of disinfectant HgCl2 (0.1%-0.2%), sterilize for 15 min-20 min; then rinse the seeds with sterile water 4-5 times.
[0107] (2) Sterilize the tweezers with high temperature, cool them, and then sow them. Sow the sterilized seeds onto M0 medium, with 30-40 seeds in each sowing box. Place the sterile culture box in a dark environment at 24 ℃ for 5-6 days.
[0108] (4) One day before infection, Agrobacterium was added to LB liquid medium containing the corresponding antibiotic at a volume ratio of 1:1000 and cultured at 28 °C for 12-16 h until the OD of the bacterial culture was reached. 600 =0.3-0.4;
[0109] (5) Centrifuge the cultured Agrobacterium at 6000 g for 10 min and collect the bacterial cells. Discard the supernatant and resuspend the cells in 10 mL of DM liquid medium for later use;
[0110] (6) Use sterile forceps and a scalpel to cut the hypocotyls of etiolated seedlings 6 days after sowing. The cut hypocotyls are the explant material at the time of infection. Each explant is 0.8-1.0 cm long.
[0111] (7) Place the cut explants into a sterilized glass dish and infect them with Agrobacterium tumefaciens solution containing DM liquid medium for 10-15 min, shaking once every 5 min.
[0112] (8) After infection, pour off the bacterial solution, use sterile filter paper to absorb the remaining bacterial solution, and dry the explants in a clean bench. Then transfer the explants to M1 solid culture medium and place them in the dark at 24 ℃ for 36-48 h.
[0113] (9) Transfer the explants on M1 medium to M2 medium and add the appropriate antibiotics for screening;
[0114] (10) After culturing on M2 medium for 3 weeks, the explants were transferred to M3 differentiation medium and subcultured every 2-3 weeks until green shoots appeared. After the green shoots appeared, the green shoots containing the growth points were cut off with a scalpel and placed into M4 rooting medium. After the roots grew strong, the transgenic positive plants were transplanted to a greenhouse or transgenic experimental field.
[0115] 3. Hi-TOM high-throughput sequencing determined the mutant genotype of the edited single plant.
[0116] To enable high-throughput detection of gene mutations in transgenic positive single plants and their offspring, two rounds of overlap PCR were performed according to the method of Liu et al., followed by high-throughput sequencing of self-built libraries (Liu et al 2019).
[0117] (1) First round of PCR amplification
[0118] Design specific primers and add adapter sequences to their 5′ ends (5′-ggagtgagtacggtgtgc-3′ added to the 5′ end of the F primer, and 5′-gagttggatgctggatgg-3′ added to the 5′ end of the R primer). The primers for the first round of PCR are shown in SEQ ID NO.19-22, as follows:
[0119] HI-KNL2-A02-F:
[0120] ggagtgagtacggtgtgcCCAATCCCAATCCAGACGAGGA
[0121] HI-KNL2-A02-R:
[0122] gagttggatgctggatggCTGAGGGAGGAATCCAGACTGA
[0123] HI-KNL2-C02-F:
[0124] ggagtgagtacggtgtgcCTAATCCCAATCCAGACGAGGA
[0125] HI-KNL2-C02-R:
[0126] gagttggatgctggatggCTGAGGGAGGAATCCAGAGTGA
[0127] The first round of PCR amplification was performed using Vazyme 2 × Taq Master Mix (Dye Plus) (P112-01). The amplification system consisted of: DNA 1 µL, Primer F 0.5 µL, Primer R 0.5 µL, 2 × Taq Master Mix 5 µL, and ddH2O 3 µL. The reaction conditions were: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 56 °C annealing for 30 s, 72 °C extension for 30 s, for 32 cycles; 72 °C final extension for 10 min; and 25 °C cooling for 1 min.
[0128] The amplification products were 184 bp and 202 bp in size, respectively. 5 µL of the first-round amplification product was taken for electrophoresis to determine its amplification specificity and amplification brightness.
[0129] (2) Second round of PCR amplification
[0130] The first-round PCR product, diluted 10-40 times, was used as a DNA template and universal primers for amplification. The universal primers consisted of 12 F primers (F1-F12), 8 R primers (RA-RH), and a pair of index primers. The 12 F primers (F1-F12) and 8 R primers (RA-RH) were mixed according to the corresponding primer combinations for a 96-well plate to prepare the primer mix.
