Nucleic acid combination, kit for identification of mycobacteria and use thereof

Abstract

This application belongs to the field of molecular biology technology, specifically relating to nucleic acid combo products, kits for mycobacterial identification, and their applications. This application provides a nucleic acid combo product for mycobacterial detection, comprising one or more primer pairs with nucleotide sequences as shown in SEQ ID NO.1 to SEQ ID NO.244. This specific primer combination can simultaneously detect multiple mycobacteria and distinguish them down to the subspecies level. Through highly specific primer design, this nucleic acid combo product can achieve accurate identification of common clinical mycobacteria (including complex groups, species, and subspecies levels), with a detection sensitivity of 50-100 CFU / mL, significantly superior to the detection performance of existing technologies. Furthermore, the nucleic acid combo product of this application can not only identify the species of mycobacteria but also simultaneously detect drug resistance gene mutations, providing important evidence for the selection of clinical treatment regimens.

Description

Technical Field

[0001] This application belongs to the field of molecular biology technology, specifically involving nucleic acid combinatorial products, kits for the identification of mycobacteria, and their applications. Background Technology

[0002] Mycobacteria are an important class of pathogenic microorganisms. The Mycobacterium tuberculosis complex is the main pathogen causing tuberculosis, while there are over 200 species of non-tuberculous mycobacteria, and their infection incidence is showing a significant upward trend globally. Mycobacterial diseases remain a major global public health threat. Traditional diagnostic procedures for mycobacterial infections are complex and time-consuming, becoming a bottleneck for effective clinical prevention and control of these diseases. Traditional mycobacterial detection methods mainly rely on smear microscopy, bacterial culture, and biochemical identification. However, smear microscopy has low sensitivity; culture, as the gold standard, takes 2-8 weeks, failing to meet the urgent clinical need for early and rapid diagnosis of key infectious diseases such as tuberculosis.

[0003] Molecular biology methods, such as conventional PCR, while shortening detection time, have limited throughput, often making it difficult to simultaneously and accurately identify multiple mycobacteria and analyze drug resistance in a single reaction, let alone distinguish subspecies. Platforms like GeneXSEQ ID NO.ert primarily focus on Mycobacterium tuberculosis complexes and individual drug resistance genes, failing to address the increasing prevalence and complex drug resistance profiles of non-tuberculous mycobacteria. High-throughput sequencing technologies, especially targeted sequencing, show potential to solve these challenges. Expert consensus indicates that tNGS is suitable for cases with negative pathogens but high clinical suspicion of mycobacterial infection, aiding in diagnosis and rapid identification of drug resistance. Compared to metagenomic sequencing, tNGS significantly improves the detection sensitivity of target pathogens and the utilization rate of sequencing data through targeted enrichment, making it more feasible and cost-effective for drug resistance gene analysis. Existing technologies have attempted to utilize tNGS for mycobacterial detection; for example, some protocols can simultaneously detect resistance genes of 47 mycobacteria and 20 drugs.

[0004] However, current technologies have significant shortcomings: for example, some patented technologies can only distinguish between tuberculous and non-tuberculous mycobacteria, and cannot perform drug resistance site analysis; other technologies are limited by the resolution of the detected target, making it difficult to achieve accurate subspecies identification, which is crucial for the selection of treatment regimens for certain NTM species. In addition, some technologies suffer from problems such as uneven primer amplification efficiency, poor detection sensitivity, and cross-reactivity between species, leading to issues in result interpretation. Summary of the Invention

[0005] Based on this, one embodiment of this application provides nucleic acid combination products, kits for mycobacterial identification, and their applications.

[0006] This application provides a nucleic acid combination product comprising one or more primer pairs with nucleotide sequences as shown in SEQ ID NO.1 to SEQ ID NO.244.

[0007] In some embodiments, each primer in the primer pair is also attached with a tag.

[0008] In some embodiments, the nucleotide sequence of the tag is as shown in SEQ ID NO.245 or SEQ ID NO.246.

[0009] In some embodiments, the primer pair consists of an F primer and an R primer; the F primer has the nucleotide sequences shown in SEQ ID NO.1-SEQ ID NO.122; and the R primer has the nucleotide sequences shown in SEQ ID NO.123-SEQ ID NO.244.

[0010] Another aspect of this application provides a kit for the identification of mycobacteria, the kit comprising the aforementioned nucleic acid combination product.

[0011] In some embodiments, the kit further includes one or more of PCR amplification reagents, negative controls, and positive controls.

[0012] In some embodiments, the PCR amplification reagent includes one or more of PCR buffer, multiplex amplification enzyme, and dNTPs.

