RPA primer, kit for detecting escherichia coli and application thereof
By designing highly specific RPA primers combined with recombinase polymerase isothermal amplification technology, the problem of rapid detection of E. coli at the grassroots level and on-site has been solved, achieving rapid and sensitive detection results, which are suitable for environmental monitoring and public health.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- BEIJING PURKINJE GENERAL INSTR
- Filing Date
- 2026-05-11
- Publication Date
- 2026-06-09
AI Technical Summary
Existing technologies are insufficient for rapid, convenient, and sensitive detection of E. coli at the grassroots level and on-site. Traditional methods are time-consuming and require complex equipment, while PCR technology is costly and difficult to popularize.
An RPA primer was designed based on a novel target DNA sequence that is broad-spectrum and specific in E. coli. It was combined with recombinase polymerase isothermal amplification technology, detected using a constant temperature device, and the results were interpreted by agarose gel electrophoresis or colorimetry.
It enables rapid detection of E. coli at room temperature, completing the test within 30 minutes, with a sensitivity of up to 10¹ copies/µL. It is suitable for grassroots and field testing and applicable to environmental monitoring and public health fields.
Smart Images

Figure CN122168784A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological detection technology, specifically relating to an RPA primer, kit, and application for detecting Escherichia coli. Background Technology
[0002] Escherichia coli ( Escherichia coli Escherichia coli (E. coli) are common Gram-negative bacilli found in nature, widely distributed in the intestines of humans and warm-blooded animals, as well as in natural water bodies and soil environments. The vast majority of E. coli strains are non-pathogenic and are an important component of the normal intestinal flora, participating in host metabolism and immune regulation. However, some pathogenic strains, such as O157:H7 and enteropathogenic E. coli (ETEC), can invade the human body through contaminated food and drinking water, inducing food poisoning, acute diarrhea, urinary tract infections, and in severe cases, even fatal complications such as hemolytic uremic syndrome (HUS), posing a significant threat to public health, food safety, and human health.
[0003] Currently, traditional methods for detecting E. coli mainly rely on culture and isolation combined with biochemical identification. This method involves inoculating samples into selective culture media, followed by separation and purification, and then biochemical verification. It boasts advantages such as high accuracy and relatively low cost, making it a classic method for laboratory testing. However, this method has significant limitations. The detection cycle is relatively long, typically requiring 24-48 hours to obtain definitive results, which cannot meet the needs of rapid detection during public health emergencies. Furthermore, this method demands a high level of expertise in the experimental environment, culture conditions, and the operators' technical skills, making it difficult to widely apply in primary healthcare institutions, food production enterprises, and on-site testing scenarios.
[0004] The advent of polymerase chain reaction (PCR) technology has significantly improved the efficiency of E. coli detection. By specifically amplifying the target nucleic acid sequence, it shortens the detection time to several hours and also improves sensitivity compared to traditional methods. However, PCR technology relies on sophisticated thermal cycling equipment, requiring strict control of temperature rise and fall procedures. This results in high equipment costs and complex operating procedures, making it difficult to adapt to testing scenarios in grassroots communities and field settings where professional laboratory facilities are lacking. Furthermore, the minimum detection limit of conventional PCR technology still has room for improvement, and the accuracy of detecting low-concentration contaminated samples needs further optimization. Therefore, developing a field detection technology that is rapid, highly sensitive, easy to operate, and requires no complex instruments is key to overcoming the current challenges in E. coli detection.
[0005] In recent years, to overcome the limitations of traditional nucleic acid amplification technologies, isothermal amplification technology has developed rapidly. Among them, recombinase polymerase isothermal amplification (RPA) technology has shown great application potential in the field of microbial detection due to its unique advantages. RPA technology integrates the synergistic effects of recombinase, single-strand binding protein, and strand displacement polymerase. It eliminates the need for high-temperature denaturation steps and can achieve efficient and specific amplification of target DNA at room temperature conditions of 25-45℃. The amplification efficiency is comparable to PCR technology, and the detection sensitivity is significantly higher than that of traditional PCR. More importantly, RPA technology does not rely on thermal cycling instruments. Only a simple constant temperature device (such as a constant temperature water bath or thermos) is needed to complete the reaction. The operation process is simple, requiring no professional technicians to be on duty. It is perfectly adapted to rapid detection scenarios such as grassroots and field, and can realize the detection needs of "immediate sampling and testing, and rapid results".