[0131] The second round of PCR amplification was performed using Vazyme 2 × Taq Master Mix (Dye Plus) (P112-01). The amplification system consisted of: DNA 1 µL, Index Primer F 0.2 µL, Index Primer R 0.2 µL, Primer Mix 3 µL, 2 × Taq Master Mix 5 µL, and ddH2O 0.6 µL. The reaction conditions were: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 56 °C annealing for 30 s, 72 °C extension for 30 s, for 32 cycles; 72 °C final extension for 10 min; and 25 °C cooling for 1 min.
[0132] After amplification, 5 µL of the second-round PCR product was subjected to gel electrophoresis to determine its amplification specificity and intensity. If the intensity of each well was similar, 1 µL of amplified product from each well on each PCR plate was mixed thoroughly. If the intensity of individual wells differed significantly, adjustments needed to be made during mixing to ensure that the PCR product in each well was mixed in equal volumes. 50 µL of the mixture was then purified and recovered via gel electrophoresis. The recovered product was sent to Shanghai Paisenno Biotechnology Co., Ltd. for next-generation sequencing. Typically, the data size for each sample on each plate is 1 GB.
[0133] (3) Sequencing data analysis
[0134] By submitting paired-end sequencing files and reference sequence files online through the Hi-Tom website, the mutation status of edited individual plants was analyzed, and the final editing status of individual plants is as follows: Figure 5 As shown. Hi-TOM analysis revealed that at target site 1 (T1), the mutant bnaknl2-1.A02 / C02 exhibited an insertion and deletion of the base "T" (in a 50:50 ratio). Similarly, at target site 2 (T2), the mutant bnaknl2-1.A02 / C02 showed an insertion of two bases, "T" and "A", in a 50:50 ratio. In the second type of mutant bnaknl2-2, at target site 1 (T1), the homologous copy bnaknl2-2.A02 had a 70% probability of inserting a base "T" and a 30% probability of deleting three bases "ATT"; while the other homologous copy bnaknl2-2.C02 showed an insertion of a base "T". At target site 2 (T2), both homologous copies bnaknl2-2.A02 and C02 showed an insertion of a base "T" ( Figure 5A). Protein chain analysis showed that the wild-type BnaKNLl2 protein chain is 438 amino acids long (aa). In both mutant types (bnaknl2-1.A02 / C02 and bnaknl2-2.A02 / C02), the protein chain is altered at amino acid 36 and terminates prematurely at amino acid 48. Compared to the wild type, this mutant protein chain is extremely short (aa). Figure 5 B).
[0135] Example 3: BnaKNL2 gene overexpression
[0136] 1. Construction of overexpression vectors
[0137] (1) Primer design
[0138] In this embodiment, the overexpression vector pC2306-Dsred was used. Specific primers were designed based on the Westar reference gene sequence to amplify the coding sequences of the target genes bnaknl2.A02 and bnaknl2.C02. After purification and recovery, the amplified sequences were recombined into pC2306-Dsred. The primer sequences are shown in SEQ ID NO.23-26, as follows:
[0139] OE-KNL2-A02-F:GAGCTCGGTACCCGGGGATCCATGGCTGACAATCCCAATCCC
[0140] OE-KNL2-A02-R: GGCGAATTGGTCGACTCTAGATCATCTTCTTGGCTTTCGAGAAA
[0141] OE-KNL2-C02-F:GAGCTCGGTACCCGGGGATCCATGGCTGACAATCCTAATCCC
[0142] OE-KNL2-C02-R:ATTGGTCGACTCTAGATCATCTTCTTGGCTTTCGAGAAACG
[0143] (2) PCR amplification
[0144] PCR amplification was performed using Westar anther cDNA as a template. The amplification system (50 µl) consisted of: 2 µl template cDNA; 2 µl primers F / R; 1 µl Phanta Max Super-Fidelity DNA Polymerase; 25 µl 2×NEB Phanta Max Buffer; 1 µl dNTP Mix; and 19 µl ddH2O. The reaction conditions were: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 60 °C annealing for 30 s, and 68 °C extension for 30 s, for 32 cycles; 68 °C final extension for 10 min; and cooling at 25 °C for 1 min. The total length of the amplified fragments was 1314 bp. After amplification, electrophoresis was performed on a 1% agarose gel, and the products were recovered using the Adley Bio Universal Gel Recovery / DNA Cleaning and Purification Kit (DR03).