[0013] This application also provides a method for constructing a library of mycobacterial genes, comprising the following steps:

[0014] Using the aforementioned nucleic acid combination product or the aforementioned mycobacterial identification kit, the template DNA is subjected to PCR amplification to obtain an amplicon library. The amplicon library is then mixed and purified to obtain a library of mycobacterial genes.

[0015] In some embodiments, the PCR amplification reaction includes a first amplification reaction and a second amplification reaction.

[0016] In some embodiments, the reaction system for the first step amplification reaction includes one or more of the aforementioned nucleic acid combination product, the nucleic acid of the sample to be tested, and the PCR amplification reagent.

[0017] In some embodiments, the reaction system for the second amplification reaction includes one or more of the products of the first amplification reaction, tag primers, and PCR amplification reagents.

[0018] This application also provides a library of mycobacterial genes obtained by the above-mentioned method for constructing a library of mycobacterial genes.

[0019] This application provides a nucleic acid combination product for mycobacterial detection, comprising one or more primer pairs with nucleotide sequences as shown in SEQ ID NO. 1 to SEQ ID NO. 244. This specific primer combination is capable of simultaneously detecting multiple mycobacteria and distinguishing them down to the subspecies level. Through highly specific primer design, this nucleic acid combination product can achieve accurate identification of common clinical mycobacteria (including complex groups, species, and subspecies levels), with a detection sensitivity of 50-100 CFU / mL, significantly superior to the detection performance of existing technologies. Furthermore, this nucleic acid combination product can not only identify the species of mycobacteria but also simultaneously detect drug resistance gene mutations, providing important evidence for the selection of clinical treatment regimens. Detailed Implementation

[0020] The present application will be further described in detail below with reference to the embodiments and examples. It should be understood that these embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the present application. The purpose of providing these embodiments and examples is to enable a more thorough and comprehensive understanding of the disclosure of the present application. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various modifications or alterations without departing from the spirit of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. Furthermore, numerous specific details are set forth in the following description to provide a fuller understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.

[0021] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0022] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:

[0023] The terms "and / or," "or / and," and "and / or" as used herein include any one of two or more of the related listed items, as well as any and all combinations of the related listed items. These arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or," "or / and," and "and / or," it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical AND," and also undoubtedly includes technical solutions connected by "logical OR." For example, "A and / or B" includes three parallel solutions: A, B, and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, a technical solution that is connected by "logical OR"), as well as any and all combinations of A, B, C, and D, that is, combinations of any two or three of A, B, C, and D, and also combinations of all four of A, B, C, and D (that is, a technical solution that is connected by "logical AND").

[0024] In this application, the terms "multiple", "various", "multiple times", "multi-dimensional", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0025] The terms “combinations of,” “any combination of,” and “any combination of” used in this article include all suitable combinations of any two or more of the listed items.

[0026] In this document, the term "suitable" as used in phrases such as "suitable combination," "suitable method," and "any suitable method" refers to the ability to implement the technical solution of this application, solve the technical problem of this application, and achieve the expected technical effect of this application.

[0027] In this application, terms such as "further," "even more," and "particularly" are used for descriptive purposes and to indicate differences in content, but should not be construed as limiting the scope of protection of this application.

[0028] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.

[0029] In this application, the technical features described in an open-ended manner include both closed technical solutions composed of the listed features and open technical solutions composed of the listed features.

[0030] In this application, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.

[0031] Unless otherwise specified, the temperature parameters in this application are permitted to be either constant-temperature treatment or variations within a certain temperature range. It should be understood that the constant-temperature treatment allows temperature fluctuations within the precision range of the instrument control, such as ±5℃, ±4℃, ±3℃, ±2℃, or ±1℃.

[0032] In this application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass-volume percentage.

[0033] All references to documents mentioned in this application are incorporated herein by reference as if each document were individually incorporated herein by reference. Unless they conflict with the inventive purpose and / or technical solution of this application, all cited documents are incorporated herein by reference in their entirety and for all purposes. When citing documents in this application, the definitions of relevant technical features, terms, nouns, phrases, etc., are also incorporated herein by reference. When citing documents in this application, examples and preferred embodiments of the cited technical features may also be incorporated herein by reference, but only to the extent that they enable the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or modifications shall be made adaptably to the description in this application.

[0034] The term "tag sequence" refers to a known sequence attached to the 5' end of a primer for subsequent detection, identification, or purification purposes. The main function of these tag sequences is to identify different samples and primers during sequencing, improving sequencing accuracy and throughput. The tag sequences are designed with sequencing platform compatibility in mind, ensuring perfect matching with BGI Genomics' MGISEQ or DNBSEQ sequencing platforms.