[0006] The key to achieving accurate detection of *E. coli* lies in screening for "broad-spectrum and specific" target DNA sequences—that is, sequences that are highly conserved in the genomes of different *E. coli* strains (including pathogenic and non-pathogenic strains), ensuring broad-spectrum detection; simultaneously, sequences that are absent or highly non-conserved in the genomes of non-*E. coli* strains, ensuring specific detection. Although some conserved target DNA sequences for detecting *E. coli* already exist in this field, such as... UidA Gene or rfbE While genes can be used as target DNA sequences for the detection of RPA in E. coli, the sensitivity of such detection methods still needs improvement. Summary of the Invention
[0007] The purpose of this invention is to provide an RPA primer, a kit, and their applications for detecting Escherichia coli. The RPA primer is designed with a novel target DNA sequence that is broad-spectrum and specific to Escherichia coli, and it has high sensitivity, strong specificity, and a short detection cycle.
[0008] This invention provides an RPA primer for detecting Escherichia coli, wherein the RPA primer is designed with the nucleotide sequence shown in SEQ ID NO:1 as the target sequence.
[0009] Preferably, the upstream and downstream primers of the RPA primers are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively.
[0010] The present invention also provides a kit for detecting Escherichia coli, the kit comprising RPA nucleic acid amplification reagent and the RPA primers described in the above technical solution.
[0011] Preferably, the RPA nucleic acid amplification reagent includes basic RPA nucleic acid amplification reagent and / or fluorescent RPA nucleic acid amplification reagent.
[0012] Preferably, the kit also includes a positive control and / or a negative control.
[0013] This invention also provides the application of the RPA primers or kits described in the above technical solutions in the detection of Escherichia coli.
[0014] Preferably, the Escherichia coli includes pathogenic Escherichia coli.
[0015] This invention also provides an RPA detection method for detecting Escherichia coli, comprising the following steps: Extract genomic DNA from the sample to be tested; The genomic DNA was amplified at an isothermal temperature using RPA primers to obtain isothermal amplification products; the RPA primers are the RPA primers described in the above technical solution or the RPA primers in the kit described in the above technical solution. The results are interpreted based on the isothermal amplification products, and the methods for interpreting the results include the following 1) and / or 2): 1) Mix the isothermal amplification product with the loading buffer and incubate. Perform agarose gel electrophoresis on the resulting reaction solution. If a specific band of 241 bp appears, the sample is determined to be positive for E. coli. If no specific band appears or multiple specific bands appear, the sample is determined to be negative for E. coli. 2) Place the isothermal amplification product under a pure, unblemished background and observe it. Determine the result based on the color. If the isothermal amplification product is magenta or orange-red, the sample is determined to be positive for E. coli. If the isothermal amplification product is yellow, the sample is determined to be negative for E. coli.
[0016] Preferably, the isothermal amplification system, in 50 µL, includes 29.4 µL of A Buffer, 2 µL each of upstream and downstream primers, 2.5 µL of B Buffer, ddH2O, and 14.1 µL of genomic DNA. The isothermal amplification procedure is to incubate at 25~45℃ for 30 min.
[0017] Preferably, the sample to be tested includes one or more of water, food, and environmental samples.
[0018] Beneficial effects: This invention provides an RPA primer for detecting *Escherichia coli*, which is designed using the nucleotide sequence shown in SEQ ID NO:1 as the target sequence. The target sequence described in this invention is a novel target DNA sequence that is broad-spectrum and specific to *E. coli*. The RPA primers designed using this sequence can be used for isothermal amplification reactions of recombinase polymerase in *E. coli*, exhibiting high sensitivity, strong specificity, and a short detection cycle.