[0145] (3) Homologous recombination
[0146] Vector linearization was performed using restriction enzymes from Thermo Fisher Scientific at 37 °C for 3 h. The restriction sites for target gene recombination were SalⅠ and XmaⅠ. The reaction system was as follows: pC2306 plasmid 30 µl; enzyme 1.5 µl; buffer 10 µl; total 50 µl. Product recovery was performed using the Adley Bio Universal Gel Recovery / DNA Cleaning and Purification Kit (DR03).
[0147] The vector backbone and target fragment were recombined using ABclonal's 2X MultiF Seamless Assembly Mix recombinase. The required vector and fragment volumes were calculated according to the instructions, and the reaction was carried out in a PCR amplification instrument at 50 °C for 20 min.
[0148] (4) Product cloning
[0149] The enzyme digestion and ligation products were transformed into DH5α competent cells for cloning, and the experimental steps were the same as in Example 1.
[0150] 2. Obtaining positive plants through genetic transformation
[0151] (1) The genetic transformation experiment of hypocotyl of Brassica napus was the same as in Example 2.
[0152] (2) Twenty OE-bnaknl2.A02 and 24 OE-bnaknl2.C02 transgenic plants were obtained respectively. Specific primers were used to detect overexpression-positive plants. The results showed that only 5 OE-bnaknl2.A02 transgenic plants were positive, while 7 OE-bnaknl2.C02 plants were positive. Figure 6 B).
[0153] (3) Real-time quantitative PCR (RT-qPCR): Anthers of Westar plants in full bloom and transgenic positive plants were collected and subjected to three biological replicates. The qRT-PCR experimental procedure was the same as in Example 1. The reaction system consisted of: 4.2 μL cDNA template, 5 μL 2 × ChamQUniversal SYBR qPCR Master Mix, 0.25 μL primer F / R, and 0.3 μL ddH2O. The reaction program was: 95 ℃ for 30 s, followed by 40 cycles of 95 ℃ for 10 s and 60 ℃ for 30 s. (Following Example 2) −ΔΔCt The analysis revealed that the expression levels of two homologous copies were determined in both overexpression plants. The detection primers are shown in SEQ ID NO.27-30, and are detailed below:
[0154] RT-KNL2-A02-F:ACTGGGAATCAAAATGTAAC
[0155] RT-KNL2-A02-R:TCATCAGTTCAACAGATTTG
[0156] RT-KNL2-C02-F:ACTCTGGATTCCTCCCTCAG
[0157] RT-KNL2-C02-R:TCATTAGTAGAAGAAGTAGTC
[0158] The results are as follows Figure 6 As shown in Figure C, the results indicate that three strains of OE-bnaknl2.A02 (OE-bnaknl2-3, OE-bnaknl2-14, and OE-bnaknl2-15) overexpressed two homologous copies, while two strains of OE-bnaknl2.C02 (OE-bnaknl2-18 and OE-bnaknl2-40) overexpressed two homologous copies.
[0159] Example 4: Phenotypic determination of BnaKNL2 gene knockout and overexpression plants
[0160] 1. Pollen viability analysis and in vitro germination
[0161] To analyze the effects of BnaKNL2 gene knockout and overexpression on pollen viability, pollen staining was performed on WT and transgenic plants. A drop of acetic carmine staining solution was added to a glass slide. Flower buds about to open were collected that day, and individual anthers were picked up with tweezers and squeezed to transfer some pollen onto the slide, spreading it evenly. A coverslip was then placed on top, and the staining solution was washed off with distilled water. The slide was immediately placed under a Zeiss microscope for observation, photography, and pollination. Results are as follows: Figure 7As shown, the results indicated a highly significant difference in pollen viability between WT and the knockout mutant bnaknl2-1, while no significant difference was observed between WT and plants overexpressing OE-bnaknl2. In the knockout mutant, pollen viability was reduced by nearly 50%, indicating that knockout of the BnaKNL2 gene significantly affects pollen development.