[0035] The term "mycobacterial subspecies level identification" refers to the ability to distinguish between different subspecies within the same mycobacterial species. In this application, through carefully designed primer combinations, it is possible to accurately distinguish subspecies such as *Mycobacterium abscessus* subsp. *abscessus* and *Massai* subspecies, or different subspecies within the *Mycobacterium avium* complex. Accurate subspecies level identification is crucial for clinical treatment because different subspecies may have different pathogenicities and drug susceptibility, requiring different treatment regimens. Traditional detection methods often struggle to achieve subspecies level differentiation, but this application achieves this goal through high-resolution primer design.

[0036] The term "two-step PCR amplification reaction" refers to a technical strategy that divides the PCR amplification process into two stages. In this application, the first stage uses a specific primer combination to target and amplify the target sequence, while the second stage incorporates tag primers for sample-specific barcode labeling. The main advantages of this two-step strategy are: the first stage specifically enriches the target sequence, improving detection sensitivity; and the second stage introduces sample identification through tag primers, facilitating simultaneous detection of multiple samples and subsequent data analysis. Two-step PCR amplification is an effective method for improving the detection performance of complex samples.

[0037] The term "drug resistance gene mutation site" refers to mutations in specific gene sites in the genome of pathogenic microorganisms that are associated with drug resistance. In this application, the focus is primarily on detecting common mutation sites in the 23S rRNA (rrl), 16S rRNA (rrs), and erm41 genes. Mutations at these sites can lead to resistance in mycobacteria to antibiotics such as macrolides and aminoglycosides. Detecting these mutation sites can predict the drug susceptibility of pathogens, providing crucial information for clinical treatment selection. Drug resistance gene detection is an important component of modern infectious disease diagnosis and is of great significance for precision medicine.

[0038] The term "targeted next-generation sequencing (tNGS)" refers to a technique that uses specific primers to enrich target regions before performing high-throughput sequencing. Compared to metagenomic sequencing (mNGS), tNGS significantly improves the detection sensitivity and sequencing data utilization of target pathogens through targeted enrichment, making it more feasible and cost-effective for analyzing drug resistance genes. In this application, target sequences of mycobacteria were enriched using specific primer combinations, followed by high-throughput sequencing, enabling simultaneous and accurate identification and drug resistance analysis of multiple mycobacteria. tNGS technology is currently a cutting-edge technology in the field of pathogen detection.

[0039] The term "limit of detection" refers to the lowest concentration of a target analyte that a detection method can reliably detect. In this application, the limit of detection is expressed in CFU / mL (colony-forming units per milliliter), representing the lowest detectable bacterial concentration. Example 2 shows that the detection system of this application achieves a limit of detection of 50 CFU / mL for Mycobacterium tuberculosis, Mycobacterium kansas, and Mycobacterium abscessis, and a limit of detection of 100 CFU / mL for other mycobacteria. This limit of detection is significantly superior to traditional PCR, multiplex PCR, or PCR-based flow cytometry detection techniques, and can meet the needs of early clinical diagnosis.

[0040] The term "Barcode sequence" refers to a unique DNA sequence used to identify different samples in a sequencing library. In this application, the MGI-UDB tag primers contain 10-base barcode sequences with 288 different numbers, each with a unique barcode sequence. The main function of the barcode sequence is to distinguish different samples during simultaneous sequencing of multiple samples, avoiding cross-contamination and improving throughput and efficiency. The design of the barcode sequence needs to consider the differences between sequences, ensuring that each barcode sequence differs by at least 2-3 bases to guarantee accurate differentiation after sequencing.

[0041] This application provides a nucleic acid combination product comprising one or more primer pairs with nucleotide sequences as shown in SEQ ID NO.1 to SEQ ID NO.244.

[0042] This application provides a nucleic acid combo product for mycobacterial detection, comprising a specific primer combination capable of simultaneously detecting multiple mycobacteria and distinguishing them down to the subspecies level. The primer combination includes primer pairs targeting species and subspecies-specific sequences of mycobacteria. This nucleic acid combo product, through highly specific primer design, can achieve accurate identification of 58 clinically common mycobacteria (including complex, species, and subspecies levels), with a detection sensitivity of 50-100 CFU / mL, significantly superior to the detection performance of existing technologies. Specifically, the primer combination can be derived from commercially synthesized oligonucleotide primers. Preferably, the primer length is 15-30 nucleotides, the Tm value is controlled within the range of 55-65℃, and the GC content is controlled between 40-60% to ensure amplification efficiency and specificity.