[0019] Based on this, the present invention provides an RPA detection method for detecting Escherichia coli using the aforementioned RPA primers. Results from the examples show that, compared with existing PCR detection techniques, the isothermal amplification detection method of the present invention can rapidly detect Escherichia coli at room temperature or with slight heating, completing the detection within 30 minutes, significantly improving detection efficiency. Furthermore, the detection method of the present invention requires no complex equipment, making it suitable for rapid on-site detection, particularly in water quality monitoring and public health fields. In addition, its detection sensitivity can detect sensitivities as low as 10. 1 The sensitivity of this method for detecting *E. coli* copies / µL is far superior to that of traditional PCR detection techniques. Therefore, this invention provides a rapid, sensitive, and convenient solution for detecting *E. coli* contamination, widely applicable in fields such as environmental monitoring, public health, and food safety. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0021] Figure 1 The electrophoretic detection and screening results of the RPA primer set in Example 1; Figure 2 The results of RPA-specific detection in Escherichia coli in Example 2; Figure 3 The graph shows the detection limit of RPA for Escherichia coli in Example 3. Detailed Implementation
[0022] This invention provides an RPA primer for detecting Escherichia coli, wherein the RPA primer is designed with the nucleotide sequence shown in SEQ ID NO:1 as the target sequence.
[0023] As one implementation, the upstream and downstream primers of the RPA primers are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively.
[0024] This invention also provides a kit for detecting *Escherichia coli*, the kit comprising RPA nucleic acid amplification reagent and the RPA primers described in the above-described technical solution. As one embodiment, the RPA nucleic acid amplification reagent of this invention comprises basic RPA nucleic acid amplification reagent and / or fluorescent RPA nucleic acid amplification reagent. This invention does not specifically limit the source of the RPA nucleic acid amplification reagent; commercially available RPA nucleic acid amplification reagents from conventional sources in the art can be used. For example, the RPA nucleic acid amplification reagent used in the embodiments of this invention was purchased from Anpu Future (Changzhou) Biotechnology Co., Ltd., product number WLB8201KIT, 48T / box, but this should not be considered as the entire scope of protection of the RPA nucleic acid amplification reagent of this invention. As one embodiment, the kit of this invention also includes a positive control and / or a negative control; as another embodiment, the negative control can be sterile, enzyme-free water.
[0025] This invention also provides the application of the RPA primers or kits described in the above-described technical solutions in the detection of *Escherichia coli*. As one embodiment, the *Escherichia coli* includes pathogenic *Escherichia coli*. As one embodiment, the *Escherichia coli* can be, but is not limited to, *Escherichia coli* found in water, food, or the environment.
[0026] This invention also provides an RPA detection method for detecting Escherichia coli, comprising the following steps: Extract genomic DNA from the sample to be tested; The genomic DNA was amplified at an isothermal temperature using RPA primers to obtain isothermal amplification products; the RPA primers are the RPA primers described in the above technical solution or the RPA primers in the kit described in the above technical solution. The results are interpreted based on the isothermal amplification products, and the methods for interpreting the results include the following 1) and / or 2): 1) Mix the isothermal amplification product with the loading buffer and incubate. Perform agarose gel electrophoresis on the resulting reaction solution. If a specific band of 241 bp appears, the sample is determined to be positive for E. coli. If no specific band appears or multiple specific bands appear, the sample is determined to be negative for E. coli. 2) Place the isothermal amplification product under a pure, unblemished background and observe it. Determine the result based on the color. If the isothermal amplification product is magenta or orange-red, the sample is determined to be positive for E. coli. If the isothermal amplification product is yellow, the sample is determined to be negative for E. coli.
[0027] The present invention does not impose any particular limitation on the extraction method of the genomic DNA; conventional genomic DNA extraction methods in the art can be used.
[0028] In one embodiment, the isothermal amplification system of the present invention, in 50 µL volume, includes 29.4 µL of Buffer A, 2 µL each of upstream and downstream primers, 2.5 µL of Buffer B, ddH2O, and 14.1 µL of genomic DNA. In another embodiment, the isothermal amplification program is incubation at 25–45 °C for 30 min, and more specifically, incubation at 37 °C for 30 min. In yet another embodiment, the sample to be tested in the present invention includes one or more of water, food, and environmental samples.