[0162] Further in vitro pollen germination analysis was performed. Pollen from DWT, bnaknl2-1, OE-bnaknl2-3, and OE-bnaknl2-18 was collected and cultured in pollen germination medium. 50 μL of medium solution was pipetted from a centrifuge tube and gently dropped onto a concave glass slide to form a spherical droplet. One well-dispersed stamen was picked up with forceps and its pollen was dispersed onto the concave glass slide. The slide was placed in a petri dish lined with moistened filter paper, without a coverslip, and the dish was tightly covered and incubated in the dark at room temperature for 2 hours. Germination was then observed under a microscope, and the number of germinating pollen grains was counted. Pollen germination rate was calculated by randomly observing three fields of view, with at least 100 pollen grains observed in each field, repeated three times. The pollen germination standard was defined as a pollen tube length greater than 1 / 2 or 2 times the pollen grain diameter. Results are as follows: Figure 8 As shown, the results indicated a significant difference in pollen growth between WT and bnaknl2-1, while there was no significant difference between WT and OE-bnaknl2. After 12 hours of in vitro culture, the pollen germination rate of WT was approximately 60%, while that of bnaknl2-1 was only 20%.
[0163] 2. Thin slices of anther
[0164] The internal anatomical structure of anthers in wild-type and mutant plants was observed using a semi-thin section technique. New flower buds from both wild-type and mutant plants were collected and fixed with FAA fixative for one day. The following day, the samples were sequentially transferred to 60% and 70% ethanol for 1 hour each, and finally to 85% ethanol for 1 hour. Subsequently, a 95% ethanol solution containing 0.1% eosin was prepared, and the samples were transferred to this solution and stained overnight at room temperature. The next day, the eosin solution was discarded, and the samples were treated in 100% ethanol for 30 minutes; this step was repeated twice. Next, the samples were immersed in fresh 100% ethanol for 1 hour, and this step was repeated once. Subsequently, the samples were sequentially treated in the following solutions for 1 hour each: xylene:ethanol = 1:3, 2:2, and 3:1, and finally in pure xylene (100%) for 1 hour; this final step was repeated twice. After completing the above steps, fresh pure xylene and one-quarter of the total volume of paraffin were added to the samples. The samples were then incubated overnight at 60°C. Over the next four days, the paraffin-containing solution was changed every 12 hours. Afterward, the sample was embedded in a paraffin block and stored at 4°C.
[0165] Trim the paraffin block to remove excess paraffin that does not contain tissue. Prepare sections to a thickness of 0.5 micrometers using a rotary microtome. Place a small drop of water on a glass slide and transfer the section onto the water drop. Mark the slide and place it on a 42°C heating plate until the section is completely dry.
[0166] The results are as follows Figure 9 As shown, the results indicate that the tapetum development in the anthers of some mutant bnaknl2 plants is uneven, which may have a negative impact on pollen development.
[0167] 3. Fruit setting rate statistics
[0168] The effect of BnaKNL2 gene mutation on seed setting rate was analyzed. WT, the mutant bnaknl2-1, and the overexpression line OE-BnaKNL2-3 were self-crossed, and the number of seeds per pod was counted and statistically analyzed. The results showed a significant difference in seed setting rate between WT and transgenic plants; the seed setting rate of both transgenic lines (knockout and overexpression lines) was decreased. Figure 10 ).
[0169] Example 5: Verification of the bidirectional haploid induction characteristics of the bnaknl2 mutant
[0170] Based on the above embodiments, it can be found that the KNL2 gene of Brassica napus is a key gene affecting its fertility. This embodiment further verifies the application of this gene in the creation of haploid induction lines based on the bnaknl2 mutant.
[0171] 1. Haploid Identification Methods
[0172] (1) GFP fluorescence screening
[0173] Potential haploids in the hybrids of + / -bnaknl2 inducible lines and wild-type materials were screened using a LUYOR-3415RG dual-wavelength fluorescent protein excitation light source from LUYOR (USA). Seeds to be tested were spread evenly in petri dishes containing moistened filter paper and germinated at room temperature in the dark. After approximately 30 hours, the radicle emerged from the seed coat. The radicles of the inducible lines were irradiated with a GFP excitation light source; those showing fluorescence were hybrids, while those without fluorescence were potential haploid plants. Non-fluorescent seeds were placed in germination boxes containing Hogland nutrient solution for further screening. Figure 11 A).