[0043] In some embodiments, each primer in the primer pair is also tagged; the introduction of tag sequences facilitates subsequent sequencing platform identification and data analysis, improving detection accuracy and throughput. Specifically, the tag sequences are SEQ ID NO.245 and SEQ ID NO.246, where SEQ ID NO.245 is an F-tag and SEQ ID NO.246 is an R-tag, respectively tagged in SEQ ID NO.1-SEQ ID NO.122 and SEQ ID NO.123-SEQ ID NO.244, for labeling the forward and reverse primers.

[0044] In some embodiments, the nucleotide sequence of the tag is as shown in SEQ ID NO.245 or SEQ ID NO.246.

[0045] In some embodiments, the primer pair consists of an F primer and an R primer; the F primer has the nucleotide sequences shown in SEQ ID NO.1-SEQ ID NO.122; and the R primer has the nucleotide sequences shown in SEQ ID NO.123-SEQ ID NO.244.

[0046] This application also provides a kit for mycobacterial identification, the kit comprising the aforementioned nucleic acid combination product. This kit integrates a highly specific primer combination, providing an integrated solution for clinical mycobacterial detection, and has advantages such as ease of operation, rapid detection, and accurate results.

[0047] In some embodiments, the kit further includes one or more of PCR amplification reagents, negative controls, and positive controls;

[0048] In some embodiments, the PCR amplification reagent includes one or more of PCR buffer, multiplex amplification enzyme, and dNTPs. The inclusion of these components ensures the integrity and standardization of the kit, improving the reliability and reproducibility of the assay. Specifically, the multiplex amplification enzyme may be selected from Taq DNA polymerase, high-fidelity DNA polymerase, etc.; the dNTPs concentration is 10 mM; the negative control is nuclease-free water, and the positive control is a solution containing a known concentration of mycobacterial DNA.

[0049] This application also provides a method for constructing a library of mycobacterial genes, comprising the following steps:

[0050] Using the aforementioned nucleic acid combination product or the aforementioned mycobacterial identification kit, template DNA is subjected to PCR amplification to obtain an amplicon library. The amplicon library is then mixed and purified to obtain a library of mycobacterial genes. This method, through a two-step PCR amplification strategy, significantly improves the detection sensitivity of low-abundance targets, and the constructed library is of high quality, suitable for high-throughput sequencing platforms.

[0051] In some embodiments, the PCR amplification reaction includes a first amplification reaction and a second amplification reaction.

[0052] In some embodiments, the reaction system for the first step amplification reaction includes one or more of the aforementioned nucleic acid combination product, the nucleic acid of the sample to be tested, and the PCR amplification reagent.

[0053] The reaction system for the second-step amplification reaction includes one or more of the products from the first-step amplification reaction, tag primers, and PCR amplification reagents.

[0054] Another aspect of this application provides a library of mycobacterial genes obtained by the method for constructing the library of the aforementioned mycobacterial genes.

[0055] The highly specific primer combination design of this scheme can achieve accurate identification of multiple mycobacteria at the same time, with detection resolution reaching the subspecies level. This solves the problem that existing technologies are unable to distinguish subspecies and provides an important basis for precision clinical treatment.

[0056] This approach significantly improves detection sensitivity through an optimized two-step PCR amplification method and primer pool grouping strategy, achieving a detection limit of 50-100 CFU / mL, which is superior to traditional PCR and multiplex PCR detection technologies and can meet the needs of early clinical diagnosis.

[0057] This solution integrates mycobacterial identification and drug resistance gene detection functions, providing pathogen identification and drug sensitivity information in a single test. This provides a comprehensive basis for the selection of clinical treatment plans and avoids the cumbersome process of multiple tests.

[0058] The nucleic acid combination products and kits of this application have good standardization and reproducibility, are suitable for various clinical sample types and different sequencing platforms, and have broad clinical application prospects and practical value.

[0059] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0060] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0061] It should be understood that in the various embodiments of this application, the order of the above-mentioned processes does not imply the order of execution. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0062] Example 1

[0063] The specific technical solution adopted in this application is as follows:

[0064] 1. Primer design and synthesis

[0065] This application designed and screened 122 primer pairs covering common mutation sites of 58 clinically common mycobacteria (including complex, species, and subspecies levels) and 23S rRNA (rrl) and 16S (rrs) drug resistance genes. The pathogen and primer sequences are shown in Table 1.

[0066] Table 1: Primer sequences for species and drug resistance gene mutations:

[0067]

[0068]

[0069] Primers were synthesized based on the designed primer sequences and mixed into one pool, named YK MTB2 panelMix.