[0029] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0030] Example 1 A rapid isothermal molecular detection method for RPA based on E. coli genome-specific DNA sequences, comprising the following steps: 1. Determination of the target sequence DNA sequences that are highly conserved in the genomes of different E. coli strains, but absent or non-conserved in the genomes of non-E. coli strains, were screened as potential target sites for rapid molecular detection of E. coli. The sequences obtained are as follows: CATGGCAATATTTTTGCGATTACGGAAAAACAAATCACATCTTAATTACTGTTGGTAACCATCAGCAAGAGTATCATTGGTTTTTCGATACTGAATCTTTTTTATCCGAAGCAGGTCACATTTATGGCCTGATAAATACCTTTGTT AAAACTCACTTTTGTGTATTTCTCTCAAAATAATCCCCTGGAAATTATGCCGCGAGATTATAAAGTTCAGGATCATTCATTAGCAAACCATTCCCGCCCCACTCCCTGGGGCTTAAATCTCTTACAATTCACCGTTTGCAGGGCG (SEQ IDNO:1).
[0031] 2. Design of RPA detection primer pairs: Following the principles of RPA primer design, primers were designed using Primer Premier software based on the preliminarily determined sequences. Each primer pair consists of a front primer (F) and a back primer (R). Five sets of RPA detection primers were designed (RPA-1, RPA-2, RPA-3, RPA-4, and RPA-5), and the specific sequence information of the primers is shown in Table 1 below.
[0032] Table 1. Primer sequence listing for Escherichia coli RPA detection
[0033] 3. Preparation of the sample to be tested: Centrifuge to collect an appropriate amount of LB cultured Escherichia coli, resuspend in ddH2O, and heat at 95℃ for 10 min to lyse the bacteria and release the bacterial genomic DNA, which is the sample to be tested and serves as the template for RPA detection.
[0034] 4. Primer Screening: RPA primers were screened using the template obtained in step 2. The RPA nucleic acid amplification reagent was purchased from Anpu Future (Changzhou) Biotechnology Co., Ltd., product number WLB8201KIT, 48T / box. The specific screening steps were as follows: In a 50µL RPA system (29.4µL A Buffer, 2µL each of upstream and downstream primers RPA-F / R, 2.5µL B Buffer, 2µL genomic DNA template, 12.1µL ddH2O), RPA detection reaction systems for primer sets RPA-1 to RPA-5 were constructed. After incubation at 37℃ in a metal bath for 20 min, loading buffer was added, and the reaction was incubated at 65℃ for 5 min to terminate the reaction. The amplification products were then separated by agarose gel electrophoresis, and the electrophoretic products were detected using a gel imaging system. The screening results of the RPA primer sets are shown below. Figures 1-2 As shown, where, Figure 1 In the diagram, lane P represents the positive control result; lane N represents the recessive control result; and G5-G1 represent the results of E. coli amplification detection using primer sets RPA-5, RPA-4, RPA-3, RPA-2 to RPA-1, respectively.
[0035] Depend on Figure 1 The primer set RPA-2 was found to have clear bands and good stability, making it the optimal primer set. Therefore, primer set RPA-2 was ultimately selected as the primer set for the isothermal molecular detection of RPA in E. coli.
[0036] Example 2 The specificity detection method in Example 1 is performed using the following steps: Using the primer set RPA-2, amplification system, and amplification program obtained in Example 1, the amplification of *Escherichia coli* (E. coli) was simultaneously targeted. Escherichia coli , E. coli Different strains (JM109, DH5α, BL21, Top10, ATCC 25922, O157:H7) and Staphylococcus aureus ( Staphylococcus aureus ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa Streptococcus pneumoniae () Streptococcus pneumoniae ), Lactobacillus salivarius ( Ligilactobacillus salivarius ) Perform specificity testing, and the results are as follows Figure 2 As shown, 1-10 represent the amplification results of different strains of Escherichia coli (JM109, DH5α, BL21, Top10, ATCC 25922, O157:H7) as well as Staphylococcus aureus, Pseudomonas aeruginosa, Streptococcus pneumoniae, and Lactobacillus salivarius, respectively, and N represents the negative control.