[0174] (2) Indel molecular marker screening
[0175] Next, the Indel molecular markers used for haploid selection were applied to the plants in the germination box. These markers are co-dominant; if the plant is haploid, the Indel band should be a single band. Figure 11B). By performing marker-assisted selection on the hybrid progeny, heterozygous single plants were discarded, and the remaining plants were used for further screening experiments. The Indel molecular marker sequences used are shown in SEQ ID NO. 31-38, as follows:
[0176] C01-3-F:ACGGAGCAGTCGAACAGG
[0177] C01-3-R:TGGGTCTCTCTCACAGCCT
[0178] C02-1-F:TCACCACCACACAAATCGAGA
[0179] C02-1-R:ACTTCAAGTCGGCTGCTGT
[0180] C01-5-F:TCTTCCCACCAGCCGAGA
[0181] C01-5-R:CAGTAGCCTGACCCAAGCA
[0182] C09-1-F:TCATGTGCCCTCAGGACA
[0183] C09-1-R: GCGAAGTTGAACTTGCAGCA
[0184] (3) Flow cytometry for cell ploidy identification
[0185] Pluripotency of potential haploid plants was determined using a Sysmex CyStain UV Precise P (05-5002). Approximately 0.5 cm of sample was taken. 2 The leaf samples were placed in a petri dish, and 0.5 mL of Nuclei Extraction Buffer was added. The leaves were then chopped using a blade and incubated at room temperature for 1 min. CellTrics samples were then used. ® The sample was filtered through a filter (04-0042-2317) into a sample tube (04-2000). 2.0 mL of Staining Buffer was added to the sample tube, and the mixture was incubated at room temperature for 1 min. Samples were loaded and analyzed using a Sysmex CyFlow Ploidy Analyzer. FlowJo v10 software was used for analysis and plotting. The peak fluorescence intensity for haploid cells was approximately 625, with a relative DNA content of approximately 3750; while the peak fluorescence intensity for diploid cells was approximately 875, with a relative DNA content of approximately 7500. Figure 11 C).
[0186] (4) Rapeseed 50K chip typing
[0187] The Bnapus50K SNP chip technology of Brassica napus was used to genotype hybrid parents and haploid plants, and to identify the genetic background of haploid plants (Xiao Qing 2022).
[0188] a) Rapeseed 50K chip typing process
[0189] Reagents: DNA (50 ng / µL, 4 µL), NaOH (0.1 mol / L, NaOH), isopropanol, 95% formamide / 1 mM EDTA, MA1, MA2, MSM, FMS, PM1, PB1, PB2, RA1, XC1, XC2, XC3, XC4, TEM, ATM, STM.
[0190] Tools: MSA3 plate, hybridization furnace, rack, 24-hole SNP chip.
[0191] 1) DNA quantification and DNA amplification: Add 20 µL MA1, 4 µL DNA and 4 µL 0.1 mol / L NaOH to the MSA3 plate, shake at 1600 g for 1 min, centrifuge at 280 g for 1 min, and let stand for 10 min; then add 34 µL MA2 and 38 µL MSM, shake at 1600 g for 1 min, centrifuge at 280 g for 1 min; place in a hybridization oven at 37 ℃ for 20-24 h;
[0192] 2) DNA fragmentation: Preheat the dry bath to 37 °C; remove the FMS from the freezer to thaw, gently invert to mix, and centrifuge at 280 g for 1 min; remove the MSA3 plate from the hybridization oven and centrifuge at 50 g for 1 min; add 25 µL of FMS, cover, vortex at 1600 g for 1 min, centrifuge at 22 °C for 1 min at 50 g, and dry bath at 37 °C for 1 h;
[0193] 3) DNA enrichment: Add 50 µL PM1 to the MSA3 plate, cover, shake at 1600 g for 1 min, dry in a 37 ℃ bath for 5 min, centrifuge at 22 ℃ for 1 min at 50 g; add 155 µL isopropanol, cover with a new lid, invert 10 times; place in a 4 ℃ refrigerator for 30 min, centrifuge at 4 ℃ for 20 min at 2200 g; remove the lid, pour out the liquid, invert on clean filter paper, and dry at room temperature for 1 h;
[0194] 4) DNA fragment recovery: Adjust the hybridization oven temperature to 48 ℃, preheat the sealing machine for 20 min, thaw RA1 at room temperature, and gently invert to dissolve; add 23 µL RA1 to the MSA3 plate; seal with aluminum foil and incubate at 170 ℃ for 5 s; incubate in the hybridization oven at 48 ℃ for 1 h, shake at 1600 g for 1 min, and centrifuge at 280 g for 1 min;
[0195] 5) DNA denaturation: Denature the MSA3 plate in a 95 ℃ dry bath for 20 min, then cool to room temperature for 30 min;
[0196] 6) DNA Hybridization with Chips: Prepare the hybridization box and chips. Place a gasket in the hybridization box, add 400 µL of PB2 to each of the 8 small slots in the hybridization box, and close the lid. Take the chips out of the 4 ℃ freezer and place them in the corresponding positions in the hybridization box, ensuring that the barcode positions on the chips correspond to the barcode positions in the hybridization box. Apply 12 µL of sample to each well of each chip, carefully applying the sample vertically with a multi-channel pipette, avoiding air bubbles, and ensuring that the DNA covers the magnetic bead stripe area.