[0070] The 5' end of the primer must also include the MGI-UDB universal tag sequence, wherein:

[0071] SEQ ID NO.1-SEQ ID NO.122 need to be marked with an F-tag:

[0072] TCACAGAACGACATGGCTACGATCCGACTt (SEQ ID NO. 245);

[0073] SEQ ID NO.123-SEQ ID NO.244 need to be tagged with R:

[0074] GTCTTCCTAAGACCGCTTGGCCTCCGACTT (SEQ ID NO. 246).

[0075] 2. Sample pretreatment and nucleic acid extraction

[0076] The sample types involved in this application mainly include bronchoalveolar lavage fluid, sputum, pleural effusion, ascites, cerebrospinal fluid, synovial fluid, ocular secretions, pus / drainage fluid, and various deep tissues (eyes, joints, etc.). It is recommended to collect samples according to the microbiological testing sample collection standards. For tissue samples, a sample size the size of a soybean is required; for bronchoalveolar lavage fluid, sputum, cerebrospinal fluid, synovial fluid, ocular secretions, and pus / drainage fluid, a sample size of at least 1 mL is required; and for pleural and ascites fluid, a sample size of at least 5 mL is required. Samples should be processed and stored at 2℃~8℃ within 24 hours of collection. For long-term storage, samples should be stored at -20℃ or -80℃.

[0077] Take 10 mL of pleural and peritoneal fluid sample and centrifuge it (12000 rpm, 10 min) before extraction. Remove the supernatant and take 800 μL of the lower precipitate.

[0078] Before nucleic acid extraction, the sample needs to be cell-wall ruptured: take out the grinding tube, add 1000uL of lysis buffer to the grinding tube, add 800μL of the sample to be tested; perform cell-wall rupture on the cell-wall breaker (power 165W; speed 18M / s) for 420s.

[0079] Nucleic acid extraction: Nucleic acid was extracted from the above samples using acid extraction or purification reagents (magnetic bead method) from Guangzhou Da An Gene Co., Ltd.

[0080] 1) Take the supernatant of the sample after cell wall disruption and place it in a 2mL centrifuge tube. Add 30μL of high-affinity silica-based magnetic beads and 40μL of proteinase K, and vortex thoroughly to mix.

[0081] 2) Place the centrifuge tubes in a constant temperature shaking metal bath and incubate at 70°C for 12 minutes (rotation speed of 1000 rpm / min). After standing, centrifuge briefly.

[0082] 3) Place the centrifuge tube on the magnetic rack. After the magnetic beads are completely attracted, carefully remove the liquid with a pipette, being careful not to pick up the magnetic beads.

[0083] 4) Add 800µL of washing solution 1 to the centrifuge tube, vortex to mix for 1 min, let stand, and then centrifuge briefly.

[0084] 5) Place the centrifuge tube on the magnetic rack. After the magnetic beads are completely attracted, carefully remove the liquid with a pipette, being careful not to pick up the magnetic beads.

[0085] 6) Add 800µL of washing solution 2 to the centrifuge tube, vortex to mix for 1 min, let stand, and then centrifuge briefly.

[0086] 7) Place the centrifuge tube on the magnetic rack. After the magnetic beads are completely attracted, carefully remove the liquid with a pipette, being careful not to pick up the magnetic beads.

[0087] 8) Repeat steps 6) and 7).

[0088] 9) Centrifuge the centrifuge tube briefly for 10 seconds, place the centrifuge tube on a magnetic rack, and after the magnetic beads are completely attracted, carefully remove the liquid with a pipette, being careful not to suck up the magnetic beads. Open the cap and let it air dry for 5 minutes.

[0089] 10) Add 100µL of elution buffer to the centrifuge tube, vortex to mix, incubate at room temperature for 5 min, place on a magnetic rack, and after the magnetic beads are completely adsorbed, transfer the nucleic acid solution to a new sterile centrifuge tube.

[0090] DNA quantification was performed using a Qubit 4.0 nucleic acid quantification instrument. If subsequent experiments are not immediately conducted after nucleic acid extraction, the extracted nucleic acid can be stored at -20℃ (within 1 month). A nucleic acid extraction concentration ≥0.1 ng / µL is considered acceptable; >0.01 ng / µL and <0.1 ng / µL indicates a risk assessment.

[0091] 3. Library construction and sequencing

[0092] Multiplex PCR library construction was performed using a multiplex library reconstruction kit. The first amplification step used YK MTB2 Panel Mix primers to amplify the target sequence of the pathogen of interest. The second amplification step used MGI-UDB tag primers (two primers, one upstream and one downstream) to add a sample-specific barcode sequence to the amplified product sequence to identify different samples. There are currently 288 numbered MGI-UDB tag primers, each containing at least one unique barcode sequence (10 bases). The library construction system described in this application is suitable for the MGISEQ or DNBSEQ sequencing platforms from BGI Genomics.