[0037] Depend on Figure 2 The results show that only *E. coli* was detected; the other bacteria did not amplify and were not detected. This demonstrates that the RPA-2 primer set is well-conserved and specific, and can be used for specific isothermal molecular detection of *E. coli*.
[0038] Example 3 The sensitivity detection of the detection method in Example 1 is performed as follows: E. coli cultured in LB medium was serially diluted 10-fold with ddH2O (where 10... 0 and 10 -1 Both concentrations were further diluted 2-fold to establish bacterial suspension concentrations of 1.0 × 10⁻⁶. 4 CFU / µL ~1.0 / 2×10 -1 Genomic DNA of *E. coli* was extracted from a bacterial culture of CFU / µL and used as a template for RPA detection limit verification. Deionized water was used as a blank control instead of bacterial culture. Amplification was performed using the RPA detection system and method constructed in Example 1. The amplification and detection results are as follows: Figure 3 As shown, lanes 1-8 represent concentrations of E. coli of 10⁻⁶. 4 10 3 10 2 10 1 10 0 10 0 / 2、10 -1 10 -1 The results of RPA amplification at a concentration of / 2 CFU / µL, where P is the positive control and N is the recessive control; and the positive control used is the positive control from the kit with product number WLB8201KIT from Anpu Future (Changzhou) Biotechnology Co., Ltd.
[0039] Depend on Figure 3 It can be concluded that the appearance of electrophoretic bands is stable at 1.0 × 10⁻⁶. 1 CFU / µL means that the detection limit of RPA is approximately 10 E. coli per µL of sample.
[0040] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. An RPA primer for detecting Escherichia coli, characterized in that, The RPA primers were designed using the nucleotide sequence shown in SEQ ID NO:1 as the target sequence.
2. The RPA primer according to claim 1, characterized in that, The upstream and downstream primers of the RPA primers are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively.
3. A kit for detecting Escherichia coli, characterized in that, The kit includes RPA nucleic acid amplification reagent and the RPA primers as described in claim 1 or 2.
4. The reagent kit according to claim 3, characterized in that, The RPA nucleic acid amplification reagents include basic RPA nucleic acid amplification reagents and / or fluorescent RPA nucleic acid amplification reagents.
5. The kit according to claim 3 or 4, characterized in that, The kit also includes a positive control and / or a negative control.
6. The use of the RPA primers according to claim 1 or 2 or the kit according to any one of claims 3 to 5 in the detection of Escherichia coli.
7. The application according to claim 6, characterized in that, The Escherichia coli mentioned includes pathogenic Escherichia coli.
8. A method for detecting RPA in Escherichia coli, characterized in that, Includes the following steps: Extract genomic DNA from the sample to be tested; The genomic DNA was amplified at an isothermal temperature using RPA primers to obtain isothermal amplification products; the RPA primers are those described in claim 1 or 2 or those in the kit described in any one of claims 3 to 5; The results are interpreted based on the isothermal amplification products, and the methods for interpreting the results include the following 1) and / or 2): 1) Mix the isothermal amplification product with the loading buffer and incubate. Perform agarose gel electrophoresis on the resulting reaction solution. If a specific band of 241 bp appears, the sample is determined to be positive for E. coli. If no specific band appears or multiple specific bands appear, the sample is determined to be negative for E. coli. 2) Place the isothermal amplification product under a pure, unblemished background and observe it. Determine the result based on the color. If the isothermal amplification product is magenta or orange-red, the sample is determined to be positive for E. coli. If the isothermal amplification product is yellow, the sample is determined to be negative for E. coli.
9. The RPA detection method according to claim 8, characterized in that, The isothermal amplification system, in 50 µL volume, includes 29.4 µL of A Buffer, 2 µL each of upstream and downstream primers, 2.5 µL of B Buffer, ddH2O, and 14.1 µL of genomic DNA. The isothermal amplification procedure is to incubate at 25~45℃ for 30 min.
10. The RPA detection method according to claim 9, characterized in that, The samples to be tested include one or more of the following: water, food, and environmental samples.