[0197] 7) Resuspension using XC4 reagent: Place the hybridization box with the spotted sample in a hybridization oven at 48 ℃ for 16-24 h, and adjust the speed to 5; add 330 mL of anhydrous ethanol to XC4, shake vigorously for 15 s, and let it stand overnight at room temperature until ready for use;
[0198] 8) Cleaning the chips: Remove the hybridization box from the 48 ℃ hybridization oven and let it cool to room temperature for 25 min. Adjust the water circulation system to 44 ℃. Add 200 mL of PB1 to two glass tanks, and place a washing rack in one of them. Remove the chips from the box and, wearing powder-free gloves, peel off the chip seal along the diagonal. Quickly place the chips in the washing rack and soak them in PB1, keeping the chip surface away from you. Carefully lift the rack up and down for 1 min, and wash the other rack for 1 min in the same way.
[0199] 9) Install the flow chamber: Add 150 ml of PB1 to the installation box and place the black frame inside; remove the chip and place it back into the black frame in the installation box, ensuring the barcode on the chip is aligned with the barcode on the installation box, so that the chip is completely submerged in PB1; remove the white protective layer from the surface of the plastic gasket, place the plastic gasket on the chip and fit it onto the corresponding protrusion in the installation box; place the positioning rod, place the cleaning slide on the chip, with one sloping end facing the barcode and the slope facing down, forming a sample loading groove with the chip, and secure it with metal clips; remove the chip from the installation box and assemble it, trimming off any excess gasket at both ends with scissors; clean the PB1 in the box with ddH2O;
[0200] 10) Single base extension: After installation, place the tube in a 44 ℃ circulating water bath. Add the following reagents to the flow chamber sequentially: 150 µL RA1, incubate for 30 s, repeat 5 times for a total of 6 times; 450 µL XC1, incubate for 10 min; 450 µL XC2, incubate for 10 min; 200 µL TEM, incubate for 15 min; 450 µL 95% formamide / 1 mM EDTA, incubate for 1 min; 450 µL 95% formamide / 1 mM EDTA, incubate for 6 min; adjust the circulating water bath temperature to 32 ℃ according to the temperature on the STM tube; 450 µL XC3, incubate for 1 min; 450 µL XC3, incubate for 1 min; wait for the circulating water bath to reach 32 ℃.
[0201] 11) Chip staining: Add the following reagents sequentially to the flow cell: 250 µL STM for 10 min; 450 µL XC3 for 1 min; 450 µL XC3 for 6 min; 250 µL ATM for 10 min; 450 µL XC3 for 1 min; 450 µL XC3 for 6 min; 250 µL STM for 10 min; 450 µL XC3 for 1 min; 450 µL XC3 for 6 min; 250 µL ATM for 10 min; 450 µL XC3 for 1 min; 450 µL XC3 for 6 min; 250 µL STM for 10 min; 450 µL XC3 for 1 min; 450 µL XC3 for 6 min; quickly remove the flow cell and incubate at room temperature.
[0202] 12) Washing and embedding: Add 310 mL of PB1 (8 chips) to the washing box and insert the staining rack with the locking arm facing you; remove the two metal clips, remove the slide, carefully remove the gasket, avoiding the magnetic bead area, remove the chip, and place it in the staining rack with the chip surface away from you; lift the staining rack up and down 10 times; soak for 5 minutes, shake the XC4 vigorously to resuspend it, and let it stand to allow the air bubbles to disappear; add the XC4 to another box and let it stand for no more than 10 minutes; transfer the staining rack into the XC4, lift the staining rack up and down 10 times, and soak for 5 minutes; place the staining rack on the test tube rack with the chip horizontal and the barcode facing upwards; place the chip in the test tube and put it in the vacuum pump for 1 hour; store the chip at room temperature for 72 hours (it can be stored for about 15 days at 4 ℃ in the dark), clean and dry each device, or blot dry with absorbent paper, and place it in its original place.