[0093] (1) The first step of amplification involved a DNA template amount of 0.1 ng to 500 ng, and the reaction system is shown in the table below. The final concentration of the primers for the microbial and drug-resistant genes in the YK MTB2Panel Mix was 0.1 μM; the final concentration of the human internal reference gene primers was 0.05 μM. The results are shown in Table 2.

[0094] Table 2

[0095]

[0096] The reaction procedure is shown in Table 3 below:

[0097] Table 3

[0098]

[0099] (2) Purification of the first step amplification product: 40 μL of nuclease-free water was added to the first step amplification product. The first step amplification product was adsorbed with 50 μL of MagPure A3 XP 1 beads (1.2× ) DNA purification magnetic beads. The product was washed twice with 200 μL of freshly prepared 80% ethanol. The remaining 80% ethanol in the tube was discarded as much as possible. The tube was placed at room temperature until dry. Finally, the magnetic beads were resuspended in 23 μL of nuclease-free water (NFW) and eluted to obtain the purified product. The tube was then placed in a -20℃ refrigerator.

[0100] (3) The second step of the amplification reaction, the reaction system is shown in the table below, where MGI-UDB is a sample-specific barcode sequence universal amplification primer as shown in Table 4:

[0101] Table 4

[0102]

[0103] The reaction procedure is shown in Table 5 below:

[0104] Table 5

[0105]

[0106] (4) Second step of amplification product sorting: After the library amplification is completed, briefly centrifuge the reaction tube, add 40 μL of DNA purification magnetic beads to the PCR product, mix well, and incubate at room temperature for 5 min; briefly centrifuge, place on a magnetic rack, discard the supernatant, add 200 μL of 80% ethanol, let stand for 30 s, discard the supernatant, and repeat once; centrifuge for 5 s, place on a magnetic rack, and discard the residual liquid; air dry the magnetic beads, add 40 μL of Nuclease-free water to resuspend the magnetic beads, mix well, and let stand for 2 min; briefly centrifuge, place on a magnetic rack, and transfer 38 μL of supernatant to a new low-adsorption tube.

[0107] (5) The library concentration was determined using Qubit4.0. A concentration ≥0.1 ng / μL indicates that the library concentration is qualified. The elution product at this point is a library ready for use and should be stored in a -20°C freezer for long-term storage.

[0108] (6) Sequencing: Based on the throughput and total library volume requirements of the sequencer, as well as the concentration of the sample library, all libraries are mixed together, DNB amplification is performed, and then sequencing is performed. The amount of data is allocated according to 1 M reads. Sequencing adopts a single-end 50bP (SE 50) or single-end 100bP (SE100) strategy.

[0109] 4. Data Analysis

[0110] (1) Data quality control filtering

[0111] The raw test data was filtered using FastP software (v0.22.0). The filtering parameters were: a) removal of sequences containing adapters (dimers); b) removal of sequences with an average base quality control below 15 and sequences with an N-number greater than 5; c) a minimum trimming length of 10 bp for PolyG tails and a trimming length of 10 bp for the 3-terminal PolyX tails. The filtered Clean FASTQ file was obtained after the above processing.

[0112] (2) Database comparison

[0113] Clean FASTQ sequences are aligned with target amplified sequences using BWA mem (v0.7.17) to obtain alignment sam files. Statistical scripts are used to analyze the sam files, retaining results with a similarity of more than 90% to the target amplified sequences, and calculating the total number of each target amplified sequence.

[0114] (3) Drug resistance mutation analysis

[0115] The SAM file obtained in step 2 was subjected to mutation analysis using bcftools software. The results were matched with a database of known mutation sites to obtain the total number of mutation sequences and mutation frequency.

[0116] (4) Data statistics

[0117] The script annotates the database alignment results and mutation analysis results to the species information, obtaining the number of detected sequences, the total number of drug-resistant gene sequences, and the mutation frequency for each species.

[0118] Example 2:

[0119] Based on the analytical sensitivity / limit of detection analysis of species within the detection range in this application.

[0120] Positive reference standard tNGSMIXA and negative reference standard NC were prepared using known concentrations of Mycobacterium tuberculosis and non-tuberculous mycobacteria, respectively. tNGS MIXA was diluted to different final concentrations, with HeLa cells (concentration 2.00E+05 cells / mL) as the substrate. The pathogens and concentrations included in all mycobacterial detection limit reference standards are shown in Table 6 below.