[0203] b) Chip scanning and data analysis
[0204] The back of the chip was wiped clean with a lint-free soft cloth dampened with anhydrous ethanol and placed in the HiScan chip scanner from Illumina (www.illumina.com). The scanner used a laser to excite the fluorescent groups of the single-base extension products on the chip, capturing the fluorescence emitted by these groups to generate a high-resolution image, and then exported the scan results. The scanned data was imported into GenomeStudio 2.0.4 software (Version 2015, Illumina Inc.) (Staaf et al. 2008) to extract the chip data and perform genotyping, obtaining SNP genotyping data for each sample. Figure 11 D).
[0205] 2. Haploid detection results
[0206] Based on the gene editing technology of Example 2, mutant plants with double mutations of bnaknl2.A02 and bnaknl2.C02 (bnaknl2-1, bnaknl2-2) were obtained. These mutants were used as male or female parents and crossed with four other Brassica napus varieties (variegated material HY, yellow-seeded material NO2127, glossy-leaved material W2, and cytoplasmic male-sterile material hau-ganA). The number of haploids produced in the offspring and the haploid induction rate (HIR) were detected using the haploid identification method described above. Wild-type (Brassica napus Westar) was used as a control. The results are shown in Table 1.
[0207] Table 1 Results of haploid induction rate determination
[0208]
[0209] The results showed that the control group WT did not produce haploids after hybridization with other varieties. However, when the mutant plants were used as the female parent to hybridize with other varieties of Brassica napus, the seeds of the hybrid offspring contained normal allotetraploids and haploid seeds containing only the paternal chromosomes (i.e., paternal haploids were induced). When the mutant plants were used as the male parent to hybridize with different varieties of female parents, the seeds of the hybrid offspring also contained normal allotetraploids and haploid seeds containing only the maternal chromosomes (i.e., maternal haploids were induced). In other words, when the bnaknl2 mutant plants were used as the male or female parent to hybridize with other varieties, haploid plants could be screened out in multiple generations (T0, T1, T2), with a haploid induction efficiency of 0.45%-2.7%. Phenotypic observation showed that the obtained haploid plants all exhibited narrower plant types and lower seed setting rates, consistent with the characteristics of haploids. Figure 12 The above results fully confirm the bidirectional haploid induction characteristics of the bnaknl2 mutant. By knocking out the KNL2 gene in Brassica napus, haploid induction lines with maternal or paternal haploid induction capabilities can be created.
[0210] 3. Creation of a cytoplasmic male sterility induction line (CMS-HI) based on the bnaknl2 mutant.
[0211] Utilizing the bidirectional haploid induction characteristic of the bnaknl2 mutant, the bnaknl2 mutant can be used as the male parent and crossed with two different types of cytoplasmic male sterile lines: polima CMS (pol-6330A) and hau CMS (hau-ganA). In the F1 generation, backcrossing is performed again using F1 as the female parent and bnaknl2 as the male parent. In each subsequent generation (e.g., F1BC1, F1BC2, and F1BC3), selection is based on SSR markers (Bakhsh et al. 2025) to ensure that plants carrying polima and hau cytoplasm and possessing the bnaknl2 genetic background are selected for the next generation of propagation. In the F1BC3 generation, genotypic background selection is performed using a 50K SNP chip to ensure that the obtained CMS-HI (cytoplasmic male sterility-haploid induction) line (…)… Figure 13 It has the genetic background of bnaknl2 and carries sterile polima or hau cytoplasm, which can be used to accelerate the breeding and seed production process of superior hybrids of Brassica napus.
[0212] 4. The effect of temperature treatment on HIR
[0213] Centromere response genes are significantly affected by temperature fluctuations. To test the effect of temperature on the HIR of the bnaknl2 mutant, bnaknl2-1 mutant plants were grown under standard conditions and high-temperature stress conditions. Different WT varieties and bnaknl2-1 were initially grown under standard conditions. At flowering, half of the bnaknl2-1 plants were transferred to 25°C for 3 days, followed by 28°C for 3 days, and then crossed with WT varieties after the flowers opened. After successful hybridization, the bnaknl2-1 mutant plants were maintained at the same temperature for 3 days, then transferred to 25°C for 3 days, and finally returned to standard conditions for seed growth and maturation.
[0214] The haploid induction rate (HIR) was detected using the above-mentioned haploid identification method. The results showed that when bnaknl2-1 was used as the paternal parent, the HIR did not increase and remained between 2% and 2.2%; however, when it was used as the maternal parent, the HIR increased by 3 to 4 times, reaching 6.7% (Table 2). These results indicate that high temperature plays an important role in increasing HIR during fertilization and embryonic development.
[0215] Table 2
[0216]
[0217] In summary, this invention has discovered that the BnaKNL2 gene in Brassica napus is a key gene affecting its fertility, and further explored new functions for creating materials with bidirectional haploid induction characteristics based on this gene. Specifically, by knocking out the BnaKNL2 gene in Brassica napus using gene knockout technology, a bifunctional inducible line can be created that can both induce paternal haploids as the maternal parent and induce maternal haploids as the paternal parent. The haploid induction rate of this inducible line after hybridization with materials from different genetic backgrounds reaches 0.45%-2.7%, and short-term high-temperature stress can increase its maternal induction efficiency by 3-4 times. Furthermore, this invention utilizes the dual function of this inducible line and combines it with a cytoplasmic male sterility system. Through hybridization and backcrossing, a CMS-HI line carrying both sterile cytoplasm and haploid induction capabilities is rapidly created to accelerate the breeding and seed production process of superior hybrids of Brassica napus. This invention provides a new approach for haploid breeding and the improvement and creation of CMS in Brassica napus, with broad application prospects.
[0218] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
Claims
1. The application of the BnaKNL2 gene or its gene expression inhibitor or its protein expression inhibitor in any of the following: A1) Application in the preparation of bifunctional haploid induction lines for Brassica napus; A2) Application in the breeding of cabbage-type oilseeds; The amino acid sequence encoded by the BnaKNL2 gene is shown in any of SEQ ID NO. 3-4.
2. The application according to claim 1, characterized in that, The nucleotide sequence of the BnaKNL2 gene is shown in any one of SEQ ID NO. 1-2.
3. The application according to claim 1, characterized in that, The gene expression inhibitor includes sgRNA, the sequence of which is shown as any one or two of SEQ ID NO. 5-6.
4. The application according to claim 1, characterized in that, By silencing or inhibiting the expression and / or activity of the BnaKNL2 gene, or knocking out the BnaKNL2 gene, transgenic plants can be obtained, thus preparing a bifunctional haploid inducible line of Brassica napus; or by further hybridizing the transgenic plants or their offspring with other Brassica napus lines as male or female parents to obtain hybrid offspring, a monoploid Brassica napus can be obtained.
5. The application according to claim 1, characterized in that, The BnaKNL2 gene was edited using CRISPR / Cas9 system-mediated gene editing technology, with the sgRNA sequence shown as any one or two of SEQ ID NO. 5-6.
6. A method for preparing a bifunctional haploid inducible line of Brassica napus, characterized in that, The procedure includes the following steps: by silencing or inhibiting the expression and / or activity of the BnaKNL2 gene, or by knocking out the BnaKNL2 gene, transgenic plants are obtained, thus obtaining a bifunctional haploid inducible line of Brassica napus; wherein the amino acid sequence encoded by the BnaKNL2 gene is shown in any one of SEQ ID NO. 3-4.
7. The method according to claim 6, characterized in that, The BnaKNL2 gene was edited using CRISPR / Cas9 system-mediated gene editing technology, and the sgRNA sequence used was shown as any one or two of SEQ ID NO. 5-6.
8. A method for preparing a botryoid of cabbage-type oil, characterized in that, The method includes: using the haploid induction line or its offspring prepared by the method according to any one of claims 6-7 as the male or female parent, and crossing it with other rapeseed lines to obtain hybrid offspring, thereby obtaining a rapeseed haploid of the Brassica napus type.
9. A method for preparing a cytoplasmic male sterility-haploid inducible line, characterized in that, The method includes: using the haploid inducing line prepared by the method according to any one of claims 6-7 as the male parent, crossing it with a cytoplasmic male sterile line to obtain the F1 generation; using the F1 generation as the female parent to backcross with the haploid inducing line prepared by the method according to any one of claims 6-7, and screening for plants carrying sterile cytoplasm and with a mutation in the BnaKNL2 gene in the offspring, thereby obtaining a cytoplasmic male sterile-haploid inducing line.
10. A method for preparing a BnaKNL2 gene expression inhibitor for a bifunctional haploid inducible line of Brassica napus, characterized in that, The gene expression inhibitor includes sgRNA, the sequence of which is shown as any one or two of SEQ ID NO. 5-6.