[0121] Table 6

[0122]

[0123] The above MTB2 Panel assay was performed using positive and negative references at all concentration gradients, with each gradient tested in triplicate. The limit of detection (LOD) / analytical sensitivity was analyzed based on the number of sequences analyzed and the judgment results. The statistical results of pathogen detection reads for each gradient of positive references are as follows: A positive threshold of ≥10 reads was used. The LOD for various pathogens was determined by comparing and analyzing the above detection results, as shown in Table 7.

[0124] Table 7

[0125]

[0126] The above-mentioned detection kit has a detection limit of 50 CFU / mL for Mycobacterium tuberculosis, Mycobacterium kansas, and Mycobacterium abscessis; and a detection limit of 100 CFU / mL for Mycobacterium guilloché, Mycobacterium occulta, Mycobacterium paracellularis, and Mycobacterium avium. The overall species detection limit is 50 CFU / mL to 100 CFU / mL. The detection limits for all of these species meet or exceed those of traditional PCR, multiplex PCR, or PCR-based flow cytometry detection techniques.

[0127] Example 3:

[0128] MTB2 Panel for the identification of different subspecies of Mycobacterium abscessus

[0129] The above-mentioned MTB Panel was used to detect subspecies of Mycobacterium abscessis that had been identified. The identification performance of MTB2 Panel for Mycobacterium abscessis subspecies was analyzed. The test results are shown in Table 8 below:

[0130] Table 8

[0131]

[0132] The above-mentioned test kit is highly specific for the identification of Mycobacterium abscessus subspecies, and the species detection resolution reaches the subspecies level.

[0133] Example 4:

[0134] Identification of different subspecies of the Mycobacterium avium complex using the MTB2 Panel

[0135] For strains of the Mycobacterium avium complex with subspecies identification results (using the Zhisheng Biotechnology 19 Mycobacterium Rapid Molecular Diagnostic Detection Kit), the above-mentioned MTB2 Panel was used for detection. The accuracy of the MTB2 Panel in identifying subspecies of the Mycobacterium avium complex was analyzed. The detection results are shown in Table 9 below:

[0136] Table 9

[0137]

[0138] The results of the rapid molecular diagnostic test kit for 19 mycobacteria from Zhishan Biotechnology showed low accuracy in identifying the Mycobacterium avium complex, while the results of this application were completely consistent with the results of whole genome sequencing (WGS), indicating that the detection involved in this application is more specific for identifying subspecies of the Mycobacterium avium complex.

[0139] Example 5:

[0140] Concordance analysis between MTB2 Panel and rapid molecular diagnostics for 19 mycobacteria

[0141] The clinical samples (BALF and sputum, etc.) were tested using the above-mentioned MTB Panel. The inclusion criteria for clinical samples included: 1) patients suspected of having mycobacterial infection; 2) patients with poor response to treatment for Mycobacterium tuberculosis infection and suspected of having other mycobacterial infections.

[0142] To compare the consistency between the two methods, qPCR or WGS verification is required for inconsistent results. The qPCR or WGS verification results and clinical diagnostic results are used as the standard, and the positive / negative concordance rate is calculated. Because the rapid molecular diagnostic kit for mycobacteria (19 species) has certain limitations (i.e., intracellular mycobacteria and avian mycobacteria may cross-react with other species in the avian mycobacteria complex outside the kit's detection range), for inconsistencies among species within the avian mycobacteria complex, the WGS confirmation result is used as the standard, and the rapid molecular diagnostic results for mycobacteria (19 species) are analyzed uniformly. The positive / negative concordance rate analysis between the MTB2 Panel and the rapid molecular diagnostic kit for 19 mycobacteria is shown in Table 10 below:

[0143] Table 10

[0144]

[0145] The positive concordance rate of the above test kits was 97.88% (139 / 142), the negative concordance rate was 71.42% (20 / 28), and the overall concordance rate was 93.52% (159 / 170).

[0146] Among the three samples that were positive for rapid molecular diagnosis of mycobacteria but negative for tNGS: one was clinically diagnosed with pulmonary tuberculosis and consistent with the rapid molecular diagnosis result of mycobacteria; one was diagnosed with mycobacteria spp. and clinically diagnosed with tuberculosis; and one was diagnosed with mycobacteria spp. but the clinical diagnosis was unclear.

[0147] In 12 samples with negative rapid molecular diagnosis of mycobacteria but positive tNGS test results, the clinical diagnosis was tuberculous or non-tuberculous mycobacterial disease, consistent with the tNGS test results; in 16 samples with negative rapid molecular diagnosis and negative tNGS test results of mycobacteria, 5 cases were clinically diagnosed as tuberculous or non-tuberculous mycobacterial disease, and 11 cases were not diagnosed as mycobacterial disease.

[0148] Using clinical diagnosis as the gold standard (excluding one sample with an unclear diagnosis), the accuracy of tNGS detection was 95.85% (162 / 169), while the accuracy of rapid molecular diagnosis for mycobacteria was 89.34% (151 / 169), with a significant difference between the two (chi-square test, P=0.02). From a clinical perspective, the MTB2 Panel kit outperforms the rapid molecular diagnosis for mycobacteria (19 types).

[0149] Example 6:

[0150] MTB2 Panel analysis of Mycobacterium avium complex and Mycobacterium abscessis drug resistance genes and comparison with drug susceptibility results.

[0151] For strains with phenotypic drug susceptibility (PDST) results, the above-mentioned MTB2 Panel was used for detection, and the PDST results were analyzed as the gold standard. The results are shown in Table 11 below.

[0152] Table 11

[0153]

[0154] The above-mentioned test kits are highly specific for identifying Mycobacterium avium complex and Mycobacterium abscessus subspecies, and the results of drug resistance gene detection are 100% consistent with the PDST results.

[0155] The above examples illustrate this application only to help understand it and are not intended to limit the scope of this application or its application.

[0156] In summary, this application primarily provides a detection protocol covering a variety of mycobacterial infection-related pathogens, while also efficiently detecting drug resistance gene mutations. Compared to traditional culture methods, it offers significant advantages in detection time; compared to molecular detection methods such as PCR, this application boasts higher throughput, wider range, and greater sensitivity; and compared to mNGS detection, its detection cost is lower. Overall, this application provides a more clinically applicable solution for detecting common mycobacterial infection pathogens and drug susceptibility.

[0157] The embodiments described above are merely illustrative of several implementation methods of this application, intended to facilitate a detailed understanding of the technical solutions of this application, but should not be construed as limiting the scope of protection of the patent application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the scope of protection of this application. Furthermore, it should be understood that after reading the above teachings of this application, those skilled in the art can make various alterations or modifications to this application, and the equivalent forms obtained also fall within the scope of protection of this application. It should also be understood that technical solutions obtained by those skilled in the art based on the technical solutions provided in this application through logical analysis, reasoning, or limited experimentation are all within the scope of protection of the appended claims. Therefore, the scope of protection of this patent application should be determined by the content of the appended claims, and the specification can be used to interpret the content of the claims.

Claims

1. A nucleic acid combination product, characterized in that, The nucleic acid combination product includes one or more primer pairs with nucleotide sequences as shown in SEQ ID NO.1 to SEQ ID NO.

244.

2. The nucleic acid combination product according to claim 1, characterized in that, Each primer in the primer pair is also attached to a tag.

3. The nucleic acid combination product according to claim 2, characterized in that, The nucleotide sequence of the tag is shown in SEQ ID NO. 245 or SEQ ID NO.

246.

4. The nucleic acid combination product according to claim 3, characterized in that, The primer pairs are divided into F primers and R primers; The F primer has the nucleotide sequences shown in SEQ ID NO.1-SEQ ID NO.122; The R primer has the nucleotide sequences shown in SEQ ID NO.123-SEQ ID NO.

244.

5. A kit for identifying mycobacteria, characterized in that, The kit comprises the nucleic acid combination product according to any one of claims 1 to 4.

6. The kit for mycobacterial identification according to claim 5, characterized in that, The kit also includes one or more of PCR amplification reagents, negative controls, and positive controls; Optionally, the PCR amplification reagent includes one or more of PCR buffer, multiplex amplification enzyme, and dNTPs.

7. A method for constructing a library of mycobacterial genes, characterized in that, Includes the following steps: Using the nucleic acid combination product of any one of claims 1 to 4 or the kit for mycobacterial identification of any one of claims 5 to 6, the template DNA is subjected to PCR amplification to obtain an amplicon library. The amplicon library is then mixed and purified to obtain a library of mycobacterial genes.

8. The method for constructing a mycobacterial gene library according to claim 7, characterized in that, The PCR amplification reaction includes a first amplification reaction and a second amplification reaction.

9. The method for constructing a mycobacterial gene library according to claim 8, characterized in that, The reaction system for the first-step amplification reaction comprises one or more of the following: the nucleic acid combination product as described in any one of claims 1 to 4, the nucleic acid of the sample to be tested, and the PCR amplification reagent; and / or The reaction system for the second-step amplification reaction includes one or more of the products from the first-step amplification reaction, MGI-UDB tag primers, and PCR amplification reagents.

10. A library of mycobacterial genes obtained by the method for constructing a library of mycobacterial genes according to any one of claims 7 to 9.

Images